CN102533747B - Single nucleotide polymorphisms (SNP) locus linked to sporisorium-reiliana-resistance-associated gene, molecular marker LSdCAP4 based on same and use of same - Google Patents
Single nucleotide polymorphisms (SNP) locus linked to sporisorium-reiliana-resistance-associated gene, molecular marker LSdCAP4 based on same and use of same Download PDFInfo
- Publication number
- CN102533747B CN102533747B CN 201210031191 CN201210031191A CN102533747B CN 102533747 B CN102533747 B CN 102533747B CN 201210031191 CN201210031191 CN 201210031191 CN 201210031191 A CN201210031191 A CN 201210031191A CN 102533747 B CN102533747 B CN 102533747B
- Authority
- CN
- China
- Prior art keywords
- snp
- head
- smut
- site
- corn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SNP locus linked to a sporisorium-reiliana-resistance-associated gene, a molecular marker LSdSCAP4 based on the same and use of the same and belongs to the technical field of genetic engineering. The SNP locus linked to the sporisorium-reiliana-resistance-associated gene, which is positioned in a nucleotide sequence represented by SEQ ID No.4. Based on the SNP locus, the invention constructs the molecular marker obviously associated with the major sporisorium-reiliana-resistance-associated locus, which consists of 119 nucleotides in SEQ ID No.1 in a sequence table. The molecular marker is obtained by converting the SNP-4ID sequence in a bin2.09 region of the major disease-resistance-associated locus maize genome, and the SNP-4ID sequence has 101 nucleotides in SEQ ID No.4 in the sequence table. The molecular marker can be used in sporisorium reiliana molecular marker assisted breeding and accelerate the breeding process of a maize disease resistance variety.
Description
Technical field
The present invention relates to a kind of SNP site and based on molecule marker and the application thereof of its exploitation, particularly a kind ofly imitate the molecule marker of chain SNP site, disease-resistant site and significant correlation and the application in corn anti-head-smut molecular mark with corn anti-head-smut master.Belong to gene engineering technology field.
Background technology
Corn (Zea mays) is important food and fodder crop, and having risen at China's maize sown area is that first, per unit area yield and gross output keep second, is only second to paddy rice (Li Shaokun, 2010).Along with the development of world economy, the raising of living standard, people are the rigidity growth to the demand trend of corn.The high yield of Maize Production, stable yields have risen to the material impact factor of world food safety and future economy Sustainable development, and maize diseases is one of key constraints, and improving the corn variety disease resistance is the basis of realizing stable and high yields, high-quality.Maize head smut (Sphacelotheca reiliana (K ü hn) Clint.) is the fungal disease that world's spring sowing arid, the corn producing region that cools generally take place, and also is one of main disease on China's Maize Production (northern spring maize district).2002 are only because of maize head smut, Direct Loss corn 1.2 hundred million kg of three provinces in the northeast of China, 9,600 ten thousand yuan of peasant's reduction of income (with 2002 corn unit prices, 0.8 yuan/kg) cause suitable serious economy loss (Wang Xiaoming etc., 2003).Utilize cultivation step and medical treatment maize head smut, both increased to produce and dropped into, brought environmental pollution again.In addition, forefathers' research has been found that and deposit anti-head-smut material (Wang Zhenhua, 2004 in corn germplasm; Sun Zhichao, 2007; Guo Manku, 2007; Wang Yan, 2010).Therefore, strengthen cultivating and promote disease-resistant variety and be effective measures the most, also is the effective way of agriculture low-carbon (LC) and Sustainable development.
The key of breeding for disease resistance is the assurance in the source of resisting and the understanding of enantiopathy rule.Forefathers studies show that corn belongs to quantitative character heredity, controlled by additivity and dominance, epistasis effect simultaneously the resistance of head smut bacterium, and wherein additive effect of gene accounts for leading role (Ma Bingyuan etc., 1983; Bemardo etc., 1992; Akhtar etc. 1990; Wang Zhenhua etc., 2006).(the BC of target group that utilizes different anti-head-smut corn germplasms to make up, F2:3 etc.) in Primary Location the quantitative character gene locus therefor of at least 15 relevant anti-head-smuts (QTL), wherein be positioned at the main effect QTL in the 2nd chromosomal bin2.09 zone, can in a plurality of researchs, be repeated to detect, average interpret table form variation rate about 35% (L ü etc., 1999; Lu etc., 1999; Li etc., 2008; Chen etc., 2008; Shi etc., 2010); Simultaneously, binding molecule information biology and functional genomics are also excavated a series of disease-resistant QTL, disease-resistant gene analogue (RGA, Resistance Gene Analog) candidate gene (TUGs, tentative unique genes) (Ji Hailian etc., 2007 relevant with the head smut resistance; Zhang Shuhong etc., 2007).But, do not have relevant anti-maize head smut master to imitate the molecular markers development in site and the report of utilization as yet in corn germplasm improvement at present and the marker assisted selection.Therefore, separate anti-head-smut major gene (or QTL), clear and definite its disease-resistant genetic mechanism, the development function molecule marker has become the target of next step research.Along with the continuous development of information biology, comparative genomics and functional genomics and perfect, the finishing and issuing of corn inbred line B73 examining order is for the excavation of corn important quantity character gene (or QTL) and the exploitation of molecule marker are laid a good foundation.
The corn Study on Molecular Marker starts from 1975.Since first molecule marker genetic map RFLP collection of illustrative plates was born in 1986, RFLP, the SSR development course to the SNP mark had been experienced in the development of corn molecule marker.Result of study shows that SNPs (Single nucleotide polymorphisms) is very abundant (Drenkard et al., 2000 in Plant Genome; Nasu et al., 2002; Batley et al., 2003; Hayashi et al., 2004).Compare with traditional molecule marker, SNP has the advantage that can detect an away minor segment easily.The disease-resistant gene molecule marker of plant location also begins to use the SNP technology in plant at present.The frequency of SNP is higher in corn, and this is conducive to find in corn and use SNP to position and gene clone as molecule marker.Ching (2002) etc. has studied representational 36 maize elite inbred lines of the U.S., and finding just has a SNP difference in average per 31 bases of genomic non-coding region.Also have high-frequency insertion and disappearance at non-coding region, average per 85 bases just have such difference.Tenaillon and Rafalski are reported in corn 3 ' end non-translational region and the coding region has per 48 bases and 130 bases that a SNP difference (Tenaillon et al., 2001 are just arranged respectively; Rafalski, 2002).
CAPS (cleaved amplified polymorphic sequence, CAPS) or dCAPS (derived CAPS) mark be the usual way (Michaels and Amasino, 1998) that utilizes the SNP site.The CAPS mark is that PCR reaction and enzyme cut are in conjunction with a kind of molecule marker of generation.If different storerooms has the SNP site in the pcr amplification zone, and this site is the restriction enzyme action site, and the pcr amplification product of differing materials carries out agarose gel electrophoresis again and will show polymorphism after specific enzyme is cut so.So this method also is a kind of.Simple lower-cost method.But it is also fewer that SNP is positioned at this situation of restriction enzyme site just, so on the basis of CAPS mark by in amplimer, introducing base mismatch, then can introduce new restriction enzyme action site in conjunction with the SNP site, the polymorphism of generation and CAPS designate similar.The method of Here it is dCAPS.Then nearly all SNP site can be changed into molecule marker (Michaels and Amasino, 1998) based on PCR with the method for CAPS or dCAPS.
Corn inbred line Mo17 and neat 319 is the outstanding good anti-sources of disease resistance.In the U.S. and other developed countries, the process that corn yield improves has been accelerated in the molecular marker assisted selection breeding, provides great potential for the production of Asia corn germ plasm resource and the raising of quality simultaneously.But the application report at the disease-resistant molecule marker of corn is less.Utilize traditional phenotypic evaluation to select, need enough big colony, many selfing or the selection intensity of the size of backcrossing, suit and evaluation performances of multiple environmental conditions from generation to generation.Seek and the closely linked molecule marker in the disease-resistant site of purpose, great for the auxiliary breeding for disease resistance Research Significance of molecule marker.So, accelerate the disease-resistant functional molecular marker exploitation of corn, be the emphasis of present research, the auxiliary disease-resistant back cross breeding of molecule in future, the auxiliary a plurality of disease-resistant gene pyramiding breedings of molecule and main effect disease-resistant gene are separated all having great importance.
Summary of the invention
One of purpose of the present invention is to provide a kind of SNP (mononucleotide sequence polymorphism) site chain with Head Smut Resistance Gene on Maize.
It is a kind of based on SNP site exploitation dCAPS molecular marker method that two of purpose of the present invention is to provide.
Three of purpose of the present invention is to provide a kind of and corn anti-head-smut master is imitated the molecule marker of disease-resistant site significant correlation and the primer of this molecule marker that is used for increasing is right.
Four of the object of the invention be to provide above-described SNP site and based on SNP site exploitation dCAPS molecule marker and amplimer thereof to the purposes in corn anti-head-smut molecular mark.
The objective of the invention is to be achieved through the following technical solutions:
A kind of SNP site chain with Head Smut Resistance Gene on Maize of the present invention, called after SNP-4, it is characterized in that, described SNP site is arranged in the nucleotide sequence shown in SEQ ID NO.4, described SNP site is A51C, and wherein the numbering of nucleotide position is based on the nucleotide sequence shown in the SEQ ID NO.4.
Wherein, " A51C " is a kind of method for expressing in SNP site, be intended to indicate this position of SNP site in the nucleotide sequence shown in the SEQ IDNO.4, and the polymorphism of the mononucleotide of this position is described, " A51C " specifically is expressed as this SNP site and is positioned at the 51st of the nucleotide sequence shown in the SEQ ID NO.4, and the Nucleotide of this position is adenine nucleotide (A) or is cytidylic acid(CMP) (C).
Further, it is a kind of based on SNP site exploitation dCAPS molecular marker method that the present invention also provides, it is characterized in that containing with the nucleotides sequence in the SNP-4 site of corn anti-head-smut significant correlation and classify basic sequence as, design dCAPS primer is right, be that template is carried out pcr amplification with the total DNA of corn, make the SNP-4 site effectively be converted into the dCAPs mark; Wherein saidly contain nucleotide sequence with the SNP-4 site of corn anti-head-smut significant correlation shown in SEQ ID NO.4.
In specific embodiments of the invention, described dCAPS primer is as follows to sequence:
LSCAP4 upstream (F) CATGGACCAACCTGAAATGGTCAC (shown in the SEQ ID NO.2)
Downstream (R) TTTAGCTCTTGGTTGAAGCACATG (shown in the SEQ ID NO.3)
The present invention also provide prepare according to above-described method with the closely linked dCAPS molecule marker of Head Smut Resistance Gene on Maize, called after LSdCAP4 is characterized in that, the nucleotide sequence of described molecule marker is shown in SEQ ID NO.1.
Molecule marker of the present invention is to be transformed by the SNP-4ID sequence that corn gene group master is imitated bin2.09 zone, anti-head-smut site to obtain, it is a dCAPS molecule marker, name is called LSdCAP4, derive from and have main corn inbred line Mo17 and neat 319 of imitating the anti-head-smut site, be that SNP site SNP-4 by correspondence is transformed, have described 119 nucleotide sequences of SEQ ID NO.1 in the sequence table, corresponding SNP site is arranged in 101 nucleotide sequences shown in the sequence table SEQ ID NO.4.
It is above-described right with the primer closely linked dCAPS molecule marker of Head Smut Resistance Gene on Maize to obtain, and preferred, described dCAPS primer is as follows to sequence:
LSCAP4 upstream (F) CATGGACCAACCTGAAATGGTCAC
Downstream (R) TTTAGCTCTTGGTTGAAGCACATG
Further, the present invention proposes described SNP site the purposes in corn anti-head-smut molecular mark chain with Head Smut Resistance Gene on Maize.
Further again, the present invention proposes described and the purposes of the closely linked dCAPS molecule marker of Head Smut Resistance Gene on Maize in corn anti-head-smut molecular mark.
Further, the present invention proposes described primer to the purposes in corn anti-head-smut molecular mark.
Exist the main corn inbred line Mo17 and neat 319 in anti-head-smut site of imitating in the generation of backcrossing for the resistance donor, screen the molecule marker of imitating disease-resistant site significant correlation with corn anti-head-smut master, for further separating and cloning the anti-head-smut gene and lay a good foundation.This molecule marker can be used in the work of corn molecular mark simultaneously, contains main individual plant material of imitating the anti-head-smut site in order to evaluation.
Because corn belongs to quantitative character heredity to the resistance of head smut, adopt traditional disease resistance authentication method that manually bacterium soil was inoculated, milk stage is carried out the diseased plant rate investigation early stage, it is longer to expend time in, the commitment that dCAPS of the present invention is marked at during the corn seed or cotyledon grows just can be identified, save time and accurately, therefore can be used for corn anti-head-smut molecular mark, accelerate the process of corn disease-resistant variety seed selection.
Description of drawings
Fig. 1 is the electrophoretic band behind the plant DNAPCR of label L SdCAP4;
The 1-5 hole is the PCR product of label L SdCAP4; M is Marker 2000
Fig. 2 is the electrophoresis detection photo of label L SdCAP4 near isogenic line, parent and susceptible pond individual plant;
Electrophoresis point sample hole 1-7 is that enzyme is cut back PCR product, the 8-14 hole is PCR product before enzyme is cut, wherein the site near isogenic line is imitated for containing Mo17 donor master in 1 hole, disease-resistant site near isogenic line is imitated for containing neat 319 donor masters in 2 holes, 3 holes are parent Mo17, and 4 holes are neat 319,5 holes are yellow morning four, and the 6-7 hole is the susceptible family individual plant of BC34F2; 8-14 hole DNA sample is corresponding successively with 1-7 hole DNA sample; M is Marker PBR322
Fig. 3 is LSdCAP4 cuts the disease-resistant strain of post analysis and susceptible strain at enzyme electrophorogram;
The 1-12 hole is for containing the main disease-resistant site near isogenic line (BC4F3) of imitating; The 13-24 hole is the susceptible family individual plant of BC4F2; M is Marker PBR322
Fig. 4 is the individual plant electrophorogram of LSdCAP4 in the anti-susceptible BAS pond of Mo17 and neat 319 donors establishment near isogenic line;
From left to right, the 1-12 hole is Mo17 donor near isogenic line; The 13-24 hole is the susceptible family individual plant of Mo17 donor BC4F2, and the 26-37 hole is neat 319 donor near isogenic lines; 38-49 is the susceptible family individual plants of neat 319 donor BC4F2, and wherein the 25th and the 50th hole is MARKER PBR322
Fig. 5 is that LSdCAP4 is marked at 10 retrieval distribution plans on the karyomit(e);
Fig. 6 is that LSdCAP4 is marked at the retrieval distribution plan on the 2nd karyomit(e);
Fig. 7 is that LSdCAP4 is marked at the interval distribution plan of the base of retrieving on the 2nd karyomit(e);
Fig. 8 is detail parameters and the sequence alignment analysis of result for retrieval behind the LSdCAP4 mark PCR product B LAST.
Embodiment
The present invention will be further described below in conjunction with specific embodiment, it should be understood that these embodiment only are used for the purpose of illustration, never limit protection scope of the present invention.
One, contains main establishment of imitating anti-head-smut site corn near isogenic line
1 parent material
Mo17 is introduced from the U.S. in 1974 by Crop Breeding Cultivation Inst., Chinese Agriculture Academy, is the second cycle line of 187-2 * C103.Outstanding advantages such as this cording has that hereditary basis is abundant, combining ability is high, wide adaptability, stalk do not fall by force, seed-producing rate height and anti-head-smut, the system of representatives and the test that are the assorted excellent monoid of Lan are planted, and itself and the head group of Siping City, the pool, improvement Reid group and the red frame in Luda all have stronger hybrid vigour.Because the cross-fertilize seed (F1) of Mo17 anti-head-smut and its assembly also has good disease resistance, so brought into play enormous function in northern spring maize production.
Neat 319 is nineteen ninety to be base mateiral by drawing cross-fertilize seed 78599 beyond the corn institute of Shandong Province Academy of Agricultural Sciences, the good PN monoid germplasm that forms by the second cycle line seed selection, contain the abundant torrid zone, subtropics corn germplasm, the combining ability height, multiresistance is strong, comprehensive proterties is good, is that good system of representatives and the test of PB hybrid vigour monoid planted.Neat 319 high-resistance corn head smuts, to corn southern rust performance immunity, the anti-leaf blight of corn, helminthosporium maydis, bacterial wilt, rough dwarf disease, smut disease etc. are the superior corn self-mating systems of double anti-multiple diseases simultaneously.
Yellow four is to be bred with Crop Inst., Beijing Agriculture and Forest Sciences Academy common selection in the local germplasm of China " Siping City, pool monoid " by Crop Breeding Cultivation Inst., Chinese Agriculture Academy in 1975 early.This cording has advantages such as combining ability height, wide adaptability, drought tolerance be strong, the system of representatives and the test that are " Siping City, pool monoid " are planted, have simultaneously that plant type compactness, pollen amount are many, Chinese People's Anti-Japanese Military and Political College's pinta and short mosaic disease viral disease, make in China's corn breeding, use very extensive.This is high sense head smut, becomes the direct applied limiting factor in northern spring maize district always, strengthens the head smut resistance improvement of this germplasm and utilizes meaning very great.
2. the basic population of near isogenic line and constructive process
Be the resistance donor with Mo17 and neat 319, yellow four be susceptible recurrent parent early, under the selection of field artificial inoculation pressure, selects the extremely disease-resistant family of backcrossing to carry out that next round is backcrossed and the selfing evaluation.Anti-head-smut backcross population to the anti-source of Mo17 (or neat 319) makes up, and mainly carries out next round by the resistance individual plant of resistance family in selection Mo17 (or the neat 319) colony and backcrosses.Concrete constructive process is, at first, before pollination, each family in Mo17 (or the neat 319) colony is carried out the normal and normal assessment of sexual organ development's (taking out hero, loose powder and female fringe) of growing way (plant height, fringe position and blade), infer that each family is to the resistance of corn anti-head-smut, comprehensive evaluation through repeating for 3 times, preliminary screening go out resistance family in Mo17 (or the neat 319) colony and row number.The second, select 4-5 normal individual plant in Mo17 (or neat 319) the resistance family, get pollen separately, corresponding and yellow four hybridization of pollinating early one by one, selfing simultaneously, and list indicated the selfing individual plant, the individual plant of backcrossing originates.The 3rd, the sickness rate of family in milk stage investigation Mo17 (or the neat 319) colony, according to the distribution situation of each familial incidence in colony, selection is positioned at resistance selfing individual plant and the individual plant of backcrossing thereof of 3-5 family of the one-sided extreme resistance of crest, and preserve, in order to the next year plantation.By that analogy, created out BC4F2 (2009, Harbin) basic near isogenic line colony from generation to generation.
3.Mo17 donor near isogenic line creation method
Be material with BC4F2 resistance family, select the individual plant of resistance by the field artificial inoculation, analyze by the SSR marker detection in the linked marker screening of SSR mark, full genome SSR mark background detection and the disease-resistant zone of possibility, finishing screen is selected and is only contained main resistance individual plant of imitating the anti-head-smut site again.Concrete operations are, at first, are instrument with main chain SSR mark SSR148152 of imitating the anti-head-smut site, and screening contains the resistance individual plant that the Mo17 donor master of isozygotying is imitated disease-resistant site; The second, choose 324 pairs of SSR marks in the full genome mean random of corn, utilize Mo17 and Huang early to exist the SSR mark of polymorphism that selected resistance individual plant is carried out background between four parents and recover to detect analysis.The 3rd, in may existing the zone of corn anti-head-smut, 10 of maize chromosome bin1.02, bin1.03, bin2.08 etc. choose 113 SSR marks, utilize parent Mo17 and yellow possible the anti-head-smut zone marker SSR that early has polymorphism between four, contain main high recovery rate individual plants of imitating the anti-head-smut site to 12 parts and carry out the site that other may anti-head-smuts and detect analysis.Do not carry out selfing for there being other individual plants that may import the anti-head-smut site, thereby tentatively obtain the homozygous individual that Mo17 master is imitated the anti-head-smut quiding gene, namely obtain Mo17 donor near isogenic line.
4. neat 319 donor near isogenic line creation methods
Be material with BC4F2 resistance family, select the individual plant of resistance by the field artificial inoculation, analyze by the SSR marker detection in the linked marker screening of SSR mark, full genome SSR mark background detection and the disease-resistant zone of possibility, finishing screen is selected and is only contained main resistance individual plant of imitating the anti-head-smut site again.Concrete operations are, at first, with main chain SSR mark umc2077, bnlg1893 and umc1525 of imitating the anti-head-smut site, screening contains the neat 319 donors main resistance individual plant of imitating disease-resistant site that isozygotys; The second, choose 324 pairs of SSR marks in the full genome mean random of corn, utilize neat 319 and the yellow SSR mark that early has polymorphism between four parents selected resistance individual plant is carried out background recover to detect and analyze.The 3rd, in may existing the zone of corn anti-head-smut, 10 of maize chromosome bin1.02, bin1.03, bin2.08 etc. choose 113 SSR marks, utilize parent neat 319 and the yellow mark that early has polymorphism SSR between four, contain main high recovery rate individual plants of imitating the anti-head-smut site to 12 parts and carry out site that other may anti-head-smuts and detect and analyze.Do not carry out selfing for there being other individual plants that may import the anti-head-smut site, thereby tentatively obtain neat 319 main homozygous individuals of imitating the anti-head-smut quiding gene, namely obtain neat 319 donor near isogenic lines.
Two, corn anti-head-smut master is imitated the snp analysis in the regional karyomit(e) 2.09
This research with resistance high and stable near isogenic line L35 (average attack rate is 2.33%, the anti-source of Mo17, BC4F4), (average attack rate is 2.9% to L271, neat 319 anti-sources, BC4F4), parent Mo17, neat 319, yellow four (susceptible recurrent parents) early and known 16 parts of self-mating system materials anti-, sense carry out the gene chip analysis, the final disease-resistant related SNP information that obtains main effect anti-head-smut site (in karyomit(e) 2.09 zones), wherein 2.09 regional gene chip analysis data of 16 parts of self-mating system materials are provided by crop institute of Chinese Academy of Agricultural Sciences corn research department.And the material of 16 parts of self-mating systems is selected, be referred to corn anti-head-smut master and imitate the donor parents Mo17 in site (R) and neat 319 (HR), the two comes from LAN blood relationship and PB blood relationship material respectively, and susceptible recurrent parent is yellow four (HS) early, comes from the SPT blood relationship material of sense head smut.For this reason, selected 1 part of 4 parts of LAN blood relationships, 3 parts of PB blood relationships and other blood relationship, amounted to 8 parts of resistance self-mating systems, field inoculation sickness rate is between 0-2.25%, and disease-resistant rank belongs to HR and R respectively; Selected 2 parts of 5 parts of SPT blood relationships, 1 part of PB blood relationship and other blood relationships, amounted to 8 parts high susceptible self-mating system, its field inoculation sickness rate is between 53.15%-89.1%, and disease-resistant rank belongs to HS (seeing Table 1) respectively.
In the SNP information (chip data of self-mating system by Chinese Academy of Agricultural Sciences crop institute corn breeding research department and Northeast Agricultural University corn research centre coacted finish, see Table 2) of bin2.09 area reseach to resistance difference.
Disease-resistant and the susceptible sorted table of 16 parts of self-mating system chip materials of table 1
The resistance difference SNP ID sequence information that table 2 is retrieved in maize chromosome bin2.09 zone
Embodiment 2. is converted into the dCAPS molecule marker with the SNP mark that corn anti-head-smut master is imitated disease-resistant site significant correlation
One, based on the dCAPs marker development method in SNP site
Be basic sequence with the SNP-4 site id information with corn anti-head-smut significant correlation, utilize online tool (http://helix.wustl.edu/dcaps/dcaps.html) to analyze best restriction enzyme site and selectional restriction restriction endonuclease.By the BLAST function of MAIZEGDB website need look for its height homology the BAC sequence, and it is downloaded in the computer, recycling DNAMAN software compares the BAC sequence of SNP-4 site id information and download, search the zone of SNP site id information and centered by the mutational site to both sides expansions base sequence, the about 500bp of total length.Recycling primer5.0 software, the fixing primer of the SNP site one end restriction enzyme site of base (band change), making the mutational site is first base that pcr amplification extends, and then need look for the suitable primer of the other end with this software; Require about 60 ℃ of annealing temperature (Tm) value, upstream and downstream primer TM value is transferred to close, the product size is about 90-140bp.The primer of design is downloaded, and in the primer strand of fixing therein, according to selected restriction enzyme, changed a corresponding 1-2 base, check back synthetic primer.Primer is by Beijing AudioCodes bio tech ltd synthetic (seeing Table 3).
Table 3 is based on the dCAPS primer information table of SNP site exploitation
Two, based on the dCAPs labeled analysis in SNP site
With the dCAPs mark that designs by pcr amplification, agarose electrophoresis detect, the digestion with restriction enzyme of pcr amplification product and the operability that polyacrylamide cohesion electrophoresis detection is analyzed primer.SNP-4 effectively is converted into dCAPs mark (see figure 1).
1.dCAPs the pcr amplification of mark
The LSdCAP4 mark upstream and downstream primer that utilization designs, at near isogenic line L35, L271, parent Mo17, neat 319, yellowly early carry out pcr amplification in four, synthetic primer is carried out pre-expansion product compliance test result, judge whether the amplified band size is consistent with the purpose band of design, and whether the expanding effect of simultaneous verification design of primers (band sharpness and stability) is desirable.The reaction system of PCR sees Table 4.
The reaction system of table 4dCAPs primer PCR
The thermal response program of dCAPs primer PCR:
2.PCR the digestion with restriction enzyme of amplified production check
Pcr amplification product is carried out digestion with restriction enzyme check, and the restriction enzyme digestion reaction system sees Table 5 and table 6.
The restriction enzyme information table of table 5dCAPs mark PCR product
Table 6dCAPs mark PCR product restriction enzyme digestion reaction system (not containing BSA)
3. polyacrylamide cohesion electrophoresis check
Pcr amplification product after enzyme cut carries out the check of polyacrylamide cohesion electrophoresis, and method is as follows:
(1) polyacrylamide gel electrophoresis equipment
Instrument: BIO-RADPowerpae 5000 type electrophoresis apparatuses
Glue type: 38cm * 32cm * 0.4mm
Gel: 4.5% polyacrylamide gel (sex change glue)
(2) electrophoretic procedures
(1) cleans electrophoresis plate and encapsulating
1. clean sheet glass: carefully strictly sheet glass is cleaned with tap water and washing composition, dry with thieving paper, use 76% alcohol wipe then, clean one time with 95% ethanol again, natural air drying, last platelet evenly is coated with the affine silane (Binding Silane) of 2mL 0.5% with medicated napkin, and the ear plate is peeled off silane (Repel Silane) with what medicated napkin evenly was coated with 2mL 2%, prevent in the operating process that two sheet glass from polluting mutually, allows it fully dry.
2. the encapsulating jar with 200mL adds sex change glue, N, N, N, N-Tetramethyl Ethylene Diamine (TEMED) and 25% Ammonium Persulfate 98.5 (APS), avoid entering bubble, slowly glue is pushed along the suitable for reading of encapsulating plate then, the concordant side of comb is slowly inserted prevented bubble in the glue then.With the water level gauge survey sheet glass is transferred to level, solidifying needs 2 hours at least.
(2) electrophoresis
1. the amplified production sex change after enzyme is cut: add 5 μ L, 3 * Lodaing Buffer (100%Formamide; 0.5MEDTA, pH=8.0; Brph Blue; X.lund), 95 ℃ of sex change 5min.
2. prerunning 45min constant power 100W.Last groove electrophoretic buffer be 0.5 * TBE (Tris Base, Boric Acid, 0.5M EDTA, pH=8.0), following groove electrophoretic buffer be 1 * TBE (Tris Base, Boric Acid, 0.5MEDTA, pH=8.0).
3. insert good comb, earlier the bubble in the swimming lane and unnecessary glue are blown out, earlier at the about 4 μ L of every swimming lane point sample, contrast the about 4 μ L of parent again.
4. electrophoresis, constant power 75W.To bromjophenol blue near plate at the bottom of.
(3) silver dyes colour developing fast
1. electrophoresis finishes, and takes off offset plate, has shelled the ear plate.
2. fixing: as with acetic acid (containing 10% ethanol) the distilled water constant volume of 1.5L 0.5%, to clean 5min.
3. rinsing: clean 2.5min with 1.5L distilled water.
4. silver dyes: the AgNO with about 0.12%
3Fixing 7min～10min.
5. rinsing: get express developed with 1.5L distilled water, flush time is no more than 30s.
6. develop: with NaOH (containing 0.5% formaldehyde) development 5min～7min of 1.5L 1.5%.
7. rinsing: with 1.5L water distilled water flushing 5min.
8. dried glue: from water, take out the nature airing.
Three, based on mono-clonal and the authentication method of the dCAPs mark in SNP site
The PCR product of 6 dCAPS marks is material, utilize sepharose to reclaim the purpose segment, again by connecting, transform and shake the bacterium step, obtain the mono-clonal of each mark, utilize former primer that bacterium liquid is directly carried out PCR, the evaluation sheet is had no progeny, and bacterium liquid is sent order-checking, and recycling DNAMAN software compares to result and the purpose fragment sequence that order-checking obtains.
1. sepharose purpose segment reclaims
For agarose gel electrophoresis separated DNA product, utilize the sky to reclaim and purifying for epoch DNA reclaims purification kit.Its concrete steps are:
Under long-wave ultra violet lamp, downcut single target DNA band (as far as possible excising redundance) with clean sterilization knife blade, put into the sterilized eppendorf pipe of 1.5ml, take by weighing weight;
Add 3 times of volume sol solutions PN in the blob of viscose, 50 ℃ of water-bath 10min, during concussion 3 times;
Sol solutions is added an adsorption column CA2 (adsorption column is put into collection tube), and the centrifugal 30s of 12000rpm outwells the waste liquid in the collection tube, and adsorption column is reentered in the collection tube;
Add 700 μ l rinsing liquid PW (having added dehydrated alcohol) in adsorption column, the centrifugal 30s of 12000rpm outwells waste liquid, and adsorption column is reentered in the collection tube;
Add 500 μ l rinsing liquid PW in adsorption column, the centrifugal 30s of 12000rpm outwells waste liquid.Centrifugal adsorption column CA2 is put back in the collection tube, and the centrifugal 2min of 12000rpm removes rinsing liquid as far as possible.Place room temperature or 50 ℃ of incubators to count min adsorption column, airing disturbs next step experiment to prevent residual rinsing liquid up hill and dale;
Adsorption column is put in the clean centrifuge tube, and to an amount of elution buffer EB of the unsettled dropping in adsorption film mid-way, room temperature is placed 2min.The centrifugal 1min of 12000rpm collects dna solution;
In order to improve the yield of DNA, can be with in the centrifugal solution that the obtains centrifugal adsorption column of add-back again, repeating step 6);
Remove centrifugal post, will reclaim DNA and put-20 ℃ of preservations;
2 connect
Carrier is used the pMD18-T clone test kit carrier system that the sky is Time Inc., concrete steps are: reagent is placed on dissolving on ice, and add following composition in 0.2 μ L centrifuge tube successively: pMD18-T carrier 1.5 μ l connect damping fluid 4.5 μ l, the DNA 4 μ l that reclaim, 16 ℃ of insulation 3h.
The preparation of 3 substratum
LB liquid nutrient medium (1000ml): yeast extract (Basto-Yeast extract) 5g, peptone (Bacto-typtone) 10g, NaCl10g.
LB solid medium: add 15g agar in the 1000mlLB liquid nutrient medium.Add Ampicillin (100mg/ml) behind the autoclaving and pave plate, every 100ml adds 60ulAmp.
4 transform
100 μ l competent cell DH5 α are thawed on ice bath;
5 μ l are connected product and competent cell mixing, ice bath 30min;
42 ℃ of heat shock 90s;
Rapidly pipe is moved on in the ice bath ice bath 2-3min;
The LB liquid nutrient medium that adds 900 μ l precoolings, 37 ℃ of jogs are cultivated 60min;
Get 200 μ l bacterium liquid, 8 μ lIPTG (100mg/ml), 4 μ l X-Gal (20mg/ml) are added on the LB solid screening culture medium that contains amp, are evenly coated on the flat board seasoning 5-10min with aseptic coated with glass device;
Flat board is inverted cultivation 12-16h at 37 ℃, to the bacterium colony that grows suitable size;
There is the flat board of bacterium colony to be placed on a few hours in 4 ℃ of refrigerators with long, blueness is fully manifested.Growing on the culture dish many whites and blue colonies, blue colonies only contains carrier, and white colony is the DNA recon.
5 shake bacterium
Picking typical case white colony is put into the LB liquid nutrient medium that contains Amp, and 37 ℃ of shaking culture 10-12h utilize former primer that bacterium liquid is directly carried out PCR, and the evaluation sheet is had no progeny, and bacterium liquid is sent order-checking.
6. the compare of analysis of sequencing result
In order to guarantee the exactness of sequence, each segment is chosen 2-4 clone and is sent to order-checking, utilizes the PCR fragment of the sequencing result of DNAMAN and design primer to compare, and the result is in full accord.Measured sequence following (shown in the SEQ ID NO.1):
5’-CATGGACCAACCTGAAATGTACACCTATACGTCCATTGCATAAGAGAGAGCATTCAGCTG
CTTTGGCCTATTCAAAATAAGTGTCCGTGTGTTCCCATGTGCTTCAACCAAGAGCTAAA-3’
Four, the dCAPS labeled analysis result of resistance near isogenic line and susceptible family
For the dCAPs mark that goes out newly developed is carried out functional selection, set up the BSA pond (seeing Table 7) of Mo17 and neat 319 groups of common corn anti-head-smuts of setting up.At first, disease-resistant pond is amounted to 24 parts of materials and is set up by Mo17 and neat 319 groups 12 parts of anti-head-smut near isogenic lines separately, and wherein Mo17 group's near isogenic line is followed the tracks of by mark SSR148152, neat 319 groups near isogenic line is by mark umc1525, and bnlg1893 and umc2077 follow the tracks of.Second, susceptible pond is by BC4F2 Mo17 and each 12 parts of height sense family individual plants in neat 319 colonies and forming from generation to generation, amount to 24 individual plants, utilize the comptibility test of card side to estimate dCAPs newly developed and be marked at the dependency of imitating the resistance site in the colony with corn anti-head-smut master.
Preferably resist, feel head smut pond bill of material in table 7Mo17 and neat 319 colonies
Annotate: 12 near isogenic lines of Mo17 group in " a " are numbered L161, L165, L167, L171, L169, L164, L166, L168, L170, L162, L163 and L173; " b " neat 319 groups of 12 near isogenic lines are numbered L417, L410, L418, L419, L412, L415, L408, L411, L416, L413, L421 and L409; Mo17 group and the neat 319 groups susceptible family individual plant of BC4F2 are imitated by the corn master in the susceptible pond in linked marker screening BSA pond, anti-head-smut site and are randomly drawed in " c " and " d ".
Comptibility test shows through the side of card, the chi-square value of label L SdCAP1 newly developed, LSdCAP2, LSdCAP3, LSdCAP4, LSdCAP7-1 and LSdCAP7-2 is respectively 0.0208,0.0208,0.1875,0.0208,0.0208 and 0.0208, its value all (sees Table 8 less than the chi-square value 3.84 of 0.05 level, Fig. 2-4), the resistant mutation site of its mark and corn anti-head-smut main imitated disease-resistant site and had dependency preferably, illustrate that 6 dCAPs marks all imitate disease-resistant site significant correlation with leading of corn anti-head-smut.
Table 8dCAPs is marked at disease-resistant pond and the card side in the susceptible pond of creating near isogenic line and detects analytical table
Embodiment 3.dCAPS molecule marker karyomit(e) physical location base sequence positional information is searched
Effective extension increasing sequence information at the dCAPS mark, be canonical sequence with B73RefGen_v1 sequence, in the BLAST of MAIZEGDB website and Locus Lookup function items, search the concrete physical location of respective markers on maize chromosome, to imitate 12 relevant molecule markers of anti-head-smut site with the corn master and be positioned at maize chromosome bin2.09 zone respectively, concrete lookup result is as follows:
One, the legend analysis of searching behind the LSdCAP4 mark PCR product B LAST
Result such as Fig. 5-7, shown in the table 9.Fig. 5 shows that LSdCAP4 is marked at 10 retrieval distribution plans on the karyomit(e), and Fig. 6 shows that LSdCAP4 is marked at the retrieval distribution plan on the 2nd karyomit(e), and Fig. 7 shows that LSdCAP4 is marked at the interval distribution plan of the base of retrieving on the 2nd karyomit(e).
Table 9LSdCAP4 is marked at homology base and the significant correlation water-glass of 10 karyomit(e) BLAST retrievals of corn
Two, detail parameters and the sequence alignment analysis of result for retrieval behind the LSdCAP4 mark PCR product B LAST
The result as shown in Figure 8
Three, the concrete base position of LSdCAP4 mark by finding after the BLAST retrieval
LSdCAP4 is marked at the concrete base position of retrieving on the 2nd karyomit(e).
The above only is the preferred embodiments of the present invention, only is illustrative for the purpose of the present invention, and nonrestrictive; Those of ordinary skills understand, and can carry out many changes to it in the spirit and scope that claim of the present invention limits, revise, even the equivalence change, but all will fall within the scope of protection of the present invention.
Claims (8)
1. single nucleotide polymorphism molecule marker chain with Head Smut Resistance Gene on Maize, has the SNP site, called after SNP-4, it is characterized in that, described SNP site is arranged in the single nucleotide polymorphism molecule marker shown in SEQ ID NO.4, described SNP site is SNP-51A/C, and wherein the numbering of nucleotide position is based on the nucleotide sequence shown in the SEQ ID NO.4.
2. one kind based on SNP site exploitation dCAPS molecular marker method, it is characterized in that containing with the nucleotides sequence in the SNP-4 site of corn anti-head-smut significant correlation and classify basic sequence as, design dCAPS primer is right, be that template is carried out pcr amplification with the total DNA of corn, make the SNP-4 site effectively be converted into the dCAPs mark; Wherein saidly contain nucleotide sequence with the SNP-4 site of corn anti-head-smut significant correlation shown in SEQ IDNO.4.
3. method as claimed in claim 2 is characterized in that, described dCAPS primer is as follows to sequence:
Upstream (F) CATGGACCAACCTGAAATGGTCAC
Downstream (R) TTTAGCTCTTGGTTGAAGCACATG
4. obtain according to claim 2 or 3 described methods with the closely linked dCAPS molecule marker of Head Smut Resistance Gene on Maize, called after LSdCAP4 is characterized in that, the nucleotide sequence of described molecule marker is shown in SEQ ID NO.1.
5. it is described right with the primer closely linked dCAPS molecule marker of Head Smut Resistance Gene on Maize to obtain claim 4, it is characterized in that described dCAPS primer is as follows to sequence:
Upstream (F) CATGGACCAACCTGAAATGGTCAC
Downstream (R) TTTAGCTCTTGGTTGAAGCACATG
Claim 1 described with the chain purposes of single nucleotide polymorphism molecule marker in corn anti-head-smut molecular mark of Head Smut Resistance Gene on Maize.
Claim 4 described with the purposes of the closely linked dCAPS molecule marker of Head Smut Resistance Gene on Maize in corn anti-head-smut molecular mark.
8. the described primer of claim 5 is to the purposes in corn anti-head-smut molecular mark.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210031191 CN102533747B (en) | 2012-02-13 | 2012-02-13 | Single nucleotide polymorphisms (SNP) locus linked to sporisorium-reiliana-resistance-associated gene, molecular marker LSdCAP4 based on same and use of same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210031191 CN102533747B (en) | 2012-02-13 | 2012-02-13 | Single nucleotide polymorphisms (SNP) locus linked to sporisorium-reiliana-resistance-associated gene, molecular marker LSdCAP4 based on same and use of same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102533747A CN102533747A (en) | 2012-07-04 |
| CN102533747B true CN102533747B (en) | 2013-08-14 |
Family
ID=46341779
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210031191 Active CN102533747B (en) | 2012-02-13 | 2012-02-13 | Single nucleotide polymorphisms (SNP) locus linked to sporisorium-reiliana-resistance-associated gene, molecular marker LSdCAP4 based on same and use of same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102533747B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498590B (en) * | 2014-11-21 | 2017-01-25 | 东北农业大学 | Molecular marker LSdCAP8 developed on basis of maize head smut resistance candidate gene ZmNL and application thereof |
| CN105734145A (en) * | 2016-04-01 | 2016-07-06 | 沈阳农业大学 | Strawberry anthocyanin regulatory gene functional marker |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575644A (en) * | 2009-05-08 | 2009-11-11 | 吉林大学 | Sporisorium reilianum PCR detection kit and preparation method thereof |
| WO2010022328A3 (en) * | 2008-08-21 | 2010-04-08 | E. I. Du Pont De Nemours And Company | Genetic loci associated with head smut resistance in maize |
| CN101824479A (en) * | 2010-05-07 | 2010-09-08 | 沈阳师范大学 | SCAR markerer of sorghum head smut resistance germ No. 3 physiological strain |
| US7956257B1 (en) * | 2009-06-09 | 2011-06-07 | Pioneer Hi-Bred International, Inc. | Maize variety inbred PHW9Z |
-
2012
- 2012-02-13 CN CN 201210031191 patent/CN102533747B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010022328A3 (en) * | 2008-08-21 | 2010-04-08 | E. I. Du Pont De Nemours And Company | Genetic loci associated with head smut resistance in maize |
| CN102165072A (en) * | 2008-08-21 | 2011-08-24 | 中国农业大学 | Genetic loci associated with head smut resistance in maize |
| CN101575644A (en) * | 2009-05-08 | 2009-11-11 | 吉林大学 | Sporisorium reilianum PCR detection kit and preparation method thereof |
| US7956257B1 (en) * | 2009-06-09 | 2011-06-07 | Pioneer Hi-Bred International, Inc. | Maize variety inbred PHW9Z |
| CN101824479A (en) * | 2010-05-07 | 2010-09-08 | 沈阳师范大学 | SCAR markerer of sorghum head smut resistance germ No. 3 physiological strain |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102533747A (en) | 2012-07-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102395678B (en) | Major qtl of maize stalk rot resistance, molecular markers linked with the same and uses thereof | |
| CN105063033A (en) | Molecular marker of brassica napus anti-clubroot gene and application of molecular marker to anti-clubroot breeding | |
| CN108048594B (en) | Molecular marker of QTL/major gene related to cotton verticillium wilt resistance | |
| CN103146691A (en) | SNP loci linked with blight resistant gene Fon-1 in watermelon, and markers thereof | |
| CN109280716A (en) | A kind of and the anti-clubroot QTL of radish chain SSR molecular marker and application | |
| CN104313155A (en) | Floral character associated molecular marker screening method of amenone form chrysanthemum and application of method | |
| CN105794631A (en) | Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line | |
| CN102533748B (en) | Single nucleotide polymorphisms (SNP) locus linked to sporisorium-reiliana-resistance-associated gene, molecular marker LSdCAP2 based on same and use of same | |
| CN102559668B (en) | Single nucleotide polymorphism (SNP) site linked with corn head smut resistance gene, and molecular marker LSdCAP3 located on site and application of molecular marker LSdCAP3 | |
| CN102533747B (en) | Single nucleotide polymorphisms (SNP) locus linked to sporisorium-reiliana-resistance-associated gene, molecular marker LSdCAP4 based on same and use of same | |
| CN105734057B (en) | With the SSR marker and its application of muskmelon downy mildew resistance main effect QTL linkage | |
| CN110607382A (en) | SNP molecular marker of single ring weight major gene derived from Xinluzao 24 | |
| CN100344223C (en) | Polyploid rice breeding and detecting method with polyploid meiosis stability gene | |
| CN102599047A (en) | Method by adopting molecular marker-assisted backcross to improve gibberellic disease expansion resistance of wheat | |
| CN108207611A (en) | A kind of selection of crops hybrid new breed | |
| CN114982630B (en) | Molecular marker assisted breeding method for high-southern rust resistance corn | |
| CN105063201A (en) | Molecular marker of corn chromosome 9 ear row number major QTL and application thereof | |
| CN104946644A (en) | Molecular marker for corn tripsacum monosome addition line nucleic male sterility genes and application thereof | |
| CN106480062A (en) | Recombinant nucleic acid fragment RecCR012080 and its detection method | |
| CN104762298A (en) | Rice seedling-stage salt-tolerant gene qST11 and molecular marker method thereof | |
| CN109006456A (en) | A kind of selection of pimento genic male sterility dual purpose | |
| CN101845504B (en) | Primer sequence for identifying resistance of cucumber against alternaria cucumerina and identification method thereof | |
| CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN105821135A (en) | Molecular marker closely linked with melon pseudoperonospora cubensis resisting gene and application thereof | |
| WO2015066832A1 (en) | Maize rough dwarf disease resistance-related major quantitative trait locus and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |