CN102533625A - Recombinant strain for producing isobutanol by using tapioca starch as raw materials and construction method and application thereof - Google Patents
Recombinant strain for producing isobutanol by using tapioca starch as raw materials and construction method and application thereof Download PDFInfo
- Publication number
- CN102533625A CN102533625A CN2011103153927A CN201110315392A CN102533625A CN 102533625 A CN102533625 A CN 102533625A CN 2011103153927 A CN2011103153927 A CN 2011103153927A CN 201110315392 A CN201110315392 A CN 201110315392A CN 102533625 A CN102533625 A CN 102533625A
- Authority
- CN
- China
- Prior art keywords
- bacterial strain
- isopropylcarbinol
- recombinant bacterial
- flour
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Provided is a recombinant strain for producing isobutanol by using tapioca starch as raw materials. The recombinant strain is obtained through expressing amylase genes from bacillus licheniformis, acetolactate synthase genes from bacillus subtilis, acetohydroxy acid reduction isomerase genes and dihydroxy acid dehydratase genes from colibacillus and keto acid decarboxylase genes from lactococcus lactis cremoris in a host. Tapioca starch can be converted to produce the isobutanol directly by using the recombinant strain.
Description
Technical field
The invention belongs to technical field of bioengineering, particularly a kind of recombinant bacterial strain and construction process and application that utilizes tapioca(flour) for the raw material production isopropylcarbinol.
Background technology
Isopropylcarbinol (2-methylpropanol) can be used for producing petroleum additive, oxidation inhibitor, paint solvent, softening agent, viton, synthetic drugs, also is that important senior solvent is gone up in industry, is the important batching of producing coating, varnish.
Isopropylcarbinol has the biological degradation of being easy to, and does not have the biological accumulation effect, can directly not poison the characteristic of fish, Amphibians, crustaceans and algae.Therefore, isopropylcarbinol is as important industrial raw material, and its production has received attention.
It is the method that adopts chemosynthesis that the scale operation isopropylcarbinol is gone up in industry at present.Isopropylcarbinol produces in propylene oxo process production fourth/octanol technological process: the propylene carbongl group synthesis reaction; Refining butyraldehyde-n and the isobutyric aldehyde of obtaining of thick aldehyde; Butyraldehyde-n and isobutyric aldehyde hydrogenation obtain product propyl carbinol and isopropylcarbinol, and butyraldehyde-n obtains the product octanol through condensation, hydrogenation.Isopropylcarbinol is the sub product of fourth/octanol production process in fact.
Because the throughput of propylene oxo alcohol is limited; Transformation along with the synthetic market of chemical; Main in the world fourth/octanol manufacturer is raised the price like numerous and confused declaration the such as U.S. Yi Siman chemistry, DOW Chemical, Celanese Corp., and the isopropylcarbinol price is further gone up.Therefore, seek instead of propylene carbonylation compound method production isopropylcarbinol and become industrial technology with important future.
Produce in the alcohol compound at microbial fermentation, ethanol is through yeast-leavened method production, and propyl carbinol is the method production through clostridial ABE fermentation.And isopropylcarbinol is different from propyl carbinol, and its hydroxyl does not produce isopropylcarbinol at second above the carbon atom in clostridial ABE fermentation.There are not the natural a large amount of generation isopropylcarbinols of mikrobe at occurring in nature yet.
Therefore,, have only the method for utilizing the approach engineering to transform mikrobe, produce isopropylcarbinol to obtain novel fermentation strain to the problem of isopropylcarbinol biological fermentation.
Summary of the invention
The object of the invention provides a kind of recombinant bacterial strain and construction process and application that utilizes tapioca(flour) for the raw material production isopropylcarbinol; Through transforming colibacillary pathways metabolism; Obtain directly to utilize the bacterial strain of tapioca(flour) Fermentive production of isobutanol, it is the raw material production isopropylcarbinol with the cassava upward that the bacterial strain of this transformation can be used for industry.
The present invention achieves the above object through following technical scheme:
A kind of recombinant bacterial strain Escherichia coli gxas-AIKA that utilizes tapioca(flour) for the raw material production isopropylcarbinol, the depositary institution of this recombinant bacterial strain is Chinese typical culture collection center, preserving number is CCTCC M 2011281.
A kind of plasmid pSTV29-AIIK; It contains alsS, ilvC, ilvD and kdcA gene, these four genes be respectively from Bacillus subtilus acetolactate synthase gene, from colibacillary acetohydroxy acid reduction isomerase gene and dihydroxy-acid dehydratase gene, from the keto acid decarboxylase gene of butterfat lactococcus spp.
A kind of plasmid pSE380-AMY, it contains the amy gene, and this gene is the amylase gene of Bacillus licheniformis Bacillus licheniformis.
Plasmid pSTV29-AIIK and pSE380-AMY express in coli strain jointly.
The coli strain gxas-AIKA that contains plasmid pSTV29-AIIK and pSE380-AMY carries out Fermentive production of isobutanol on the substratum that with the tapioca(flour) is sole carbon source; Concrete grammar be with the gxas-AIKA inoculation in fermention medium; Under 37 ℃, 250r/min condition, cultivate OD to be grown to
600Add the IPTG of final concentration 1mmol/L during for 0.4-0.6, and continue to cultivate 24 hours, obtain containing the fermented liquid of isopropylcarbinol, isopropylcarbinol content is 3 grams per liters.
Substantive distinguishing features and marked improvement that the present invention gives prominence to are: provide a kind of direct fermentation tapioca(flour) to produce the method for isopropylcarbinol.Tapioca(flour) does not need to add in advance glycase and carries out the saccharification processing, can directly be generated isopropylcarbinol by the constructed strain fermentation of the present invention.
Description of drawings
Fig. 1 is the fermented liquid isopropylcarbinol gas phase mensuration figure of recombinant bacterial strain according to the invention.
2.801 minute be isopropylcarbinol, 2.872 minutes is interior mark propyl carbinol.
Embodiment
Below through embodiment technical scheme of the present invention is further described.
Embodiment 1
The construction process that utilizes tapioca(flour) for the recombinant bacterial strain of raw material production isopropylcarbinol according to the invention comprises the steps:
1, the structure of plasmid pSTV29-AIIK
1.1 gene amplification
The total DNA that extracts subtilis is a template, uses upstream primer: GCCTGCGCATGCCACAAAAGCAACAAAAGA, downstream primer: ACGCAGTCGACCTAGAGAGCTTTCG, pcr amplification alsS gene; Extracting colibacillary total DNA is template; Use upstream primer: ACGCAGTCGACAGGAAACAGACCATGGCTAACTACTTCAAT; Downstream primer: CGGGATCCTTAACCCGCAACAGCAATAC, amplification ilvC gene is used upstream primer: CGGGATCCAGGAGATATACCATGCCTAAGTACCGTTC; Downstream primer: GCCGAGCTCTTAACCCCCCAGTTTCGATTTATC, pcr amplification ilvD gene; The total DNA that extracts butterfat lactococcus spp NIZO B1157 is a template, uses upstream primer: GCGAGCTCAGGAAACAGCTATGTATACAGTAGGAG, downstream primer: GCCGAGCTCCTATTTATTTTGCTCAG, pcr amplification kdcA gene.
1.2PCR amplification condition:
Reaction conditions: 94 ℃ of 2min, 94 ℃ of 30s, 54 ℃ of t
1Min, 72 ℃ of t
2Min, 30 circulations; 72 ℃ of 10min.The annealing time t of primer 1-4
1With extension time t
2Be respectively 53 ℃, 1.5min, 58 ℃, 1.5min, 62 ℃, 2min, 59 ℃, 1.5min.
1.3PCR the enzyme of product is cut and is connected
The ilvD fragment of first ilvC fragment, BamHI, SacI double digestion and pSTV29 plasmid with SalI, SacI double digestion with Sal I, BamHI double digestion; Plasmid is bought the precious biotech firm from Dalian; Carry out three fragments and connect construction expression plasmid pSTV29-ilvC-ilvD.Again the alsS fragment of SphI, SalI double digestion is connected construction expression plasmid pSTV29-alsS-ilvC-ilvD with plasmid pSTV29-ilvC-ilvD with SphI, SalI double digestion.The kdcA fragment of at last the SacI enzyme being cut is carried out flush end with the plasmid pSTV29-alsS-ilvC-ilvD that cuts through the SacI enzyme and is connected construction of expression vector pSTV29-alsS-ilvC-ilvD-kdcA.
2, the structure of plasmid pSE380-AMY
2.1 the amplification of amylase gene AMY.
The total DNA that extracts Bacillus licheniformis is as template; With upstream primer 5 '-CGAGCCCATGGCTAAACAACAAAAACG-3 '; Contain the NcoI restriction enzyme site; With downstream primer 5 '-GTACCCATGGTCTGTTTCCTCTATCTTTGAACATAAATTGAAACCG-3 ', contain the NcoI restriction enzyme site, carry out pcr amplification AMY gene.
2.2PCR amplification condition:
Reaction conditions: 94 ℃ of 3min, 94 ℃ of 30s, 48 ℃ of 30s, 72 ℃ of 1.5min, 30 circulations; 72 ℃ of 10min.
2.3PCR the enzyme of product is cut and is connected
The AMY fragment is cut with the NcoI enzyme, be connected with the pSE380 plasmid of cutting with same enzyme then.Make up the pSE380-AMY plasmid.
3, the coexpression of plasmid pSTV29-AIIK and pSE380-AMY
The CaCl of preparation intestinal bacteria BW25113
2Competent cell is transformed into the BW25113 bacterial strain to plasmid pSTV29-AIIK earlier.Become CaCl to the BW25113 bacterial strain refabrication that contains the pSTV29-AIIK plasmid then
2Competence is transformed into the pSE380-AMY plasmid, and two plasmids transform bacterial strain gxas-AIKA and are kept in the flat board.
Embodiment 2
Present embodiment is the fermentation instance that utilizes tapioca(flour) for the recombinant bacterial strain of raw material production isopropylcarbinol according to the invention.
The recombinant bacterial strain that will contain the two plasmids of pSTV29-AIIK and pSE380-AMY is inoculated into the LB substratum, and said LB medium component and content (g/L) are: Tryptones 10, yeast extract 5, sodium-chlor 10.The seed liquor of incubated overnight is inoculated in the fermention medium by 5% inoculum size, and under 37 ℃ of temperature, 250r/min cultivates, OD to be grown to
600The IPTG that adds final concentration 1mmol/L during for 0.4-0.6 induces, under 37 ℃ of temperature, and the 250r/min 24h that ferments.Add isopyknic propyl carbinol in the tunning and carry out gas Chromatographic Determination as interior mark, through with interior target comparative measurement fermented liquid in the amount of isopropylcarbinol.The fermentation yield of measuring and calculating isopropylcarbinol is 3 grams per liters from the tunning gas chromatogram of Fig. 1.Said fermentation culture based component and content (g/L) are: Tapioca Starch 50, yeast powder 0.5.
The isopropylcarbinol determination of yield
Instrument is the Agilent6890 gas chromatograph.Chromatographic condition: phenomen ZB-WAXplus chromatographic column; FID (220 ℃) detector; Injection port pressure is 16.92psi; Post oven temperature, degree is 100 ℃; Hydrogen flowing quantity is 30mL/min; Sample size 0.2uL.
Interior mark: propyl carbinol.
Claims (4)
1. a recombinant bacterial strain gxas-AIKA who utilizes tapioca(flour) for the raw material production isopropylcarbinol is characterized in that, the depositary institution of this recombinant bacterial strain is Chinese typical culture collection center, and preserving number is CCTCC M 2011281.
2. the described construction process that utilizes tapioca(flour) for the recombinant bacterial strain of raw material production isopropylcarbinol of claim 1 may further comprise the steps:
1) from the acetolactate synthase gene of Bacillus subtilus, from colibacillary acetohydroxy acid reduction isomerase gene and dihydroxy-acid dehydratase gene, the keto acid decarboxylase gene insertion vector plasmid from the butterfat lactococcus spp, construction recombination plasmid pSTV29-AIIK.
2) insert amylase gene in the vector plasmid construction recombination plasmid pSE380-AMY from Bacillus licheniformis.
3) transform the host bacterium to recombinant plasmid pSTV29-AIIK and recombinant plasmid pSE380-AMY jointly, make up recombinant bacterial strain gxas-AIKA.
3. the described recombinant bacterial strain that utilizes tapioca(flour) for the raw material production isopropylcarbinol of claim 1, it is characterized in that: said recombinant bacterial strain is a coli strain.
4. the described application that utilizes tapioca(flour) for the recombinant bacterial strain of raw material production isopropylcarbinol of claim 1 is characterized in that: be to be that the said recombinant bacterial strain of prepared using carries out fermentation culture with the tapioca(flour), and in fermented liquid, produce isopropylcarbinol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103153927A CN102533625A (en) | 2011-10-17 | 2011-10-17 | Recombinant strain for producing isobutanol by using tapioca starch as raw materials and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103153927A CN102533625A (en) | 2011-10-17 | 2011-10-17 | Recombinant strain for producing isobutanol by using tapioca starch as raw materials and construction method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102533625A true CN102533625A (en) | 2012-07-04 |
Family
ID=46341662
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011103153927A Pending CN102533625A (en) | 2011-10-17 | 2011-10-17 | Recombinant strain for producing isobutanol by using tapioca starch as raw materials and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102533625A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110452847A (en) * | 2019-08-19 | 2019-11-15 | 山东汇冠康博生物科技有限公司 | A kind of YH-76S bacterial strain of high yield isobutanol and preparation method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080274526A1 (en) * | 2007-05-02 | 2008-11-06 | Bramucci Michael G | Method for the production of isobutanol |
-
2011
- 2011-10-17 CN CN2011103153927A patent/CN102533625A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080274526A1 (en) * | 2007-05-02 | 2008-11-06 | Bramucci Michael G | Method for the production of isobutanol |
Non-Patent Citations (2)
| Title |
|---|
| 林丽华等: "产异丁醇大肠杆菌工程菌的构建", 《生物技术通报》 * |
| 林丽华等: "大肠杆菌中表达关键基因产异丁醇的研究", 《生物技术》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110452847A (en) * | 2019-08-19 | 2019-11-15 | 山东汇冠康博生物科技有限公司 | A kind of YH-76S bacterial strain of high yield isobutanol and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5618995B2 (en) | Production of butanediol by anaerobic microbial fermentation. | |
| CN104619835B (en) | Ketol-acid Reductoisomerase and its application method | |
| CN105051179A (en) | Recombinant microorganisms and uses therefor | |
| CN101851598A (en) | Environmentally-friendly breeding of bacillus subtilis for producing 2,3-butanediol by fermentation with glucose substrate | |
| CN104140959B (en) | Novel esterase as well as coding gene and application of esterase | |
| CN104560852B (en) | The Corynebacterium glutamicum recombinant bacterium that a kind of L phenylalanines saccharic acid conversion ratio is improved | |
| CN107586795A (en) | A kind of method of fermentation by saccharomyces cerevisiae production phloretin | |
| CN107129959A (en) | Produce the construction method and its application of (R) 3-hydroxy-2-butanone engineering strain | |
| CN105936915A (en) | Double-gene knockout engineering bacteria and construction method and application thereof in fermentation production of 1,3-propylene glycol | |
| CN103865869B (en) | Genetically engineered bacterium for producing alpha-ketobutyric acid and application of genetically engineered bacterium | |
| CN105829524A (en) | Recombinant microorganism having increased d(-) 2,3-butanediol productivity, and method for producing d(-) 2,3-butanediol by using same | |
| CN103695493A (en) | Biological synthesis method of 2,3-epoxy squalene | |
| CN101864381A (en) | Breeding of microbial strain for producing 3-hydroxy-2-butanone by fermenting substrate glucose | |
| CN112080452B (en) | High-yield phenyllactic acid bacillus licheniformis genetically engineered bacterium, method for producing phenyllactic acid and application | |
| CN100558884C (en) | Acid-producing Klebsiella and application thereof | |
| CN104046586A (en) | Genetically engineered bacteria and application of genetically engineered bacteria to production of (2R, 3R)-2,3-butanediol | |
| CN106119180A (en) | A kind of mycobacteria recombination engineering bacteria and application thereof | |
| CN111484961A (en) | Gene engineering bacterium for producing 5 α -androstanedione and application thereof | |
| CN103781899B (en) | Butylic fermentation is carried out by the biomass of low-kappa number | |
| CN102703493B (en) | The recombinant bacterial strain of a kind of high yield butanol and construction method thereof | |
| CN116948932A (en) | Construction and application of caffeic acid strain synthesized from head by taking glucose as substrate | |
| CN104789487A (en) | Bacterial strain capable of respectively producing butyric acid and n-butanol and method for producing n-butanol | |
| CN102533625A (en) | Recombinant strain for producing isobutanol by using tapioca starch as raw materials and construction method and application thereof | |
| CN107142287A (en) | The application of sweet wormwood aldehyde double bond reductase DBR1 and its recombinant bacterium in dihydro-β-ionone is prepared | |
| CN114736918A (en) | Recombinant escherichia coli for producing salidroside through integrated expression and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120704 |