CN105936915A - Double-gene knockout engineering bacteria and construction method and application thereof in fermentation production of 1,3-propylene glycol - Google Patents
Double-gene knockout engineering bacteria and construction method and application thereof in fermentation production of 1,3-propylene glycol Download PDFInfo
- Publication number
- CN105936915A CN105936915A CN201610179046.3A CN201610179046A CN105936915A CN 105936915 A CN105936915 A CN 105936915A CN 201610179046 A CN201610179046 A CN 201610179046A CN 105936915 A CN105936915 A CN 105936915A
- Authority
- CN
- China
- Prior art keywords
- gene
- apra
- lactate dehydrogenase
- klebsiella
- acetolactate synthase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1022—Transferases (2.) transferring aldehyde or ketonic groups (2.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01028—D-Lactate dehydrogenase (1.1.1.28)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y202/00—Transferases transferring aldehyde or ketonic groups (2.2)
- C12Y202/01—Transketolases and transaldolases (2.2.1)
- C12Y202/01006—Acetolactate synthase (2.2.1.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
Abstract
The invention discloses double-gene knockout engineering bacteria and a construction method and an application thereof in fermentation production of 1,3-propylene glycol. A D-lactic dehydrogenase gene and an alpha-acetolactate synthetase gene in a genome of a wild type strain for production of 1,3-propylene glycol are knocked out to obtain the engineering strain; the wild type strain for production of 1,3-propylene glycol takes glycerol as a raw material for fermentation production of 1,3-propylene glycol. The engineering bacteria obtained after simultaneous knockout of the two genes of lactic dehydrogenase and acetolactate synthetase are applied in the process of fermentation-process production of 1,3-propylene glycol; the accounting proportion of 1,3-propylene glycol in a fermentation liquid in metabolites is increased, synthesis of lactic acid and 2,3-butylene glycol are simultaneously greatly reduced, and other by-products are not significantly increased. In the process of microbiological fermentation-process production of 1,3-propylene glycol, the role in improving the accounting proportion of 1,3-propylene glycol synthesized by the engineering bacteria and reducing the proportion of the synthesized by-products are played, the production cost is facilitated to be reduced, and the engineering bacteria have important application prospects.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a strain and knock out lactic acid dehydrogenase and acetolactate synthestase simultaneously
The engineering bacteria of gene and construction method thereof and the application in fermenting and producing 1,3-propylene glycol.
Background technology:
1,3-PD (PDO) is a kind of important industrial chemicals, can be applied to pressure high lubrication as organic solvent
The industries such as agent, dyestuff, ink, antifreezing agent.PDO can be used to synthesizing polyester and polyurethane, heterocycle, pharmaceutical intermediate etc., mainly uses
In synthesis PTT (PTT).PTT is continue the polyethylene terephthalate fifties (PET), the seventies
Realize after polybutylene terephthalate (PBT) (PBT) plant-scale new can thread-forming polyester macromolecular material, be a kind of pole
Rising new polyester material.Within 1998, PTT is chosen as one of six big petrochemical industry new products by the U.S..PTT with PET, PBT phase
Ratio, in addition to the chemical resistance with polyester, also has some other more excellent characteristic.Such as the elastic recovery of nylon, at full model
Enclose and can present good characteristic of printing and dyeing continuously without adding special chemical medicine, uvioresistant, ozone and oxynitride
Color, anti-internal stress, the absorption of low water, low electrostatic and good biodegradable, can follow and go back usability etc..Due to PTT's
Having above good characteristic, it has the most widely in carpet industry, dress materials, engineered thermoplastics and other various fields
Application.
Produce the source that it is critical only that raw material monomer PDO of ptt fiber.What PTT dominated the market it is critical only that price, and
The price of PTT depends primarily on the price of PDO.Owing to can not inexpensively prepare PDO, constrain development and the market development of PTT.Directly
Achieving industrialized production to the mid-90 PDO so that PDO price is substantially reduced, PTT just starts industrialized production and answers
With.
Du Pont and shell Liang Jia multinational corporations once used chemical synthesis route, with oxirane or propylene as raw material production
PDO.It is that by-product is many that chemical synthesis produces the shortcoming of PDO, and selectivity and productivity are relatively low, and operating condition needs High Temperature High Pressure,
Equipment investment is huge, and raw material is non-renewable；Simultaneously because limits throughput, PDO price is higher for a long time.
The production method of 1,3-propylene glycol is mainly microbe fermentation method at present.Compared with chemical synthesis, microorganism is sent out
Ferment method produces 1,3-propylene glycol and has the significant advantage that 1, utilizes lower-cost Renewable resource (such as glycerol, Semen Maydis, starch)
For raw material；2, working condition is gentle, easy and simple to handle, is not required to precious metal catalyst；3, selectivity is good, and by-product is less, it is easy to
Isolated and purified；4, environmental pollution is little.Microbe fermentation method is characterized " green industry " to conventional petroleum with biotechnology
The strong challenge that work proposes, has important practical significance, thus increasingly comes into one's own.
Production by Microorganism Fermentation 1,3-propylene glycol is to utilize fermentable glycerol to produce.The most all be found 1,
Ammediol produces strain and is antibacterial, wherein klebsiella (Klebsiella pneumoniae), citrobacter freundii
(Citrobacter freudii) and Clostridium butyricum (Clostridium butyricum) have higher 1,3-propylene glycol and turn
Rate and 1,3-PD produce intensity, have higher DEVELOPMENT PROSPECT, thus have obtained more concern.
The klebsiella being presently used for producing 1,3-propylene glycol is mainly isolatable from soil environment.Klebsiella is only
Glycerol (saccharide can not be utilized) can be utilized to produce 1,3-propylene glycol.During producing 1,3-PD, glycerol generation disproportionation
Reaction, the product in oxidative pathway is consistent with carbohydrate fermentation product, and produces for the necessary ATP of cell growth, produces in oxidation
Thing discharges reducing power NADH while being formed；Reduction approach then consumes reducing power unnecessary in oxidative pathway, generates 1,3-the third two
Alcohol.Glycerol first oxidized generation acetone acid in oxidative pathway；Acetone acid may be converted into multiple fermentation byproduct, as lactic acid, 2,
3-butanediol, succinic acid, acetic acid, ethanol etc..1 mole of acetone acid generates the process of 1 molar lactic acid to consume 1 mole of reducing power, and 2
Mole of acetone acid generates the process of 1 mole of 2,3-butanediol to consume 1 mole of reducing power, and 1 mole of acetone acid generates succinic acid
Process to consume 2 moles of reducing powers；Acetone acid is acetyl-CoA and formic acid by pyruvate formate-lyase catalytic decomposition, formic acid
It is decomposed into CO again2And H2；Acetyl-CoA generates the ATP of excess during forming acetic acid through acetyl phosphate, and through acetaldehyde shape
Become in the reaction of ethanol and to consume 2 moles of reducing powers.Reduction approach includes two-step reaction: the first step, by depending on coenzyme B12's
Glycerol dehydratase dehydrating glycerin with catalyst generates 3-HPA；Second step, is catalyzed 3-hydroxyl by dhaT
Propionic aldehyde reduction generates 1,3-PD, and this process consumes 1 mole of reducing power.
According to the metabolic pathway of klebsiella fermentation glycerol, during the fermentation, cell utilizes substrate glycerol to ferment
Metabolite in addition to principal product 1,3-PD, the also main by-product such as lactic acid, 2,3-butanediol, ethanol, acetic acid, succinic acid
Thing.By-product synthesis mainly has three aspect adverse effects to producing 1,3-propanediol through fermentation: 1) consumes substrate glycerol, reduces the end
The thing conversion ratio to 1,3-propylene glycol；2) during accumulation higher concentration by-product, cell is continued fermentation and forms relatively high inhibition effect,
Obstruction obtains high concentration 1,3-PD fermentation liquid, also reduces target product in fermentation liquor 1,3-PD in whole generation simultaneously
Thank to the proportion in product；3) when broth extraction 1,3-PD, the more separating-purifying 1 that can increase of by-product, 3-third
Glycol difficulty and cost.In Main By product, the yield with lactic acid and 2,3-butanediol is most again, document report wild type gram
During thunder primary Salmonella fermentation glycerol produces 1,3-propylene glycol, by-product lactic acid production reaches as high as more than 40g/L；Next to that
2,3-butanediol, yield reaches as high as more than 30g/L.Therefore, reduce the generation of by-product, especially reduce lactic acid and 2,3-fourth
The production of glycol, generates 1,3-PD level to improving fermentation glycerol, reduces producing 1,3-propanediol through fermentation cost, have weight
The meaning wanted.Research report individually knocks out lactate dehydrogenase gene in lactic acid metabolic pathway of synthesizing, and lactic acid can be greatly reduced
Synthesis, but 2,3-butanediol synthesis simultaneously increases considerably, and illustrates to cut off lactic acid metabolic pathway of synthesizing, and metabolic fluxes mainly turns to 2,
3-butanediol synthesizes, it is impossible to be obviously improved 1,3-PD proportion in total metabolite；And individually knock out 2,3-fourth
Crucial catalyzing enzyme gene in glycol metabolic pathway of synthesizing, can be greatly reduced 2,3-butanediol synthesis, but lactic acid closes simultaneously
One-tenth increases considerably.
Summary of the invention:
It is an object of the invention to provide a kind of lactic acid and 2,3-butanediol metabolic pathway of synthesizing encoding gene of simultaneously knocking out
Dual-gene knock out engineering bacteria and construction method thereof and apply producing in 1,3-PD.
Our early-stage Study finds to knock out klebsiella acetolactate synthestase encoding gene, synthesis breast in fermentation liquid
Acid concentration can reach more than 2 times of wild mushroom, illustrates to cut off 2,3-butanediol metabolic pathway of synthesizing, and metabolic fluxes mainly turns to lactic acid
Synthesis, can not be obviously improved 1,3-PD proportion in total metabolite.If cut off lactic acid and 2,3-simultaneously
Butanediol metabolic pathway of synthesizing, metabolic fluxes is mainly to turn to 1,3-PD synthesis or turn to other metabolic by-product synthesis way
Footpath？As turned to synthesis of acetic acid, ethanol or succinic acid？Whether can promote 1,3-propylene glycol ratio in all metabolites
Example？In view of the complexity of klebsiella metabolism network, there is multiple metabolic by-product route of synthesis, add and knock out dual-gene
The dynamic (dynamical) unpredictability of glycerol metabolism of engineering bacteria, we not can determine that cut off lactic acid synthesizes generation with 2,3-butanediol simultaneously
Approach of thanking produces the impact of 1,3-propylene glycol to klebsiella fermentation glycerol.Strike owing to klebsiella is carried out consecutive gene
The certain technical difficulty of existence of the genetic manipulation removed, therefore studies and knocks out lactic acid dehydrogenase with acetolactate synthestase to sending out simultaneously
Ferment produces the impact of 1,3-propylene glycol and has novelty.
The dual-gene of the present invention knocks out engineering bacteria, and it builds by the following method, is the open country by producing 1,3-PD
The work that D-lactic acid dehydrogenase gene in the genome of raw type bacterial strain and α-acetolactate synthase gene obtain after knocking out simultaneously
Journey bacterial strain, the described wild-type strain producing 1,3-PD is to produce 1,3-PD with glycerol for fermenting raw materials.
The wild-type strain of described 1,3-PD is preferably the antibacterial of Klebsiella (Klebsiella), enters one
Step is preferably Klebsiella pneumonia (Klebsiella pneumoniae).
The described lactate dehydrogenase gene by Klebsiella pneumonia and acetolactate synthase gene knock out simultaneously, excellent
Choosing knocks out by the following method:
The lactate dehydrogenase gene of a, PCR amplification Klebsiella pneumonia, is connected it with cloning vehicle, imports
In escherichia coli Dh5a containing Red recombinase plasmid pKD46, obtain containing Red recombinase plasmid pKD46 and lactic acid dehydrogenase base
Escherichia coli Dh5a because of cloning vehicle；
B, design be each with two flanks of lactate dehydrogenase gene sequence homology～the primer of 40bp, with plasmid pIJ773 as mould
Plate, PCR amplification Apra+ screens resistant gene box, and purification obtains the Apra+ screening resistance of both sides and lactate dehydrogenase gene homology
Box gene DNA fragmentation；
C, both sides step b obtained are electric with the Apra+ screening resistant gene box DNA fragmentation of lactate dehydrogenase gene homology
Convert in the escherichia coli Dh5a imported containing Red recombinase plasmid pKD46 and lactate dehydrogenase gene cloning vehicle；Induction
Red recombinase is expressed, the Apra+ screening resistant gene box DNA fragmentation of both sides and lactate dehydrogenase gene homology and lactic dehydrogenase
Homologous recombination between enzyme gene clone carrier, goes out the clone bacterium containing recombinant fragment by Apra+ resistance screening；
D, by PCR amplification two ends be long flanking homologous fragment, centre is the DNA of Apra+ resistance screening marker gene box
Fragment；
E, DNA fragmentation electricity step d obtained convert and import the wild type Cray primary containing Red recombinase plasmid pIJ790
In Salmonella, induction Red recombinase is expressed, producer homology weight between two ends long flanking homologous fragment and lactate dehydrogenase gene
Group, is inserted in the middle of lactate dehydrogenase gene by Apra+ resistant gene box, goes out recombinant bacterium by Apra+ resistance screening, i.e. lactic acid
The klebsiella of dehydrogenase gene inactivation；
F, the lactate dehydrogenase gene inactivation obtained to step d klebsiella in electricity proceed to pCP20 plasmid, induction weight
Group expression of enzymes, deletes Apra+ resistant gene by the FRT site at Apra+ resistant gene box two ends, obtains lactate dehydrogenase gene
The klebsiella mutant of inactivation, then converts the plasmid pIJ790 containing Red recombinase and enters lactate dehydrogenase gene
The klebsiella mutant of inactivation, obtains the Cray that the lactate dehydrogenase gene containing Red recombinase plasmid pIJ790 inactivates
Primary Salmonella mutant；
The acetolactate synthase gene of g, PCR amplification Klebsiella pneumonia, is connected it with cloning vehicle, the most again
Import in the escherichia coli Dh5a containing Red recombinase plasmid pKD46, obtain containing Red recombinase plasmid pKD46 and acetolactic acid
The escherichia coli Dh5a of synthase gene cloning vehicle；
H, design be each with two flanks of acetolactate synthase gene homology～the primer of 40bp, with plasmid pIJ773 as mould
Plate, PCR amplification Apra+ screens resistant gene box, and these both sides of purification are anti-with the Apra+ screening of acetolactate synthase gene homology
Property box gene DNA fragmentation；
The Apra+ of i, both sides step h obtained and acetolactate synthase gene homology screens resistant gene box DNA sheet
Section electricity converts and imports containing Red recombinase plasmid pKD46 and the escherichia coli Dh5a of acetolactate synthase gene cloning vehicle
In, induction Red recombinase is expressed, and the Apra+ of both sides and acetolactate synthase gene homology screens resistant gene box DNA fragmentation
And homologous recombination between acetolactate synthase gene cloning vehicle, is gone out containing recombinant fragment by Apra+ resistance screening
Clone bacterium；
J, by PCR amplification two ends be long flanking homologous fragment, centre is the DNA of Apra+ resistance screening marker gene box
Fragment；
K, DNA fragmentation electricity step j obtained convert and import the lactic acid dehydrogenase base containing Red recombinase plasmid pIJ790
Because, in the klebsiella mutant of inactivation, induction Red recombinase is expressed, and two ends long flanking homologous fragment synthesizes with acetolactic acid
Producer homologous recombination between enzyme gene, is inserted in the middle of acetolactate synthase gene by Apra+ resistant gene box, passes through
Apra+ resistance screening goes out recombinant bacterium, the klebsiella that i.e. lactate dehydrogenase gene and acetolactate synthase gene all inactivate；
In the klebsiella that l, the lactate dehydrogenase gene obtained to step k and acetolactate synthase gene all inactivate
Electricity proceeds to pCP20 plasmid, and induction recombinase is expressed, and deletes Apra+ resistance by the FRT site at Apra+ resistant gene box two ends
Gene, it is thus achieved that what lactate dehydrogenase gene and acetolactate synthase gene all inactivated dual-gene knocks out engineering bacteria.
The use of described step a-l with klebsiella lactate dehydrogenase gene and acetolactate synthase gene
Homologous sequence is that lactate dehydrogenase gene is unimportant with which partial sequence of acetolactate synthase gene, as long as lactic acid
Dehydrogenase gene and an acetolactate synthase gene part therein.
Described clone bacterium, plasmid vector: E.coli Dh5a, cloning vehicle such as pMD18-T, plasmid pIJ773, plasmid
PKD46, plasmid pCP20 etc., can buy from commercial company.
Present invention also offers and knock out the dual-gene engineering bacteria that knocks out of lactic acid and 2,3-butanediol metabolic pathway gene and giving birth to
Produce the application in 1,3-PD.
Preferably, described dual-gene knock out engineering bacteria application in producing 1,3-PD, dual-gene knock out engineering bacteria
Substrate glycerol concentration is 1-50g/L during the fermentation, and draft speed is 1.0-3.0vvm, and temperature is 30-40 degree Celsius, and pH is
6.0-8.0。
The present invention utilizes homologous recombination, the method for gene knockout makes the lactic acid in the wild-type strain of product 1,3-propylene glycol take off
Hydrogen enzyme, acetolactate synthase gene inactivate, thus obtain the genetic engineering that lactic acid is deactivated with 2,3-butanediol metabolic pathway
Bacterium.Carry out the fermenting and producing of 1,3-PD with the engineering bacteria of the present invention, lactic acid is greatly reduced with 2,3-butanediol synthesis, and 1,
Ammediol proportion in the metabolite that fermentation glycerol obtains dramatically increases；Due to by-product lactic acid and 2,3-fourth two
Alcohol reduces, and 1,3-PD ratio increases, and reduces production cost.It is demonstrated experimentally that by the engineering bacteria of the present invention according to a conventional method
Fermenting 36 hours, 1,3-PD mass ratio in fermentation glycerol main metabolites is brought up to 68.2% by 55.1%.
The present invention will play a significant role in the industrialized production of Production of 1,3-Propylenediol via Microbiological Fermentation Method, has important application
Prospect.
Accompanying drawing illustrates:
Fig. 1 is to knock out lactate dehydrogenase gene (LDH) schematic diagram；
Fig. 2 is to knock out acetolactate synthase gene (budB/ALS) schematic diagram.
Detailed description of the invention:
Following example are to further illustrate the present invention rather than limitation of the present invention.
Embodiment 1: the e coil k 1 pneumonia that lactic acid metabolic pathway of synthesizing key gene lactate dehydrogenase gene is deactivated
The structure of bacterium mutant.The wild Klebsiella pneumonia of starting strain, building process is as shown in Figure 1.
(l) clone lactate dehydrogenase gene LDH
DNA sequence (No. GenBank: CP000647.1) design primer according to lactate dehydrogenase gene LDH, PCR expands
Gene order, primer sequence is as follows: forward primer LDH-F:5 '-CCTCGGACATTTCCTGTTAAT-3 ') and downstream primer
LDH-R:(5 '-GGCAAACGCTGCAGCGAGCAG-3 ').(it is preserved in Chinese Typical Representative to cultivate with wild type Klebsiella pneumonia
Thing preservation center, deposit number is: CCTCC M 2011075) genomic DNA is template, in drawing of primer LDH-F and LDH-R
Leading down, the nucleotide sequence of PCR amplification lactate dehydrogenase gene LDH, PCR amplification condition is: first 95 DEG C of 3min；Then 94 DEG C
1min, 55 DEG C of 1min, 72 DEG C of 2.5min, totally 35 circulations；Last 72 DEG C of 10min.After reaction terminates, pcr amplification product is entered
Row 1.5% agarose gel electrophoresis, reclaims and purification about 2100bp target DNA fragment, is cloned into carrier pMD18-T
In (TaKaRa company), recombinant products is converted escherichia coli Dh5 α competent cell, screens positive transformant, extract plasmid,
Identified by enzyme action and order-checking, show to obtain the recombinant vector that insertion sequence is correct, named pT-LDH plasmid.It is derived from
Escherichia coli Dh5 α containing pT-LDH plasmid, then will should contain pT-LDH matter containing Red recombinase plasmid pKD46 conversion entrance
In the escherichia coli Dh5 α of grain, be derived from containing Red recombinase plasmid pKD46 and lactate dehydrogenase gene cloning vehicle is big
Enterobacteria Dh5 α.
(2) the Apra resistant gene box with lactate dehydrogenase gene LDH sequence as flank is built
Synthetic primer LDH-Apra-F:5 '-
gaactggaattcttcgatttcctgctgacagcgaagactgTTCCGGGGATCCGTCGACC-3’；LDH-Apra-R:5’-
agtggtctccgaaatgctgatcagcgcctcggcggtgaggGTAGGCTGGAGCTGCTTC-3’.With LDH-Apra-F,
LDH-Apra-R is primer, and with plasmid pIJ773 as template, PCR amplification Apra+ screens resistant gene box, obtains about 1400bp's
DNA fragmentation, its both sides each 40bp sequence and lactate dehydrogenase gene LDH sequence homology, middle for Apra+ screening resistant gene
Box.Reclaim this DNA fragmentation of purification, build the resistant gene box of long flank LDH homologous sequence for next step.
The DNA fragmentation electricity obtained by above purification converts and imports containing Red recombinase plasmid pKD46 and lactic acid dehydrogenase base
Because of in the escherichia coli Dh5 α of cloning vehicle；Induction Red recombinase is expressed, both sides and the Apra+ of lactate dehydrogenase gene homology
Homologous recombination between screening resistant gene box DNA fragmentation and lactate dehydrogenase gene cloning vehicle, is sieved by Apra+ resistance
Select the clone bacterium containing restructuring Apra+ resistant gene box；With LDH-F:5 '-CCTCGGACATTTCCTGTTAAT-3 ' and LDH-R:
(5 '-GGCAAACGCTGCAGCGAGCAG-3 ' it is primer, above one-step cloning bacterium is template, obtains long flank LDH by PCR
The resistant gene box LDH-Apra-LDH of homologous sequence.PCR amplification condition is: first 95 DEG C of 3min；Then 94 DEG C of 1min, 55 DEG C
1min, 72 DEG C of 4min, totally 35 circulations；Last 72 DEG C of 10min.After reaction terminates, pcr amplification product is carried out 1.5% agar
Sugar gel electrophoresis, reclaims and purification about 2700bp target DNA fragment.This DNA fragmentation left side flap LDH homologous sequence is about 500bp,
Right side flap LDH homologous sequence is about 750bp, the middle Apra resistant gene box being about 1400bp.This tool long flank LDH homology sequence
The resistant gene box LDH-Apra-LDH of row builds the engineering bacteria of lactate dehydrogenase gene inactivation for next step.
(3) build with the klebsiella of lactate dehydrogenase gene inactivation
The Apra resistant gene box LDH-Apra-LDH electricity having long flank LDH homologous sequence previous step obtained converts leads
Enter in the wild type klebsiella containing Red recombinase plasmid pIJ790；Induction Red recombinase is expressed, and the long flank in two ends is same
Producer homologous recombination between source fragment and lactate dehydrogenase gene corresponding sequence, is inserted into lactic acid by Apra resistant gene box
In the middle of dehydrogenase gene, filter out recombinant bacterium by Apra resistance (50ug/ml), i.e. the Cray primary of lactate dehydrogenase gene inactivation
Salmonella；Make pIJ790 plasmid loss by passing on, be derived from the klebsiella of lactate dehydrogenase gene inactivation.
(4) Apra resistant gene box is eliminated
PCP20 plasmid electricity is transformed in the klebsiella of the lactate dehydrogenase gene inactivation that previous step obtains, induction
Recombinase is expressed, and makes the Apra resistant gene box between two FRT sequences eliminate, the breast of the Apra resistant gene box that has been eliminated
The klebsiella of dehydrogenase gene inactivation；PCP20 plasmid loss is made by passing on.
By above 4 operating procedures, it is thus achieved that lactic acid metabolic pathway of synthesizing key gene lactate dehydrogenase gene inactivates
Klebsiella pneumonia mutant.
Dash forward converting the Klebsiella pneumonia entering lactate dehydrogenase gene inactivation containing Red recombinase plasmid pIJ790
In mutant, obtain the klebsiella having inactivated lactic acid dehydrogenase containing Red recombinase plasmid pIJ790.
The lung that embodiment 2:2,3-butanediol metabolic pathway of synthesizing key gene acetolactate synthase gene is deactivated
The structure of scorching klebsiella mutant.Building process is as shown in Figure 2.
Starting strain is the Klebsiella pneumonia mutant of the lactate dehydrogenase gene inactivation that embodiment 1 obtains, and builds
Process is as shown in Figure 2.
(l) clone acetolactate synthase gene ALS
DNA sequence (No. GenBank: CP006738.1) design primer according to acetolactate synthase gene ALS, PCR
Amplification gene sequence, primer sequence is as follows: forward primer ALS-F:5 '-atggacaaacagtatccggtacgc-3 ' and downstream
Primer ALS-R:5 '-ttacagaatctgactcagatgcag-3 '.(it is preserved in China's allusion quotation with wild type Klebsiella pneumonia
Type culture collection center, deposit number is: CCTCC M 2011075) genomic DNA is template, at primer ALS-F and ALS-
Under the guiding of R, the nucleotide sequence of PCR amplification acetolactate synthase gene ALS, PCR amplification condition is: first 95 DEG C of 3min；So
Rear 94 DEG C of 1min, 55 DEG C of 1min, 72 DEG C of 2.0min, totally 33 circulations；Last 72 DEG C of 10min.After reaction terminates, PCR is expanded
Product carries out 1.5% agarose gel electrophoresis, reclaims and purification about 1500bp target DNA fragment, is cloned into carrier
In pMD18-T (TaKaRa company), recombinant products is converted escherichia coli Dh5 α competent cell, screen positive transformant, carry
Take plasmid, identified by enzyme action and order-checking, show to obtain the recombinant vector that insertion sequence is correct, named pT-ALS plasmid.
It is derived from the escherichia coli Dh5 α containing pT-ALS plasmid, then this contains will to convert entrance containing Red recombinase plasmid pKD46
In the escherichia coli Dh5 α of pT-ALS plasmid, it is derived from containing Red recombinase plasmid pKD46 and acetolactate synthase gene
The escherichia coli Dh5 α of cloning vehicle.
(2) the Apra resistant gene box with acetolactate synthase gene ALS sequence as flank is built
Synthetic primer ALS-Apra-F:5 '-
CGCCGCGCCGGATGATGCCATCGACCAGGTGGCGAAGCTTTTCCGGGGATCCGTCGACC-3’；ALS-Apra-R:5’-
CGATATTTTGCGCCAGCTTGTTGAGAGTGCCGGCGATATCGTAGGCTGGAGCTGCTTC-3’.With ALS-Apra-F,
ALS-Apra-R is primer, and with plasmid pIJ773 as template, PCR amplification Apra+ screens resistant gene box, obtains about 1400bp's
DNA fragmentation, its both sides each 40bp sequence and acetolactate synthase gene sequence homology, middle for Apra+ screening resistant gene
Box.Reclaim this DNA fragmentation of purification, build the resistant gene box of long flank ALS homologous sequence for next step.
The DNA fragmentation electricity obtained by above purification converts and imports containing Red recombinase plasmid pKD46 and acetolactic acid synthesis
In the escherichia coli Dh5a of enzyme gene clone carrier；Induction Red recombinase is expressed, each 40bp in both sides and acetolactate synthestase base
Because between Apra+ screening resistant gene box DNA fragmentation and the acetolactate synthase gene cloning vehicle of homologous sequence, gene is same
Recombinating in source, goes out the clone bacterium containing restructuring Apra+ resistant gene box by Apra+ resistance screening；With ALS-F:5 '-
Atggacaaacagtatccggtacgc-3 ' and ALS-R:5 '-ttacagaatctgactcagatgcag-3 ' is primer, above
One-step cloning bacterium is template, is obtained the resistant gene box ALS-Apra-ALS of long flank ALS homologous sequence by PCR.PCR expands
Condition is: first 95 DEG C of 3min；Then 94 DEG C of 1min, 55 DEG C of 1min, 72 DEG C of 3min, totally 34 circulations；Last 72 DEG C of 10min.Instead
After should terminating, pcr amplification product is carried out 1.5% agarose gel electrophoresis, reclaim and purification about 2500bp target DNA fragment.
This DNA fragmentation left side flap ALS homologous sequence is about 400bp, and right side flap ALS homologous sequence is about 700bp, middle about 1400bp
Apra resistant gene box.The resistant gene box ALS-Apra-ALS of this tool long flank ALS homologous sequence builds for next step
The engineering bacteria of acetolactate synthase gene inactivation.
(3) build with the klebsiella of acetolactate synthase gene inactivation
The resistant gene box ALS-Apra-ALS electricity having long flank ALS homologous sequence previous step obtained converts importing and contains
Have in the klebsiella having inactivated lactic acid dehydrogenase of Red recombinase plasmid pIJ790 and (embodiment 1 builds)；Induction
Red recombinase is expressed, producer homology between two ends long flanking homologous fragment and acetolactate synthase gene corresponding sequence
Restructuring, is inserted in the middle of acetolactate synthase gene by Apra resistant gene box, is filtered out by Apra resistance (50ug/ml)
The klebsiella that recombinant bacterium, i.e. acetolactate synthase gene and lactate dehydrogenase gene inactivate simultaneously；Make by passing on
PIJ790 plasmid loss.Thus obtain acetolactate synthase gene and citric acid that lactate dehydrogenase gene inactivates simultaneously
Bacterium.
(4) Apra resistant gene box is eliminated
The while that pCP20 plasmid electricity being transformed into acetolactate synthase gene and the lactate dehydrogenase gene that previous step obtains
In the klebsiella of inactivation, induction recombinase is expressed, and makes the Apra resistant gene box between two FRT sequences eliminate, obtains
Eliminate the klebsiella of the dual-gene inactivation of Apra resistant gene box；PCP20 plasmid loss is made by passing on.
Operated by above 4 steps, it is thus achieved that lactic acid and 2,3-butanediol metabolic pathway of synthesizing key gene lactic acid dehydrogenase
The Klebsiella pneumonia mutant that gene and acetolactate synthase gene inactivate simultaneously, is and dual-gene knocks out engineering bacteria.
Embodiment 3: the Klebsiella pneumonia that lactate dehydrogenase gene and acetolactate synthase gene inactivate simultaneously is dashed forward
The lactic acid dehydrogenase of mutant detects with acetolactate synthase activity.
The Klebsiella pneumonia that the lactate dehydrogenase gene of embodiment 2 is inactivated with acetolactate synthase gene simultaneously
Mutant carries out the Activity determination of lactate dehydrogenase gene and acetolactate synthestase, is right with wild type Klebsiella pneumonia
According to, concrete grammar comprises the following steps:
1, the Activity determination of lactic acid metabolism pathway key enzyme lactic acid dehydrogenase:
The lactic acid dehydrogenase base of lactic acid and 2,3-butanediol metabolic pathway key gene is inactivated while embodiment 2 is built
The Klebsiella pneumonia mutant that cause and acetolactate synthase gene inactivate simultaneously carries out the Activity determination of lactic acid dehydrogenase,
With wild-type strain for comparison, concrete grammar comprises the following steps:
(1) take strain inoculation LB culture medium, 37 DEG C of shaken cultivation 12 hours, obtain seed culture bacterium solution；
(2) take seed culture bacterium solution to be seeded in 200ml fermentation medium (see embodiment 4), 37 DEG C of shaken cultivation 12-24
Hour, sampling in every 2 hours is centrifugal collects thalline；
(3) thalline is washed 2 times with phosphate buffer (0.1M, the pH7.5) suspension of 100ml pre-cooling；
(4) with phosphate buffer (0.1M, pH7.5) the suspension thalline of 2.5ml pre-cooling；
(5) ultrasonic disruption thalline (400W probe work 3 seconds, intermittently 3 seconds, ice bath effect 80-100 time)；
(6) 2000g is centrifuged 10min, and enzyme is alive (measures OD340nm with ultraviolet-uisible spectrophotometer for measuring to take supernatant
Change in 1min).Lactic acid dehydrogenase reaction system contains: containing 25mmol L-1PH 7.4 kaliumphosphate buffer 790ul,
5mmol·L-1NADH 80ul, 1mol L-1 MgCl2 10ul、20mmol·L-1Ester of Harden Young 50ul,
400mmol·L-1Acetone acid 50ul, crude enzyme liquid 20 μ L.Start to react spectrophotometer measurement Δ A after adding enzyme liquid340nm/min。
One enzyme unit definition alive is the enzyme amount consumed needed for 1 μm ol NADH for 1 minute.
Result shows, the lung that the lactate dehydrogenase gene of embodiment 2 structure and acetolactate synthase gene inactivate simultaneously
The 1.8%-5.3% that lactic acid dehydrogenase activity is wild-type strain of scorching klebsiella mutant, shows what embodiment 2 built
The lactic acid dehydrogenase of the Klebsiella pneumonia mutant that lactate dehydrogenase gene and acetolactate synthase gene inactivate simultaneously
Inactivation.
2, the Activity determination of 2,3-butanediol metabolic pathway key enzyme acetolactate synthestase:
The lactic acid dehydrogenase base of lactic acid and 2,3-butanediol metabolic pathway key gene is inactivated while embodiment 2 is built
The Klebsiella pneumonia mutant that cause and acetolactate synthase gene inactivate simultaneously carries out the activity of acetolactate synthestase
Detection, with wild-type strain for comparison, concrete grammar comprises the following steps:
L Klebsiella pneumonia mutant that lactate dehydrogenase gene and acetolactate synthase gene are inactivated by () simultaneously
It is inoculated in 100mL culture medium and (every L water contains glycerol 30g, tryptone 10g, yeast powder 5g, NaCl 5g, pH 7.0,120
DEG C sterilizing 20min) in, shaken cultivation 12-24 hour at 37 DEG C, sampling in every 2 hours is centrifugal collects thalline；
(2) thalline is washed 2 times with 100mL phosphate buffer (0.1M, pH7.5) suspension；
(3) with 2.5mL phosphate buffer (0.1M, pH7.5) suspension thalline；
(4) 4 DEG C of ultrasonic disruption thalline；
(5) enzyme activity determination decarboxylation can form acetoin according to acetolactic acid under the conditions of uniform temperature, and acetoin is at alkali
Red material can be generated with the mixture reaction of creatine and alpha-Naphthol under the conditions of property, can detect under 525nm.Reaction system is
1mL 0.1M sodium phosphate buffer (pH 7.0), the wherein Sodium Pyruvate containing 40mmol/L, the magnesium chloride of 1mmol/L, 1mmol/L
TPP, the FAD of 10 μm ol/L, 37 DEG C add 20 μ L enzyme liquid (i.e. crushing thalline liquid) start reaction, add 50 μ L3mol/ after 10min
L sulphuric acid terminates reaction, 37 DEG C of decarboxylation 25min, and after 2 000r/min are centrifuged 1min, supernatant takes 500 μ L and adds after diluting 20 times
0.25mL 0.17% creatine and the alpha-Naphthol of 0.25mL 1.7%, 37 DEG C of colour developing 30min, at 525nm, measure absorbance.Second
The standard curve equation of acyloin is: y=0.0139x, and wherein x is acetoin concentration (μm ol/L), and y is OD525 value.Enzyme unit alive
(IU) it is defined as under the reaction conditions, the enzyme amount needed for catalysis generates 1 μm ol/L acetoin in 1min.
Result shows, the lung that the lactate dehydrogenase gene of embodiment 2 structure and acetolactate synthase gene inactivate simultaneously
The 3.5%-6.0% that acetolactate synthase activity is wild-type strain of scorching klebsiella mutant, shows embodiment 2 structure
The acetyl of the Klebsiella pneumonia mutant that the work lactate dehydrogenase gene built and acetolactate synthase gene inactivate simultaneously
Lactic acid synzyme inactivates.
Embodiment 4: the Klebsiella pneumonia that lactate dehydrogenase gene and acetolactate synthase gene inactivate simultaneously is dashed forward
Mutant (LDH, ALS are dual-gene knocks out bacterium) fermentation glycerol produces 1,3-propylene glycol
(1) culture medium
LB culture medium (g L-1): yeast powder 5, peptone 10, NaCl 10, agar 10, regulation is to pH 7.0, for Cray
The short term storage of primary Salmonella strain and activation.Seed and fermentation medium composition are shown in Table 1:
Table 1: culture medium forms
(2) training method
(i) seed activation: the lactate dehydrogenase gene from the embodiment 2 of glycerol pipe preservation and acetolactate synthestase base
Klebsiella pneumonia mutant because inactivating simultaneously is seeded to the activation of LB medium slant, cultivates work in 12 hours at temperature 37 DEG C
Change seed.
(ii) seed culture: the 9 layers of gauze sealing of 250mL triangular flask, liquid amount 100mL seed culture medium, accesses inclined-plane bacterium
Tongue (activated seed of a step i) ring, carries out aerobic seed culture, temperature 30 DEG C, rotating speed 150r min in shaking table-1。
(iii) fermentation culture: in order to investigate the dual-gene inactivation of constructed LDH, ALS Klebsiella pneumonia is fermented
Glycerol produces the impact of 1,3-PD, loses with the lactate dehydrogenase gene in embodiment 2 and acetolactate synthase gene simultaneously
The Klebsiella pneumonia mutant lived is experimental group, with the wild mushroom Klebsiella pneumonia that sets out as matched group, carries out feed supplement
Batch fermentation, uses Shimadzu LC-20A HPLC to analyze material composition in fermentation liquid.
When 5L stirred fermentor is carried out, liquid amount 3L, inoculum concentration 1%, it is passed through 0.5vvm air and carries out micro-aerobe fermentation
Cultivating, speed of agitator is 200rpm.Fermentation temperature is constant at 37 DEG C；NaOH regulates pH to 6.8, and in sweat, system pH is passed through
The NaOH solution regulation and control that stream adds 40%.Carrying out glycerol feed supplement after bacterial strain enters exponential phase, glycerol concentration controls at 1-
50g/L。
(iv) fermentation results
Fermentation is carried out 36 hours, base consumption, 1,3-PD and other by-product synthesis situation result, is shown in Table 2.
Table 2: inactivation lactate dehydrogenase gene and acetolactate synthase gene are raw to Klebsiella pneumonia fermentation glycerol
Produce the impact of 1,3-propylene glycol
From fermentation results it is known that inactivation LDH, als gene make strain bio amount slightly reduce, glycerol consumption is the most slightly
Edge down low, illustrate that inactivating LDH, ALS exists certain impact to the growth of strain；Inactivation LDH, als gene engineering bacteria synthesis 1,3-
PG concentration the most slightly reduces compared with wild mushroom, but the most notable；Engineering bacteria synthesis 1,3-propylene glycol produces intensity and yield
Without significant difference compared with wild mushroom；Inactivation LDH, als gene engineering bacteria synthesising by-product lactic acid and 2,3-butanediol ratio are wild
Bacterium significantly reduces, wherein lactic acid synthesis reduction by 88.06%, 2,3-butanediol synthesis reduction by 58.36%；Other by-product synthesis nothing
Notable change.Owing to engineering bacterium fermentation synthesising by-product lactic acid, 2,3-butanediol reduce, 1,3-PD accounts for total metabolism product
Ratio significantly improves, raising 13.1% compared with wild mushroom.In engineered strain fermentation liquid, 1,3-propylene glycol accounts for total metabolism product ratio
Example is 1.24 times of wild strain.This shows that engineering strain fermentation glycerol metabolic flux analysis 1,3-PD improves, main by-product
Thing lactic acid and 2,3-butanediol reduce, and during this feature is conducive to product to extract, reduction processes the production cost of by-product,
There is significant application value.
Claims (8)
1. the dual-gene construction method knocking out engineering bacteria of a strain, it is characterised in that be the wild-type strain by producing 1,3-PD
Genome in D-lactic acid dehydrogenase gene and α-acetolactate synthase gene knock out simultaneously after obtain engineered strain, institute
The wild-type strain of the product 1,3-propylene glycol stated is to produce 1,3-propylene glycol with glycerol for fermenting raw materials.
Construction method the most according to claim 1, it is characterised in that the described wild-type strain producing 1,3-PD is
The antibacterial of Klebsiella (Klebsiella).
Construction method the most according to claim 2, it is characterised in that the described wild-type strain producing 1,3-PD is
Klebsiella pneumonia (Klebsiella pneumoniae).
Method the most according to claim 3, it is characterised in that described by the D-breast in the genome of Klebsiella pneumonia
It is by D-breast by RED homologous recombination gene knockout method that dehydrogenase gene and α-acetolactate synthase gene knock out simultaneously
Dehydrogenase gene and α-acetolactate synthase gene knock out.
Method the most according to claim 4, it is characterised in that described by the D-lactic acid dehydrogenase of Klebsiella pneumonia
Gene and α-acetolactate synthase gene knock out and knock out simultaneously, are to knock out by the following method:
The lactate dehydrogenase gene of a, PCR amplification Klebsiella pneumonia, is connected it with cloning vehicle, imports and contains
In the escherichia coli Dh5a of Red recombinase plasmid pKD46, obtain containing Red recombinase plasmid pKD46 and lactate dehydrogenase gene
The escherichia coli Dh5a of cloning vehicle；
B, design be each with two flanks of lactate dehydrogenase gene sequence homology～the primer of 40bp, with plasmid pIJ773 as template,
PCR amplification Apra+ screens resistant gene box, and purification obtains the Apra+ screening resistance base of both sides and lactate dehydrogenase gene homology
Because of box DNA fragmentation；
C, both sides step b obtained convert with the Apra+ screening resistant gene box DNA fragmentation electricity of lactate dehydrogenase gene homology
Import in the escherichia coli Dh5a containing Red recombinase plasmid pKD46 and lactate dehydrogenase gene cloning vehicle；Induction Red weight
Group expression of enzymes, the Apra+ screening resistant gene box DNA fragmentation of both sides and lactate dehydrogenase gene homology and lactate dehydrogenase gene
Homologous recombination between cloning vehicle, goes out the clone bacterium containing recombinant fragment by Apra+ resistance screening；
D, by PCR amplification two ends be long flanking homologous fragment, centre is the DNA fragmentation of Apra+ resistance screening marker gene box；
E, DNA fragmentation electricity step d obtained convert and import the wild type klebsiella containing Red recombinase plasmid pIJ790
In, induction Red recombinase is expressed, producer homologous recombination between two ends long flanking homologous fragment and lactate dehydrogenase gene,
Be inserted in the middle of lactate dehydrogenase gene by Apra+ resistant gene box, go out recombinant bacterium by Apra+ resistance screening, i.e. lactic acid takes off
The klebsiella of hydrogenase gene inactivation；
F, the lactate dehydrogenase gene inactivation obtained to step d klebsiella in electricity proceed to pCP20 plasmid, induce recombinase
Express, delete Apra+ resistant gene by the FRT site at Apra+ resistant gene box two ends, obtain lactate dehydrogenase gene inactivation
Klebsiella mutant, then by containing Red recombinase plasmid pIJ790 convert enter lactate dehydrogenase gene inactivation
Klebsiella mutant, obtain containing Red recombinase plasmid pIJ790 lactate dehydrogenase gene inactivation citric acid
Bacterium mutant；
The acetolactate synthase gene of g, PCR amplification Klebsiella pneumonia, is connected it with cloning vehicle, imports
In escherichia coli Dh5a containing Red recombinase plasmid pKD46, obtain synthesizing containing Red recombinase plasmid pKD46 and acetolactic acid
The escherichia coli Dh5a of enzyme gene clone carrier；
H, design be each with two flanks of acetolactate synthase gene homology～the primer of 40bp, with plasmid pIJ773 as template,
PCR amplification Apra+ screens the Apra+ of resistant gene box, these both sides of purification and acetolactate synthase gene homology and screens resistance
Box gene DNA fragmentation；
I, both sides step h obtained are electric with the Apra+ screening resistant gene box DNA fragmentation of acetolactate synthase gene homology
Convert in the escherichia coli Dh5a imported containing Red recombinase plasmid pKD46 and acetolactate synthase gene cloning vehicle, lure
Lead Red recombinase to express, the Apra+ screening resistant gene box DNA fragmentation of both sides and acetolactate synthase gene homology and second
Homologous recombination between acyl lactic acid synthase gene cloning vehicle, goes out the clone containing recombinant fragment by Apra+ resistance screening
Bacterium；
J, by PCR amplification two ends be long flanking homologous fragment, centre is the DNA fragmentation of Apra+ resistance screening marker gene box；
K, DNA fragmentation electricity step j obtained convert the lactate dehydrogenase gene imported containing Red recombinase plasmid pIJ790 and lose
In the klebsiella mutant lived, induction Red recombinase is expressed, two ends long flanking homologous fragment and acetolactate synthestase base
Producer homologous recombination between Yin, is inserted in the middle of acetolactate synthase gene by Apra+ resistant gene box, passes through Apra
+ resistance screening goes out recombinant bacterium, the klebsiella that i.e. lactate dehydrogenase gene and acetolactate synthase gene all inactivate；
In the klebsiella that l, the lactate dehydrogenase gene obtained to step k and acetolactate synthase gene all inactivate, electricity turns
Entering pCP20 plasmid, induction recombinase is expressed, and deletes Apra+ resistant gene by the FRT site at Apra+ resistant gene box two ends,
Obtain that lactate dehydrogenase gene and acetolactate synthase gene all inactivate dual-gene knocks out engineering bacteria.
6. one kind build according to the construction method described in claim 1,2,3,4 or 5 obtain dual-gene knock out engineering bacteria.
7. dual-gene described in claim 6 knocks out engineering bacteria application in producing 1,3-PD.
8. the application described in claim 7, it is characterised in that the described dual-gene engineering bacteria that knocks out is in producing 1,3-PD
Application, be the dual-gene engineering bacteria substrate glycerol concentration during the fermentation that knocks out be 1-50g/L, draft speed is 1.0-
3.0vvm, temperature is 30-40 degree Celsius, and pH is 6.0-8.0.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610179046.3A CN105936915A (en) | 2016-03-24 | 2016-03-24 | Double-gene knockout engineering bacteria and construction method and application thereof in fermentation production of 1,3-propylene glycol |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610179046.3A CN105936915A (en) | 2016-03-24 | 2016-03-24 | Double-gene knockout engineering bacteria and construction method and application thereof in fermentation production of 1,3-propylene glycol |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105936915A true CN105936915A (en) | 2016-09-14 |
Family
ID=57151279
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610179046.3A Pending CN105936915A (en) | 2016-03-24 | 2016-03-24 | Double-gene knockout engineering bacteria and construction method and application thereof in fermentation production of 1,3-propylene glycol |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105936915A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106282083A (en) * | 2016-09-26 | 2017-01-04 | 中国科学院青岛生物能源与过程研究所 | A kind of utilize the glucose synthesis recombinant bacterium of D lactic acid and construction method thereof and application |
| CN106399217A (en) * | 2016-12-06 | 2017-02-15 | 江南大学 | Method for knocking out arcA to increase yield of Klebsiella 1,3-propylene glycol |
| CN107190025A (en) * | 2017-03-15 | 2017-09-22 | 华中农业大学 | Infection of Toxoplasma Gondii lactate dehydrogenase gene knocks out the construction method and purposes of worm strain |
| CN112501092A (en) * | 2019-09-16 | 2021-03-16 | 南京理工大学 | Base-editing mutant strains of Clostridium Diolis that block glycerol-glucose metabolic pathway |
| CN112646764A (en) * | 2020-12-18 | 2021-04-13 | 山东大学 | Recombinant lactococcus lactis for producing lycopene and application thereof |
| CN113234653A (en) * | 2021-04-22 | 2021-08-10 | 中国科学院青岛生物能源与过程研究所 | Mutant strain for improving content of ethanol produced by fermentation of synthesis gas and application of mutant strain |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1800364A (en) * | 2005-12-05 | 2006-07-12 | 中国农业大学 | Engineered bacterium lacking lactic acid production path and its construction method and uses |
| CN103305543A (en) * | 2013-06-09 | 2013-09-18 | 中国科学院南海海洋研究所 | Engineering bacteria of inactivated acetolactate synthetase, and applications thereof in producing 1,3-propanediol |
| WO2015093832A1 (en) * | 2013-12-16 | 2015-06-25 | 지에스칼텍스 주식회사 | Recombinant microorganism with improved 1,3-propanediol productivity, and method for producing 1,3-propanediol by using same |
-
2016
- 2016-03-24 CN CN201610179046.3A patent/CN105936915A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1800364A (en) * | 2005-12-05 | 2006-07-12 | 中国农业大学 | Engineered bacterium lacking lactic acid production path and its construction method and uses |
| CN103305543A (en) * | 2013-06-09 | 2013-09-18 | 中国科学院南海海洋研究所 | Engineering bacteria of inactivated acetolactate synthetase, and applications thereof in producing 1,3-propanediol |
| WO2015093832A1 (en) * | 2013-12-16 | 2015-06-25 | 지에스칼텍스 주식회사 | Recombinant microorganism with improved 1,3-propanediol productivity, and method for producing 1,3-propanediol by using same |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106282083A (en) * | 2016-09-26 | 2017-01-04 | 中国科学院青岛生物能源与过程研究所 | A kind of utilize the glucose synthesis recombinant bacterium of D lactic acid and construction method thereof and application |
| CN106282083B (en) * | 2016-09-26 | 2019-10-25 | 中国科学院青岛生物能源与过程研究所 | It is a kind of to utilize the recombinant bacterium and its construction method of glucose synthesis D-ALPHA-Hydroxypropionic acid and application |
| CN106399217A (en) * | 2016-12-06 | 2017-02-15 | 江南大学 | Method for knocking out arcA to increase yield of Klebsiella 1,3-propylene glycol |
| CN107190025A (en) * | 2017-03-15 | 2017-09-22 | 华中农业大学 | Infection of Toxoplasma Gondii lactate dehydrogenase gene knocks out the construction method and purposes of worm strain |
| CN107190025B (en) * | 2017-03-15 | 2020-04-14 | 华中农业大学 | Construction method and application of toxoplasma gondii lactate dehydrogenase gene knock-out strain |
| CN112501092A (en) * | 2019-09-16 | 2021-03-16 | 南京理工大学 | Base-editing mutant strains of Clostridium Diolis that block glycerol-glucose metabolic pathway |
| CN112501092B (en) * | 2019-09-16 | 2022-06-28 | 南京理工大学 | Clostridium diolus base-editing mutants blocking glycerol-glucose metabolic pathway |
| CN112646764A (en) * | 2020-12-18 | 2021-04-13 | 山东大学 | Recombinant lactococcus lactis for producing lycopene and application thereof |
| CN112646764B (en) * | 2020-12-18 | 2022-09-20 | 山东大学 | Recombinant lactococcus lactis for producing lycopene and application thereof |
| CN113234653A (en) * | 2021-04-22 | 2021-08-10 | 中国科学院青岛生物能源与过程研究所 | Mutant strain for improving content of ethanol produced by fermentation of synthesis gas and application of mutant strain |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105936915A (en) | Double-gene knockout engineering bacteria and construction method and application thereof in fermentation production of 1,3-propylene glycol | |
| Sun et al. | Efficient production of lactic acid from sugarcane molasses by a newly microbial consortium CEE-DL15 | |
| CN102199570B (en) | Method for constructing gene engineering bacterium for improving microbial fermentation for1,3-propanediol production from glycerol | |
| CN105154476B (en) | A method of efficiently producing 1,3-PD by reducing by-product acetic acid | |
| CN105051181B (en) | The preparation method of the increased recombinant microorganism of the generative capacity of 2,3-butanediol and the 2,3-butanediol using it | |
| CN102933715B (en) | Novel method for producing 3-hydroxypropionic acid from glycerol | |
| WO2009140929A1 (en) | A method for co-production of 1, 3-propanediol, 2,3-butanediol and polyhydroxypropionic acid by fermentation of constructed genetic engineering bacteria | |
| CN104911117A (en) | Method for producing glucaric acid by improving yeast fermentation by use of fusion expression | |
| CN103305543A (en) | Engineering bacteria of inactivated acetolactate synthetase, and applications thereof in producing 1,3-propanediol | |
| CN103146740B (en) | Engineering bacteria for producing 1,3-propylene glycol and method for constructing same | |
| CN106609249B (en) | Klebsiella pneumoniae mutant bacteria and its application for producing 1,3- propylene glycol | |
| CN106867922B (en) | The method of Klebsiella pneumoniae production α-ketoisovaleric acid and isobutanol | |
| CN102899372B (en) | Method for fermentation production of cyclic adenosine monophosphate by controlling dissolved oxygen content at two phases | |
| CN101130782B (en) | Construction method for producing 1,3-trimethylene glycol regrouping saccharomyces cerevisiae with glucose as substrate | |
| CN105400831A (en) | Method for co-production of 1,3-propanediol and glutamic acid through recombined corynebacterium glutamicum | |
| CN104498523B (en) | One strain knocks out engineering bacteria and the application thereof of pyruvate formate-lyase gene | |
| CN106148255B (en) | Engineering bacteria lacking organic acid production way and application thereof in co-production of 1, 3-propylene glycol, 2, 3-butanediol and ethanol | |
| CN103642745A (en) | Method for producing mannitol in biotransformation way by utilizing sucrose as raw material | |
| CN109563471B (en) | Bacterial strains producing 2,3-butanediol and other metabolites | |
| CN112280725B (en) | Recombinant escherichia coli for efficiently producing succinic acid and construction method thereof | |
| CN108085288A (en) | A kind of method using recombinant microorganism fermenting and producing 1,3- propylene glycol | |
| CN111334459B (en) | Construction method and application of Klebsiella engineering bacteria for improving yield of 1, 3-propylene glycol | |
| CN104204206A (en) | A process for butanol production | |
| CN106636156A (en) | Engineering bacterium capable of co-producing long-chain dicarboxylic acid and 1,3-propylene glycol and building method thereof | |
| CN111394396A (en) | Method for producing 1, 3-propylene glycol by using glycerol fermentation by microorganisms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160914 |
|
| RJ01 | Rejection of invention patent application after publication |