CN102453720A

CN102453720A - Fusion promoter capable of realizing high-efficiency expression in pig muscular tissue

Info

Publication number: CN102453720A
Application number: CN2010105270973A
Authority: CN
Inventors: 蒋思文; 邓兵
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2010-10-28
Filing date: 2010-10-28
Publication date: 2012-05-16
Anticipated expiration: 2030-10-28
Also published as: CN102453720B

Abstract

The invention belongs to the field of animal genetic engineering and is characterized in that: six different promoter deletion segments, which are MSTN-P1, MSTN-P2, MSTN-P3, PSTN-P4, MSTN-P5 and MSTN-P6 respectively, at the upstream of an MSTN gene are cloned from a large white pig; the segments are established in pGL3-Basic vectors to determine activities thereof; the MSTN-P2 has stronger activity and the nucleotide sequence thereof is shown as a sequence table SEQ ID NO:2. By adding SV40 enhancer segments into the MSTN-P2, the nucleotide sequence of the MSTN-P2 is shown as a sequence table SEQ ID NO:3. The promoter segments are found to be greatly enhanced in activities through transfected muscle-derived cells and non-muscle-derived cells. The invention discloses the establishment progress of the fusion promoters, thus providing a new genetic resource for genetically modified animals or induced foreign genes for establishing muscle specificity in high-efficiency expression in muscular tissues.

Description

A kind of promoter, fusion in the organizationally efficient expression of pig muscle

Technical field

The invention belongs to animal genetic engineering uses and technical field of molecular biology; Be specifically related to a pig MSTN gene promoter the zone amplification and to its active evaluation; And thereby its transcriptional activity is provided, but do not destroy its muscle specific property to this sequence transformation.

Background technology

Growing of animal is the results of various functioning genes in different time and spacial ordering expression and performance function.Expression of gene regulation and control receive the adjusting of internal and external factor, like allogenic material to the influence of growing, animal growth itself etc.These factors all can produce regulating effect to the genetic expression of individuality.And can be divided into pretranscriptional control, transcriptional level control, post-transcriptional level regulation and control, translation skill regulation and control and protein level regulation and control etc. for gene regulating.Transcriptional level control is important in a gene expression regulation regulation and control link, and it is to receive the mutual coordination of multiple cis and transacting element acting.

Promotor is important cis-acting elements, is one section dna sequence dna that is positioned at 5 ends of gene, and this sequence can and combine promotor gene to transcribe by the identification of RNA enzyme.In this section sequence, have some specific transcription factor binding sequences, these sequences can determine expression of gene frequency and expression specificity.Promotor generally can be divided three classes: 1, constitutive promoter, and the expression of such promotor does not receive the restriction of space-time; 2, inducible promoter, i.e. the expression of gene effect that receives some inductor is just expressed; 3, tissue-specific promoter, i.e. the genetic expression of such promoter regulation has certain tissue specificity.The eukaryotic gene promotor has some typical core textures (Core promoter); Greatly between transcription initiation site-40-+50; Some specific elements such as TATA box are generally arranged in this zone, and this element can combine transcribing of regulation and control downstream gene with TBP (TATA-box-binding protein).Along with going deep into of research, it is found that at the gene promoter upstream region also to have another kind of important sequence-enhanser.But transcribing of this sequence enhancing gene improved and transcribed efficient.Enhanser can work in upstream, catchment or the gene of gene.This sequence at first is found among the SV40 (vacuolating virus of monkey 40), forms by two forward Tumor-necrosis factor glycoproteinss, and each long 72bp, this sequence can effectively improve gene promoter activity, the expression of enhancing gene.

Utilize tissue-specific promoter and inducible promoter, can induce some albumen in specific position and the proteic expression of regulation and control under specific inductive condition.In plant, people will organize with stage specific promotor and use and obtained gratifying achievement in the production.Like (McGranahan GH et al., 1998 such as transgenic fruit tree, tomatoes; Penarrubia L et al., 1992).For plant; Use in the transgenic animal through separating animal's tissue and space-time specific promoter and with it and then to relatively lag behind; This mainly is because existing transgene efficiency is low and the influence of factor such as animal cost costliness, but its application has bigger incentive and wide prospect.As utilize the special promotor of mammary gland to instruct pharmaceutical protein overexpression in mammary gland, can make the genetically engineered drug industrialization.Some scholars are also carrying out positive trial, in transgenic mice milk, efficiently express (Huang Zan etc., 2002) like promotor instructor's plasma thromboplastin component of the beta-casein genes of successful use goats such as Huang Zan.

(Myostatin MSTN) is a member in the TGF-beta superfamily to myostatin, mainly in Skelettmuskel, expresses, and can suppress muscle growth (McPherron, 1997; Thomas, Langley et al.2000).The promotor of MSTN gene is studied more thorough in other species, and the promotor of this gene can be regulated (Spiller et al., 2002) by the transcription factor of muscle specifics such as Myod.The MSTN part promoter sequence of pig has been committed to NCBI in 1998; A large amount of E-box is arranged on this sequence; And E-box can combine transcription factor such as MyoD, Myf5, myogenin, MRF4 of muscle specific etc.; These transcription factors can strengthen its expression, but the author does not verify (Stinckens etal., 2008) to its biological activity.Therefore be necessary the promoter function of this gene is further verified.

It is with a long history to raise pigs, and has formed the local variety of many suitable this locality in the secular domestication process, like plum mountain pig, Tibetan pig, Tongcheng pig, peaceful pig.The local litter size of pig of China is many, meat is good but have the slow characteristics of the speed of growth simultaneously, suitable large-scale production.External kind such as Da Bai, landrace, Du Luoke etc. then have advantages such as fast growth.The introduction of these kinds has greatly improved the intensification level of pig industry, but the meat of producing is relatively poor.Along with growth in the living standard, people can not satisfy people's demand to increasingly high, the traditional breeding mode that requires of meat.Along with development of molecular biology; People induce the expression of specific gene through the promotor of transgenic technology utilization tissue or muscle specific; Can some flavour substancess etc. that improves meat matter be allowed to condition at muscle position high expression level, thereby improve meat matter to solve the deficiency of traditional breeding method mode.But it is very limited nowadays to can be used for genetically modified promotor value volume and range of product; Mainly contain cytomegalovirus (CMV), SV40, human immunodeficiency virus (HIV), human herpes simplex vicus (HSV) and hepatitis B virus constitutive promoters such as (HBV); They do not have space-time or tissue specificity; Utilize them as the promotor that instructs protein expression in the transgenic animal, cause some albumen overexpression easily.The tissue-specific promoter that in Mammals, reports mainly concentrates in the animal's mammary gland tissue, like beta-lact oglobulin (BLG), casein gene and whey acid protein (Fan Baoliang etc., 2005 such as (WAP); Cui Kuiqing etc., 2005; Hennighausen etc., 1992; Whitelaw etc.; 2000); But the special promotor of muscle tissue report is less, can be used for the transgenic pig preparation and have the muscle tissue specific promoter that efficiently expresses of independent intellectual property right also fewer, big limitations the development of transgenic animal; Therefore, obtain tissue specificity and the higher promotor of expression efficiency and become urgent problem.Therefore the present invention is intended to make up the promotor that acquisition is adapted at efficiently expressing in the muscle tissue.Research shows mainly expression (McPherron in muscle tissue of Myostatin (MSTN) gene in mouse; 1997); The applicant tentatively transforms the MSTN promotor as the promotor of candidate gene; With the promotor that obtains to be fit to muscle tissue and to efficiently express, in the hope of later on this promotor effectively being used.

Summary of the invention

The objective of the invention is to be structured in the promotor that efficiently expresses in the pig muscle tissue, and the promotor that obtains is carried out functional checking, understand fully its expression regulation, overcome the deficiency of specific high-efficiency expression promotor comparatively small amt in muscle tissue at present.

Technical scheme of the present invention is as follows:

The applicant is through cloning process, and the clone obtains the promoter, fusion MSTNp2-EnhancerNX of a pig muscle tissue specific expression from the Large White genome, and its nucleotide sequence is shown in sequence table SEQ ID NO:1.

This promotor MSTNp2-EnhancerNX obtains through following steps:

1) according to pig MSTN Gene A Y208121 sequence data; Design primer MSTNPF and MSTNPR; Amplification obtains the promoter fragment MSTNp of 1709bp; Again design 7 primer: MSTNPF1, MSTNPF2, MSTNPF3, MSTNPF4, MSTNPF5, MSTNPF6 and MSTNPR1 then, with preceding 6 primers of described primer respectively with the 7th primer pairing, it is right to obtain 6 primers; With promoter fragment MSTNp is template; Amplification obtains 6 sections dna fragmentations that have Kpn I and Nhe I restriction enzyme site: MSTNp1, MSTNp2, MSTNp3, MSTNp4, MSTNp5 and MSTNp6 are connected to 6 dna fragmentations of above-mentioned amplification in the pGEM-Teasy carrier;

2) be material with the pGL3-Basic carrier; Excise Kpn I and the sequence between the Nhe I restriction enzyme site in this carrier; Cutting step 1 simultaneously) described 6 dna fragmentations that have Kpn I and a Nhe I restriction enzyme site are connected to Kpn I and the sequence between the Nhe I restriction enzyme site in the pGEM-Teasy carrier, and in the fragment after the Kpn I of the directed pGL3-Basic of insertion of 6 fragments carriers that are cut is cut with Nhe I enzyme, structure obtains following carrier: pGL3-MSTNP1; PGL3-MSTNP2; PGL3-MSTNP3, pGL3-MSTNP4, pGL3-MSTNP5 and pGL3-MSTNP6;

3) with step 2) 6 carriers respectively in transfection C2C12 cell and the myotube, verify its activity, obtain intermediate carrier pGL3-MSTNp2;

4) be the dna fragmentation EnhancerNX that template amplification obtains the SV40 of band Nhe I and Xho I restriction enzyme site with carrier pEGFP-N1; Its nucleotide sequence is shown in sequence table SEQ ID NO:3; Described dna fragmentation EnhancerNX is connected among the carrier pGEM-Teasy, obtains carrier pGEM-Teasy-EnhancerNX;

5) with sequence and carrier pGEM-Teasy-EnhancerNX between Nhe I and Xho I endonuclease digestion intermediate carrier pGL3-MSTNP2Nhe I and the Xho I; Dna fragmentation EnhancerNX orientation is inserted between the Nhe I and Xho I of intermediate carrier pGL3-MSTNP2; Obtain promoter, fusion carrier pGL3-MSTNp2-EnhancerNX; Sequence between the KpnI of this carrier and the Xho I restriction enzyme site is promoter, fusion MSTNp2-EnhancerNX, and its nucleotide sequence is shown in sequence table SEQ ID NO:1;

Wherein: the nucleotide sequence of described primer of step 1) and dna fragmentation is as follows:

MSTNPF：TTCAGGGCATCTGGTTTGTGTCT；

MSTNPR：GGGACCAGCAACAATCAGCA；

MSTNPF1：GGGGTACCCAGGGCATCTGGTTTGTG；

MSTNPF2：GGGGTACCTTCCCCAAAAGGAGTAGG；

MSTNPF3：GGGGTACCTGCAACTTTAGGATAGGA；

MSTNPF4：GGGGTACCTTTAGTCAGGAAAACAAG；

MSTNPF5：GGGGTACCTTAAGTATGAAGTGTAAAAG；

MSTNPF6：GGGGTACCTGGAGCAAGAGCCAATCA；

MSTNP：

TTCAGGGCATCTGGTTTGTGTCTGTTTTTCCTTAATCTTTAATGATGAGCAAGTCTAATGCATTATGTAAGGCCATTTTTCTCAAGTGATGTAGATACCTCCTAAGAATTTGATGAAAATGCATTAACTTTTCAGGCTACTGAGTTGCATTTTAGTGCACTGAGGCAGTAAATGAGTGTACAATGTGCAAAAGTAGTGACCTAAAAAATAAATATTTGATATGAACCACTGCATTCTCTTGGAAAAAAAAAAAGTAATGGATTAACTCTCTTAGGAGTCCTTAGCTTCCCCAAAAGGAGTAGGAAGAATAAATCTCCTGTGGCCTGGAAACAGCTTCTGTTTCTCACTGGCTATGTTTGTTTAGCTCTTTAATAGTTCATTTGATTAGATCTTGTGGCTCCTAAAGCTAAGGTTGAGAGTTTGAGCTCTACAGAGGCCACTTAAATTTAGAGAACAAAAAGCTCTATTCTCTGCTCCCAGACCTTACCCCAAATCCCTGCCAGGTGTCTGCCCTCTGGTCAAATGAGAAACTGGCAAAGGGGTGCAAACCTAGCACAGAATTGGGAAACAGAAAAATGGGCACCCTTTATTATGGTGCTCCTTCTCTTTTATGTGTTTACAATACTTGGGCATAATTTACAGAGAATAGATACTACATTTTTTACTTTCACCACTGGAAATCTGAGGCAAACTGCATTATCAGTCATAAAATTCATTATCTTTCTATTCTAAGTTATTCTAAGCTTATTCTAAGCTCAGATAGCTGACATTATCCTCTTGGTAATAAACAATGAAAAAACACATCTTCTGAGCAATATTAATCTGCAACTTTAGGATAGGAGAAAATCAGTTGAAAACTGAGCACGATTTTCACGTGAATAAAAGATATTATTTAAAAATAATTCCATGTGTAATATAACAGAATAAGTATGATTTTCATTATGTACTAGAAATTTAGTCAGGAAAACAAGTTTCTCAAATTATAGCTGAATATATTTTACTAGTATCACAATCTTAAATTTTAATTCAGGTCTTCCTAATTTAAATCTGTATTTCTCTGATTACGCAGGACTAAAAATAATTTAAAACAGCAAATAAAATTCTTTTTTCCTCAAATGTTTGTCTAAATAATGTAAAATCATTTTATTTTTTTGAGGAAAAAGACATTTCAACTTTTTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAA?GCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTCCC

MSTNP1：

CAGGGCATCTGGTTTGTGTCTGTTTTTCCTTAATCTTTAATGATGAGCAAGTCTAATGCATTATGTAAGGCCATTTTTCTCAAGTGATGTAGATACCTCCTAAGAATTTGATGAAAATGCATTAACTTTTCAGGCTACTGAGTTGCATTTTAGTGCACTGAGGCAGTAAATGAGTGTACAATGTGCAAAAGTAGTGACCTAAAAAATAAATATTTGATATGAACCACTGCATTCTCTTGGAAAAAAAAAAAGTAATGGATTAACTCTCTTAGGAGTCCTTAGCTTCCCCAAAAGGAGTAGGAAGAATAAATCTCCTGTGGCCTGGAAACAGCTTCTGTTTCTCACTGGCTATGTTTGTTTAGCTCTTTAATAGTTCATTTGATTAGATCTTGTGGCTCCTAAAGCTAAGGTTGAGAGTTTGAGCTCTACAGAGGCCACTTAAATTTAGAGAACAAAAAGCTCTATTCTCTGCTCCCAGACCTTACCCCAAATCCCTGCCAGGTGTCTGCCCTCTGGTCAAATGAGAAACTGGCAAAGGGGTGCAAACCTAGCACAGAATTGGGAAACAGAAAAATGGGCACCCTTTATTATGGTGCTCCTTCTCTTTTATGTGTTTACAATACTTGGGCATAATTTACAGAGAATAGATACTACATTTTTTACTTTCACCACTGGAAATCTGAGGCAAACTGCATTATCAGTCATAAAATTCATTATCTTTCTATTCTAAGTTATTCTAAGCTTATTCTAAGCTCAGATAGCTGACATTATCCTCTTGGTAATAAACAATGAAAAAACACATCTTCTGAGCAATATTAATCTGCAACTTTAGGATAGGAGAAAATCAGTTGAAAACTGAGCACGATTTTCACGTGAATAAAAGATATTATTTAAAAATAATTCCATGTGTAATATAACAGAATAAGTATGATTTTCATTATGTACTAGAAATTTAGTCAGGAAAACAAGTTTCTCAAATTATAGCTGAATATATTTTACTAGTATCACAATCTTAAATTTTAATTCAGGTCTTCCTAATTTAAATCTGTATTTCTCTGATTACGCAGGACTAAAAATAATTTAAAACAGCAAATAAAATTCTTTTTTCCTCAAATGTTTGTCTAAATAATGTAAAATCATTTTATTTTTTTGAGGAAAAAGACATTTCAACTTTTTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC

MSTNP2：

TTCCCCAAAAGGAGTAGGAAGAATAAATCTCCTGTGGCCTGGAAACAGCTTCTGTTTCTCACTGGCTATGTTTGTTTAGCTCTTTAATAGTTCATTTGATTAGATCTTGTGGCTCCTAAAGCTAAGGTTGAGAGTTTGAGCTCTACAGAGGCCACTTAAATTTAGAGAACAAAAAGCTCTATTCTCTGCTCCCAGACCTTACCCCAAATCCCTGCCAGGTGTCTGCCCTCTGGTCAAATGAGAAACTGGCAAAGGGGTGCAAACCTAGCACAGAATTGGGAAACAGAAAAATGGGCACCCTTTATTATGGTGCTCCTTCTCTTTTATGTGTTTACAATACTTGGGCATAATTTACAGAGAATAGATACTACATTTTTTACTTTCACCACTGGAAATCTGAGGCAAACTGCATTATCAGTCATAAAATTCATTATCTTTCTATTCTAAGTTATTCTAAGCTTATTCTAAGCTCAGATAGCTGA?CATTATCCTCTTGGTAATAAACAATGAAAAAACACATCTTCTGAGCAATATTAATCTGCAACTTTAGGATAGGAGAAAATCAGTTGAAAACTGAGCACGATTTTCACGTGAATAAAAGATATTATTTAAAAATAATTCCATGTGTAATATAACAGAATAAGTATGATTTTCATTATGTACTAGAAATTTAGTCAGGAAAACAAGTTTCTCAAATTATAGCTGAATATATTTTACTAGTATCACAATCTTAAATTTTAATTCAGGTCTTCCTAATTTAAATCTGTATTTCTCTGATTACGCAGGACTAAAAATAATTTAAAACAGCAAATAAAATTCTTTTTTCCTCAAATGTTTGTCTAAATAATGTAAAATCATTTTATTTTTTTGAGGAAAAAGACATTTCAACTTTTTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC

MSTNP3：

TGCAACTTTAGGATAGGAGAAAATCAGTTGAAAACTGAGCACGATTTTCACGTGAATAAAAGATATTATTTAAAAATAATTCCATGTGTAATATAACAGAATAAGTATGATTTTCATTATGTACTAGAAATTTAGTCAGGAAAACAAGTTTCTCAAATTATAGCTGAATATATTTTACTAGTATCACAATCTTAAATTTTAATTCAGGTCTTCCTAATTTAAATCTGTATTTCTCTGATTACGCAGGACTAAAAATAATTTAAAACAGCAAATAAAATTCTTTTTTCCTCAAATGTTTGTCTAAATAATGTAAAATCATTTTATTTTTTTGAGGAAAAAGACATTTCAACTTTTTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC

MSTNP4：

TTTAGTCAGGAAAACAAGTTTCTCAAATTATAGCTGAATATATTTTACTAGTATCACAATCTTAAATTTTAATTCAGGTCTTCCTAATTTAAATCTGTATTTCTCTGATTACGCAGGACTAAAAATAATTTAAAACAGCAAATAAAATTCTTTTTTCCTCAAATGTTTGTCTAAATAATGTAAAATCATTTTATTTTTTTGAGGAAAAAGACATTTCAACTTTTTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAG?CAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC

MSTNP5：

TTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC

MSTNP6：

TGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC。

Concrete steps of the present invention are following:

Technological line of the present invention is seen shown in Figure 1.

At first confirm that according to Literature Consult MSTN is the gene of expressing in the muscle tissue.In the ncbi database retrieval, find the MSTN full length sequence of pig then, the number of landing is AY208121.Through Genebank information; Find its first exon sequence; Choose the sequence about the first exon upper reaches 2000bp; Http:// www.fruitfly.org/cgi-bin/seq_tools/promoter.pl analyzes and finds to have transcription initiation site in the website, on http://www.cbrc.jp/research/db/TFSEARCH.html, analyzes and finds that this sequence has a large amount of transcription factor recognition sites.Through the design primer amplification 1709bp sequence; This sequence is passed through cloning and sequencing; And through the American National biotechnology (NCBI of information center; National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov) BLAST (Basic Local Alignment Search Toll) instrument comparison finds that the sequence of this sequence and website submission has 99% similarity.Then applicant's sequence clone that above-mentioned amplification is obtained is to the pGEM-Teasy carrier; Be the primer of the template promoter fragment that designed 6 pairs of amplification different lengths deletion fragments again and add Kpn I and Nhe I restriction enzyme site in the primer both sides that amplification obtains 6 sections promoter fragments of brachymemma and this 6 fragments is connected to the exactness of order-checking in the pGEM-Teasy carrier and assurance sequence with it.Primer is numbered MSTNpF1, MSTNpF2, MSTNpF3, MSTNpF4, MSTNpF5, MSTNpF6, MSTNpR.Extract above-mentioned segmental plasmid then, be connected in the pGL3-Basic plasmid after utilizing Kpn I and Nhe I enzyme that above-mentioned fragment enzyme is scaled off, transfecting eukaryotic cells is confirmed the fragment that activity is the highest through the activity that detects the Luc+ reporter gene that above-mentioned fragment drives.Choose the highest active pGL3-MSTNp2 then as the intermediate carrier that connects enhanser.The applicant is a template with the pEGFP-N1 carrier again, and the design primer also adds NheI and the XhoI restriction enzyme site, and primer mark is EnhancerNX-F, R.Amplification obtains to contain the fragment of SV40 enhanser, is labeled as EnhancerNX, this fragment is connected to the pGEM-Teasy carrier, the exactness of sequence verification sequence.Above-mentioned fragment is connected in the intermediate carrier pGL3-MSTNp2 plasmid; Make up a promoter, fusion carrier; Called after pGL3-MSTNp2-EnhancerNX; Sequence between Kpn I and the Nhe I restriction enzyme site is the promoter, fusion fragment MSTNp2-EnhancerNX that builds, and its nucleotides sequence is classified SEQ IDNO:1 as.The applicant is with intermediate carrier pGL3-MSTNp2 and promoter, fusion carrier pGL3-MSTNp2-EnhancerNX transfection myocyte C2C12 and pig kidney cell PK-15 cell; Through measuring the activity of the Luc+ reporter gene that above-mentioned fragment drives; Relatively whether they exist bigger difference, confirm whether the promoter, fusion that makes up efficiently expresses in muscle tissue.

The invention has the advantages that:

(1) the present invention has analyzed the segmental activity of MSTN promotor different lengths first; Find active higher fragment MSTNp2; And the applicant adds the SV40 enhanser after this sequence, makes up promoter, fusion carrier pGL3-MSTNp2-EnhancerNX, and this promoter, fusion activity improves greatly.

(2) the present invention has verified this promoter, fusion carrier pGL3-MSTNp2-EnhancerNX transfection muscle-derived cell and non-muscle-derived cell its activity simultaneously; Confirm that the promoter, fusion activity all is higher than MSTNp2 in two kinds of cells, and the activity in the muscle-derived cell is higher than non-muscle-derived cell far away.

Description of drawings

Sequence table SEQ ID NO:1 is the nucleotide sequence of the pig MSTN gene promoter MSTNp2-EnhancerNX that the present invention cloned, and length is 1539bp.

Sequence table SEQ ID NO:2 is the nucleotide sequence of the pig MSTN gene promoter MSTNP2 that the present invention cloned, and length is 1422bp.

Sequence table SEQ ID NO:3 is the nucleotide sequence of the SV40 enhanser EnhancerNX that the present invention cloned, and length is 117bp.

Fig. 2 is the MSTN promoter fragment electrophorogram of the present invention's amplification, and length is 1709bp, i.e. brighter band between the 1000-2000bp.

The electrophoretogram that Fig. 3 identifies for the different lengths deletion fragment double digestion that the present invention makes up from left to right is respectively DL2000 marker, pGL3-MSTNp6, pGL3-MSTNp7, pGL3-MSTNp4, pGL3-MSTNp3, pGL3-MSTNp2, pGL3-MSTNp1.

After Fig. 4 is the myotube of different deletion fragment transfection C2C12 and C2C12 differentiation, two uciferase activities.

Fig. 5 has obtained SV40 enhanser EnhancerNX fragment for amplification.

Fig. 6 for pGL-3MSTNp2-EnhancerNX utilizes different enzyme enzymes cut the evaluation collection of illustrative plates.From left to right be respectively DL2000 marker, NheI and XhoI endonuclease bamhi, KpnI and NheI endonuclease bamhi, KpnI and XhoI endonuclease bamhi.

Fig. 7 is the two uciferase activities behind pGL3-MSTNp2 and the pGL3-MSTNp2-EnhancerNX transfection C2C12.

Fig. 8 is the two uciferase activities behind pGL3-MSTNp2 and the pGL3-MSTNp2-EnhancerNX transfection PK-15.

Fig. 9 is the comparative result of two uciferase activities in PK-15 and C2C12 cell of pGL3-MSTNp2 and pGL3-MSTNp2-EnhancerNX.

Figure 10 is the used pGL3-Basic carrier information of the present invention.

Figure 11 is the used pGL3-Control carrier information of the present invention.

Figure 12 is the used pGL3-TK carrier information of the present invention.

Figure 13 is the used pGEM-Teasy carrier information of the present invention.

Embodiment

Embodiment 1: the acquisition of pig muscle organizing specific expression promotor MSTNP fragment and different deletion fragments

1, main agents:

Phenol (Chemical Reagent Co., Ltd., Sinopharm Group), chloroform (Chemical Reagent Co., Ltd., Sinopharm Group), primary isoamyl alcohol (Chemical Reagent Co., Ltd., Sinopharm Group), plasmid extraction kit (available from OMEGA company), pGEM-Teasy carrier (Pu Luomaige (Beijing) Bioisystech Co., Ltd, i.e. U.S. Promega company), 2 * GC Buffer (precious biotechnology Dalian ltd), LA Taq polysaccharase (precious biotechnology Dalian ltd), dNTP (available from Fermentas company), DL-2000 Marker (available from Fermentas company), AC pillar agarose DNA reclaim test kit (available from Bio Teke company)

2, pig blood extracting genome DNA

The used Large White DNA appearance of the present invention is that conventional phenol/chloroform method for extracting extracts genomic dna, and the concrete operations step is following:

(1) 0.5mol/LEDTA of preparation pH8.0 is as antithrombotics, and the sterilization back is drawn about 1mL and added in the 50mL centrifuge tube.

(2) from Large White (Shizishan Street, Hongshan District, Wuhan City, Hubei Province Hua Zhong Agriculture University animal technical college elaboration pig farm; The market pig kind of China's public use) precaval vein is taked the blood sample about 20mL; Add in the 50mL centrifuge tube of antithrombotics, take back the laboratory and be used to separate white corpuscle.

(3) get 10mL left and right sides blood sample,, carefully abandon upper serum with 3000rpm, 4 ℃ of centrifugal 10min.

(4) Xiang Guanzhong adds the distilled water of 1.5 times of volumes, shakes gently with broken red blood cell, and the time is controlled in the 10min, avoids the cracking overlong time, and white corpuscle breaks.

(5) 5000rpm, 4 ℃ of centrifugal 10min carefully abandon upper strata red corpuscle slurry, avoid lower floor's white corpuscle to pour out.

(6) Xiang Guanzhong adds 10mL 0.9%NaCl solution washing, and 5000rpm, 4 ℃ of centrifugal 10min abandon supernatant, obtains the white corpuscle deposition.

(7) in white corpuscle, add 1 * SET damping fluid suspension cell, add Proteinase K (10mg/L) to concentration 100 μ g/mL, 10%SDS spends the night to 0.5%, 55 ℃ of digestion of final concentration.

(8) treat that cell dissociation adds the saturated phenol of equal-volume, the mixing 20min that turns upside down gently, 5000rpm, 4 ℃ of centrifugal 10min in the back well.

(9) carefully draw supernatant with the heavy caliber suction nozzle of cutting sharp mouth, protein layer in the middle of avoiding sucking moves into a new 50mL centrifuge tube with supernatant, abandons lower floor's phenol.

(10) join phenol/chloroform/primary isoamyl alcohol (volume ratio is 25: 24: 1) mixed solution, upwards add isopyknic mixed solution in the supernatant in a step, reverse centrifuge tube gently, mixing 15min, 10000rpm, 4 ℃ of centrifugal 15min suct clearly to another clean pipe.

(11) add isopyknic chloroform/primary isoamyl alcohol (volume ratio is 24: 1), mixing 15min, 10000rpm, 4 ℃ of centrifugal 15min suct clearly to another clean pipe.

(12) Xiang Guanzhong adds the absolute ethyl alcohol of 2.5 times of volume precoolings, the mixing centrifuge tube that turns upside down, and visible DNA separates out.

(13) with the cotton-shaped DNA of rifle head sucking-off in the centrifuge tube of a 1.5mL, with 70% washing with alcohol once, the centrifugal 5min of 10000rpm abandons upper strata ethanol.

(14) with centrifuge tube dry DNA in stink cupboard, add 300 μ LTE dissolving DNAs in the end to pipe, be stored in-20 ℃ subsequent use.

3, the acquisition of pig gene M STN promoter fragment

At ncbi database retrieval pig gene M STN full length sequence (accession number AY208121).Through the annotation information of Genebank, find its first exon sequence, choose the sequence about the first exon upper reaches 2000bp, in the website Http:// www.fruitfly.org/cgi-bin/seq tools/promoter.plAnalyze and find to have transcription initiation site, Http:// www.cbrc.jp/research/db/TFSEARCH.htmlLast analysis finds that this sequence has a large amount of transcription factor recognition sites.Through having designed a pair of special primer (primer called after MSTNPF and MSTNPR, its sequence is seen table 1), the 1709bp sequence that increased, this sequence comprise 1521bp5 ' upstream sequence and 188bp exon sequence.The sequence called after MSTNP of amplification.Amplified fragments detected result such as Fig. 2.

The PCR reaction system is: 2.5 μ l, 10 * LA Taq Buffer, and 2 μ l 2mM dNTP, 0.5 μ l, 10 μ M primer MSTNPF and MSTNPR, 1U LA Taq enzyme, 0.5 μ l DNA adds deionized water and mends to 25 μ l.The PCR reaction conditions is: 94 ℃ of preparatory sex change 4min, and 94 ℃ of sex change 40s of 10 circulations, 60 ℃ of annealing 40s, 72 ℃ are extended 2min; Each cycle annealing reduces by 0.5 ℃, 94 ℃ of sex change 4min of 30 circulations then, 58 ℃ of annealing 40s; 72 ℃ are extended 2min, and after 40 circulations, 72 ℃ are extended 10min altogether.Primer is as shown in table 1

Table 1 designed primer sequence of the present invention

Table 1 explanation: underscore partly is a restriction enzyme site, and MSTNPF1-6 is a Kpn I restriction enzyme site, and MSTNPR1 is a Nhe I restriction enzyme site; Thickened portion is the protectiveness base.

The PCR product reclaims purifying: the agarose gel electrophoresis of amplification PCR products warp 1.5% is detected; Under the uv lamp purpose band (1709bp) is downcut behind the electrophoresis 20min; Put into the 1.5ml centrifuge tube, then through PCR product purification test kit (Beijing hundred Tyke Bioisystech Co., Ltd, product article No.: DP1701); Reclaim purified pcr product by its specification sheets, will reclaim product be saved to-20 ℃ subsequent use.

The recovery product connects: will reclaim product and connect by following system and carrier pGEM-Teasy (available from Pu Luomaige (Beijing) Bioisystech Co., Ltd, i.e. U.S. Promega company).Linked system is: 2.5 μ l, 2 * Ligbuffer, and 0.5 μ l pGEM-Teasy vector, 0.5 μ l T4 ligase, 1.5 μ l reclaim product, and mixed system is put to the 4 ℃-connection of spending the night.

Connecting product transforms: will connect product with the rifle head of sterilizing and add ice bath 30min in the 30 μ l competence (Quan Shijin); 42 ℃ of heat shock 45s then; Put rapidly then to 2min on ice, add the not LB substratum of ammonification benzyl of 400 μ l, put into 37 ℃ of constant temperature shaking table recovery 45min.Then, remove 300 μ l supernatants, remaining supernatant is dispelled bacterial precipitation with the centrifugal 4min of 4000rpm/min; And they are applied in the LB solid medium flat board that contains 100 μ g/ml ammonia benzyls; 37 ℃ just putting cultivate 30min after, be inverted and cultivated 14-16 hour, observe and have or not white colony to grow.

Screening positive clone and sequence verification: dip in from flat board with the toothpick of sterilizing and to get in the LB liquid nutrient medium that mono-clonal inserts 500 μ l, 100 μ g/ml, and put into 37 ℃ of shaking table enlarged culturing 6h.With bacterium liquid is template; MSTNPF, MSTNPR are that primer carries out pcr amplification by the segmental condition of amplification MSTNP, and pcr amplification finishes after electrophoresis detection; Positive clone's of this clone's possibility of purpose bar carrying means is arranged, positive colony is delivered to the order-checking of the big genome company of China.With sequence assembly and through BLAST and AY208121 sequence alignment, the result shows that the sequence of amplification is the promoter sequence of Large White MSTN gene after the order-checking.The positive colony that order-checking is correct is to extracting plasmid, this plasmid called after pGEM-MSTNp plasmid through TIANprep Mini Plasmid Kit test kit.

4, the acquisition of the different deletion fragments of pig MSTN gene promoter

With the pGEM-MSTNp plasmid is template, has designed the promoter deletion fragment of 6 pairs of amplification different lengths sizes, and primer is called after MSTNPF1-6 and MSTNPR1 respectively.Upstream primer adds Kpn I restriction enzyme site; Downstream primer adds Nhe I restriction enzyme site; And add the protectiveness base in the primer both sides, and primer sequence and bonded position such as table 1, the fragment length of amplification is respectively 1705bp, 1422bp, 884bp, 754bp, 531bp, 268bp.The different lengths promoter fragment that amplification is obtained carries out electrophoresis, and purifying and recovering purpose band, is connected to the pGEM-Teasy carrier, transforms then, picking positive colony and carry out sequence verification, concrete operations step such as the segmental acquisition of pig MSTN gene promoter.Above-mentioned 6 segmental positive colony enlarged culturing be will contain then, and plasmid, plasmid called after: pGEM-T-MSTNp1, pGEM-T-MSTNp2, pGEM-T-MSTNp3, pGEM-T-MSTNp4, pGEM-T-MSTNp5 and pGEM-T-MSTNp6 extracted.

Embodiment 2: the structure of the corresponding deletion fragment carrier of pig MSTN promotor

1, main agents

Kpn I and Nhe I restriction endonuclease (available from Fermentas company), T4 ligase enzyme (precious biotechnology Dalian ltd), plasmid extraction kit (available from OMEGA company), pGL3-Basic carrier (available from Pu Luomaige (Beijing) Bioisystech Co., Ltd).

2, the carrier and the pGL3-Basic carrier double digestion that contain different deletion fragments

With Kpn I and Nhe I enzymes double zyme cutting plasmid pGEM-T-MSTNp1, pGEM-T-MSTNp2, pGEM-T-MSTNp3, pGEM-T-MSTNp4, pGEM-T-MSTNp5 and pGEM-T-MSTNp6 and pGL3-Basic carrier.The double digestion system is: 2 μ l, 10 * Tango Buffer, and 1 μ l Kpn I, l μ l Nhe I, 4 μ l plasmids and 12 μ l aqua sterilisas, 37 ℃ of enzymes are cut 6h.Enzyme is cut the promoter fragment of back with 6 difference-sizes of purification kit recovery, reaches the band after pGL3-Basic carrier enzyme is cut.With receive product be stored in-20 ℃ subsequent use.

3, the framework of recombinant vectors

Band connection after the promoter fragment that 6 different lengthss of double digestion are big or small is cut respectively at pGL3-Basic carrier enzyme is built into recombinant vectors, respectively called after pGL3-MSTNp1, pGL3-MSTNp2, pGL3-MSTNp3, pGL3-MSTNp4, pGL3-MSTNp5, pGL3-MSTNp6.Linked system is: the fragment after 2 μ l pGL3-Basic carrier enzymes are cut, and the promoter fragment of the different lengths size after 6 μ l enzymes are cut, 1 μ l T4 ligase enzyme, 1 μ l, 10 * T4 DNA ligation Buffer, 16 ℃ connect 12h.Be converted into then in the DH5 α competence, the picking positive colony also carries out sequence verification, concrete operations step such as the segmental acquisition of pig MSTN gene promoter.For the positive colony enlarged culturing, utilize the little extraction reagent kit of intracellular toxin plasmid that goes of OMEGA company to extract plasmid, and survey the concentration and the OD260/OD280 of plasmid.Used plasmid concentration determining instrument is: NanoDrop2000 Spectrophotometer.The plasmid that extracts 2 carries out double digestion and carries out enzyme and cut evaluation set by step, and whether confirm to extract plasmid correct.Enzyme is cut and is identified collection of illustrative plates such as Fig. 3.

Embodiment 3: promoter deletion fragment of the present invention determination of activity

1, main agents:

Foetal calf serum (FBS is available from GBICO company), the high sugar soln of DMEM (available from GBICO company), 0.25% pancreatin (available from GBICO company), Lipofectamin ^TM2000 liposomes (available from Invitrogen company); Dual-LuciferaseReporter Assay System (available from Pu Luomaige (Beijing) Bioisystech Co., Ltd), PBS powder (available from DECENT BIOTECH company, article No.: p100p), pGL3-Control (available from Pu Luomaige (Beijing) Bioisystech Co., Ltd), PRL-TK (available from Pu Luomaige (Beijing) Bioisystech Co., Ltd)

2, main consumptive material:

24 porocyte culture plates (Costar), Tissue Culture Flask, disposable sterilized suction pipe, disposable syringe, enzyme plate (Costar) etc.

3, cell cultures is with the preparation of solution

The PBS preparation: convert the 1000ml ultrapure water with a bag PBS powder, the dissolving back is subsequent use behind 121 ℃ of autoclaving 30min.

Cell culture medium: draw nine parts of high sugar solns of DMEM with disposable syringe and convert a FBS, subsequent use behind the mixing, whole process is noted aseptic technique.

4, transfection is with the preparation of cell

Transfection previous day with 1.5 * 10 ⁵Density inoculation C2C12 cell to 24 orifice plate in, treat behind the 18-24h that cell grows to 80% and converges, carry out transfection experiment.

5, cell transfecting

(1) before transfection, changes cell in 24 orifice plates into fresh culture, so that let cell grow to best growth conditions.

(2) be dissolved in the 50 μ l Opti-MEM serum free mediums by every hole 0.8 μ g amount.PGL3-MSTNp1, pGL3-MSTNp2, pGL3-MSTNp3, pGL3-MSTNp4, pGL3-MSTNp5, three repetitions of each plasmid of pGL3-MSTNp6 plasmid.While is with the pGL3-Basic plasmid and pGL3-Control is negative and positive control.Be dissolved in the 50 μ lOpti-MEM serum free mediums simultaneously and do positive control with confidential reference items (PRL-TK) plasmid of every hole 0.04 μ g.Room temperature static 5min in back in plasmid mixing and the Opti-MEM serum free medium.

(3) by every hole 2 μ l (plasmids: Lipofectamin ^TM2000 liposomes=1: 2.5) Lipofectamin ^TMThe amount of 2000 liposomes (Invitrogen) is dissolved in the 50 μ l Opti-MEM serum free mediums.Then press every hole 0.1 μ l Lipofectamin for confidential reference items ^TMThe amount of 2000 liposomes is dissolved in the 50 μ l Opti-MEM serum free mediums, the static 5min of room temperature.

(4) will dissolve good Lipofectamin behind the 5min ^TM2000 mix with the good plasmid of dissolving, and the static 20min of room temperature is for confidential reference items also mixing in an identical manner.

(5) get the solvent interior participation liposome complex of 100 μ l behind the static 20min and carefully drop to and treat in the cells transfected, rock culture plate while dripping, so that mixture is evenly distributed in the cell culture medium.Carefully different promoters deletion fragment and liposome complex are carefully dropped in the cell culture medium by dividing into groups again after adding well.

(6) Tissue Culture Plate is carefully put into CO ₂In the incubator, change substratum into fresh culture behind the cultivation 6h and continue to cultivate collecting cell behind the 24h.

6, uciferase activity is measured

(1) solution preparation

The preparation of cell pyrolysis liquid PLB: with the sterilization ultrapure water of 1 part of 5 * Passive Lysis Buffer (PLB) with 4 parts of volumes, mixing is used for cell harvesting gently.

LAR II luciferase is analyzed the substrate preparation: 10ml luciferase in the test kit is analyzed buffered soln II all add in the fluorescence Soviet Union enzyme analysis substrate in the brown bottle, wait to dissolve back lucifuge-70 ℃ preservation.

1 * Stop&Glo Reagent reagent preparation: draw 1 part of 50 * Stop&Glo Substrate and be dissolved in and be diluted to 1 * Stop&Glo Reagent reagent among the Stop&Glo Buffer, join existing usefulness at present.

(2) collection of cell

Collecting cell behind the transfection 24h; At first, clean one time with PBS then, in each hole, add 120 μ l cell pyrolysis liquids, the 1 * PLB for preparing then the substratum sucking-off; Room temperature is rocked the abundant lysing cell of 15min, then lysate is collected in the 1.5ml centrifuge tube.

(3) determination of activity

Draw lysate and add the enzyme plate bottom, with the VICTOR of PerkinElmer company ^TMX ²Multilabel Plate Reader instrument carries out two uciferase activities and measures.The detailed process of measuring is following:

A, open to open again to measure behind the computer of monitoring instrument and use instrument.

Software is measured in b, startup, and the Dispenser maintenance under the Tool in the selection tool hurdle, ejects dialog box.

C,

selection sample channel

1 and 2 clean 2 times sample channel with the sterilization ultrapure water.

D, selection sample channel 1 continue to clean with the sterilization ultrapure water, and whether individual inspiration pipeline sample introduction is normal, the ultrapure water after having cleaned in the emptying pipe 1.

E, selection sample channel 1 are selected Fill, fill up pipeline 1 with LARII, and the LARII that will reclaim in the cup reclaims utilization again.

F, selection sample channel 2 clean the back emptyings to pipeline 2 separately with the sterilization ultrapure water.

G, selection sample channel 2 are selected Fill, fill up pipeline 1 with Stop buffer, and the Stop buffer that will reclaim in the cup reclaims utilization again.

H, the enzyme plate that will add cell pyrolysis liquid are put into Multilaber Reader.

I, entering software interface are selected automatic application of sample Auto-dual-luciferase, test routine.

The sample that j, selection will be measured, and select to preserve the preservation that the result is set, select to measure button sample is measured.

K, measured the back and select Tool Dispenser maintenance down, ejected dialog box, selection Empty discharges excessive solution.

L, c cleans sample channel set by step, closes instrument and computer after having cleaned.

(4) the different fragments promoter activity is analyzed

The applicant utilizes SPSS13.0 that different fragments length promoter activity is carried out statistical study after at first data being carried out rough handling (M1/M2).Find out the highest active fragment, statistical result showed pGL3-MSTNp2 is higher with respect to other fragment.Result such as Fig. 4.

Embodiment 4: the structure of promoter, fusion MSTNp2-EnhancerNX

1, main agents:

Nhe I restriction endonuclease; Xho I restriction endonuclease (available from NEB company); T4 ligase enzyme (precious biotechnology Dalian ltd); Plasmid extraction kit (available from OMEGA company); Carrier pGEM-Teasy (available from Pu Luomaige (Beijing) Bioisystech Co., Ltd); 2 * GC Buffer (available from precious biotechnology Dalian ltd); LA Taq polysaccharase (available from precious biotechnology Dalian ltd); DNTP (available from Fermentas company); DL-2000 Marker (available from Fermentas company); AC pillar agarose DNA reclaims test kit (available from Bio Teke company); Carrier pEGFP-N1 (available from Pu Luomaige (Beijing) Bioisystech Co., Ltd)

2, the acquisition of enhancer sequence

At first according to the sequence information of pEGFP-N1 carrier, the primer in design band NheI restriction endonuclease and XhoI endonuclease digestion site is a template with pEGFP-N1 to the applicant, and amplification has obtained the enhanser fragment.Primer called after: EF and ER, the fragment called after EnhancerNX of amplification, primer sequence is: EF:CTA GCTAGCGGAATGTGTGT CAGTTAG, ER:CCG CTCGAGGAGTTAGGGGCGGGACTA (underscore in the above-mentioned primer is a restriction enzyme site, and thickened portion is the protectiveness base), amplified fragments electrophoresis detection result such as Fig. 5,

The PCR reaction system is: 12.5 μ l, 2 * GC Buffer, and 2 μ l 2mM dNTP, 0.5 μ l, 10 μ M primer EF and ER, 1U LA Taq enzyme, 0.5 μ l DNA adds ultrapure water and mends to 25 μ l.The PCR reaction conditions is: 94 ℃ of preparatory sex change 4min; 94 ℃ of sex change 40s of 35 circulations, 68 ℃ of annealing 40s, 72 ℃ are extended 25s; 72 ℃ are extended 10min.

3, enhanser is connected to the pGEM-Teasy carrier

PCR reaction is carried out electrophoresis detection after finishing, and the PCR product reclaims, and connects, and transforms, and chooses bacterium, and order-checking confirms that the fragment of amplification is correct and be connected to the pGEM-Teasy carrier, and called after pGEM-T-EnhancerNX also extracts plasmid, be stored in-20 ℃ subsequent use.Detailed process is with the process among the embodiment one 3

4, the enhanser fragment is connected to intermediate carrier pGL3-MSTNp2

PGEM-T-EnhancerNX and intermediate carrier pGL3-MSTNp2 are carried out double digestion with NheI restriction endonuclease and XhoI restriction endonuclease simultaneously.The enzyme system of cutting is: 2 μ l 10X Buffer2, and 1 μ l Xho I, 1 μ l Nhe I, 4 μ l plasmids, 0.2 μ l BSA add aqua sterilisa polishing to 20 μ l, and 37 ℃ of enzymes are cut 6h.Enzyme is cut the back and is reclaimed the enhanser fragment about 120bp with purification kit, reaches the band after intermediate carrier pGL3-MSTNp2 enzyme is cut.Reclaim product be stored in-20 ℃ subsequent use.

5, the structure of promoter, fusion

The enhanser fragment that reclaims is connected with the T4DNA ligase enzyme with band after intermediate carrier pGL3-MSTNp2 enzyme is cut; Linked system is: the fragment after 2 μ l pGL3-MSTNp2 carrier enzymes are cut; Enhanser fragment after 6 μ l enzymes are cut; 1 μ l T4 ligase enzyme, 1 μ l, 10 * T4DNA ligationBuffer, 16 ℃ connect 12h.Be converted into then in the DH5 α competence; The picking positive colony also carries out sequence verification, extracts plasmid and also measures plasmid concentration, be stored in-20 ℃ subsequent use; Plasmid called after pGL3-MSTNp2-EnhancerNX, the acquisition of the different deletion fragments of concrete operations step such as pig MSTN gene promoter.The plasmid pGL3-MSTNp2-EnhancerNX that extracts carries out double digestion and carries out enzyme and cut and identify whether confirm to extract plasmid correct.Double digestion is divided into three kinds of modes and identifies; Utilize Kpn I and Nhe I enzyme to cut and confirm to contain the MSTNp2 fragment in this promoter, fusion carrier; Utilize Nhe I and Xho I enzyme to cut and confirm to contain EnhancerNX in this promoter, fusion carrier; Utilize Kpn I and Xho I enzyme to cut and confirm to contain the MSTNp2-EnhancerNX fragment in this promoter, fusion carrier, this fragment comprises MSTNp2 and EnhancerNX.Preceding two kinds of enzyme systems of cutting are seen before.The system of utilizing Kpn I and Xho I enzyme to cut is: 2 μ l, 10 * BamH I Buffer, and 1 μ lXho I, 1 μ l Kpn I, 4 μ l plasmids add aqua sterilisa polishing to 20 μ l, and 37 ℃ of enzymes are cut 6h.Enzyme is cut and is identified collection of illustrative plates such as Fig. 6; Double digestion is identified and order-checking shows that all promoter, fusion fragment carrier pGL3-MSTNp2-EnhancerNX makes up successfully; Sequence between the Kpn I of carrier pGL3-MSTNp2-EnhancerNX and the Xho I restriction enzyme site is promoter, fusion MSTNp2-EnhancerNX, and its nucleotide sequence is shown in SEQ ID NO:1.

Embodiment 5: promoter, fusion carrier pGL3-MSTNp2-EnhancerNX and intermediate carrier pGL3-MSTNp2 specific activity are

1, main agents consumptive material, cell cultures and liposome transfection cell step are all with embodiment 3

2, two kinds of promoter vector activity comparisons in different cells

With promoter vector pGL3-MSTNp2-EnhancerNX of the present invention and intermediate carrier pGL3-MSTNp2 difference transfection C2C12 and PK-15 cell; Rotaring transfecting mode is with embodiment 3; Through measuring the activity of two carriers in different cells, relatively whether the pGL3-MSTNp2-EnhancerNX activity is higher than pGL3-MSTNp2 after the transfection.The result shows that the activity of the promoter vector pGL3-MSTNp2-EnhancerNX that the present invention makes up is higher than the activity of intermediate carrier pGL3-MSTNp2 (seeing Fig. 7 and shown in Figure 8) far away; The activity of promoter vector pGL3-MSTNp2-EnhancerNX of the present invention in myocyte C2C12 inferred it and can in the pig muscle tissue, be regulated and control efficiently expressing of genes involved also apparently higher than non-myocyte PK-15 (see figure 9).

Reference:

1, Cui Kuiqing etc., the clone of buffalo beta-casein 5 ' promoter region and sequential analysis Guangxi agro-ecology science, 2005,24 (2): 94-98;

2, Fan Baoliang etc., the mensuration of buffalo alpha-lactalbumin gene partial sequence with analyze Chinese herding magazine, 2005,41 (7): 21-24;

3, Huang Zan etc., the transgenic mice milk that goat β 2 promotor of casein gene instruct efficiently expresses human blood coagulation IX, Acta Genetica Sinica, 2002,29 (3): 206～211;

4、Hennighausen，L.The?prospects?for?domesticating?milk?protein?genes.J?Cell?Biochem.1992，49(4)：325-32.

5、McPherron?et?al.，Regulation?of?skeletal?muscle?mass?in?mice?by?a?new?TGF-b?superfamily?member.Nature，1997，387：83e90；

6、McGranahan?et?al.，Agrobacterium-mediated?transformation?of?walnut?somatic?embryos?and?regeneration?oftransgenic?plants.Nature?Biotechnology，1988，6，800-804；

7、Penarrubia?et?al.，Production?of?the?sweet?protein?monellin?in?transgenic?plants.Nature?Biotechnology，1992，10，?561-564；

8、Spiller?et?al.，The?myostatin?gene?is?a?downstream?target?gene?of?basic?helix-loop-helix?transc?ription?factorMyoD.Mol?Cell?Biol，2002，22：7066-7082.

9、Stinckens?et?al.，Characterization?of?the?complete?porcine?MSTN?gene?and?expression?levels?in?pig?breedsdiffering?in?muscularity.Animal?Genetics，2008，39，586-596.

10、Thomas?et?al.，Myostatin，a?negative?regulator?of?muscle?growth，functions?by?inhibiting?myoblastproliferation.J?Biol?Chem.2000，275(51)：40235-43；

11、Whitelaw，CB.Nucleosome?organisation?ofthe?beta-lactoglobulin?gene.Transcription?complex?formation.AdvExp?Med?Biol.2000，480：147-53。

Claims

1. the promoter, fusion MSTNp2-EnhancerNX of a pig muscle tissue specific expression, its nucleotide sequence is shown in sequence table SEQ IDNO:1.

2. the promoter, fusion MSTNp2-EnhancerNX of a pig muscle tissue specific expression, it obtains through following steps:

5) with sequence and carrier pGEM-Teasy-EnhancerNX between Nhe I and Xho I endonuclease digestion intermediate carrier pGL3-MSTNP2 Nhe I and the Xho I; Dna fragmentation EnhancerNX orientation is inserted between the Nhe I and Xho I of intermediate carrier pGL3-MSTNP2; Obtain promoter, fusion carrier pGL3-MSTNp2-EnhancerNX; Sequence between the Kpn I of this carrier and the Xho I restriction enzyme site is promoter, fusion MSTNp2-EnhancerNX, and its nucleotide sequence is shown in sequence table SEQ ID NO:1;

MSTNPF：TTCAGGGCATCTGGTTTGTGTCT；

MSTNPR：GGGACCAGCAACAATCAGCA；

MSTNPF1：GGGGTACCCAGGGCATCTGGTTTGTG；

MSTNPF2：GGGGTACCTTCCCCAAAAGGAGTAGG；

MSTNPF3：GGGGTACCTGCAACTTTAGGATAGGA；

MSTNPF4：GGGGTACCTTTAGTCAGGAAAACAAG；

MSTNPF5：GGGGTACCTTAAGTATGAAGTGTAAAAG；

MSTNPF6：GGGGTACCTGGAGCAAGAGCCAATCA；

MSTNP：

TTCAGGGCATCTGGTTTGTGTCTGTTTTTCCTTAATCTTTAATGATGAGCAAGTCTAATGCATTATGTAAGGCCATTTTTCTCAAGTGATGTAGATACCTCCTAAGAATTTGATGAAAATGCATTAACTTTTCAGGCTACTGAGTTGCATTTTAGTGCACTGAGGCAGTAAATGAGTGTACAATGTGCAAAAGTAGTGACCTAAAAAATAAATATTTGATATGAACCACTGCATTCTCTTGGAAAAAAAAAAAGTAATGGATTAACTCTCTTAGGAGTCCTTAGCTTCCCCAAAAGGAGTAGGAAGAATAAATCTCCTGTGGCCTGGAAACAGCTTCTGTTTCTCACTGGCTATGTTTGTTTAGCTCTTTAATAGTTCATTTGATTAGATCTTGTGGCTCCTAAAGCTAAGGTTGAGAGTTTGAGCTCTACAGAGGCCACTTAAATTTAGAGAACAAAAAGCTCTATTCTCTGCTCCCAGACCTTACCCCAAATCCCTGCCAGGTGTCTGCCCTCTGGTCAAATGAGAAACTGGCAAAGGGGTGCAAACCTAGCACAGAATTGGGAAACAGAAAAATGGGCACCCTTTATTATGGTGCTCCTTCTCTTTTATGTGTTTACAATACTTGGGCATAATTTACAGAGAATAGATACTACATTTTTTACTTTCACCACTGGAAATCTGAGGCAAACTGCATTATCAGTCATAAAATTCATTATCTTTCTATTCTAAGTTATTCTAAGCTTATTCTAAGCTCAGATAGCTGACATTATCCTCTTGGTAATAAACAATGAAAAAACACATCTTCTGAGCAATATTAATCTGCAACTTTAGGATAGGAGAAAATCAGTTGAAAACTGAGCACGATTTTCACGTGAATAAAAGATATTATTTAAAAATAATTCCATGTGTAATATAACAGAATAAGTATGATTTTCATTATGTACTAGAAATTTAGTCAGGAAAACAAGTTTCTCAAATTATAGCTGAATATATTTTACTAGTATCACAATCTTAAATTTTAATTCAGGTCTTCCTAATTTAAATCTGTATTTCTCTGATTACGCAGGACTAAAAATAATTTAAAACAGCAAATAAAATTCTTTTTTCCTCAAATGTTTGTCTAAATAATGTAAAATCATTTTATTTTTTTGAGGAAAAAGACATTTCAACTTTTTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTCCC

MSTNP1：

MSTNP2：

TTCCCCAAAAGGAGTAGGAAGAATAAATCTCCTGTGGCCTGGAAACAGCTTCTGTTTCTCACTGGCTATGTTTGTTTAGCTCTTTAATAGTTCATTTGATTAGATCTTGTGGCTCCTAAAGCTAAGGTTGAGAGTTTGAGCTCTACAGAGGCCACTTAAATTTAGAGAACAAAAAGCTCTATTCTCTGCTCCCAGACCTTACCCCAAATCCCTGCCAGGTGTCTGCCCTCTGGTCAAATGAGAAACTGGCAAAGGGGTGCAAACCTAGCACAGAATTGGGAAACAGAAAAATGGGCACCCTTTATTATGGTGCTCCTTCTCTTTTATGTGTTTACAATACTTGGGCATAATTTACAGAGAATAGATACTACATTTTTTACTTTCACCACTGGAAATCTGAGGCAAACTGCATTATCAGTCATAAAATTCATTATCTTTCTATTCTAAGTTATTCTAAGCTTATTCTAAGCTCAGATAGCTGACATTATCCTCTTGGTAATAAACAATGAAAAAACACATCTTCTGAGCAATATTAATCTGCAACTTTAGGATAGGAGAAAATCAGTTGAAAACTGAGCACGATTTTCACGTGAATAAAAGATATTATTTAAAAATAATTCCATGTGTAATATAACAGAATAAGTATGATTTTCATTATGTACTAGAAATTTAGTCAGGAAAACAAGTTTCTCAAATTATAGCTGAATATATTTTACTAGTATCACAATCTTAAATTTTAATTCAGGTCTTCCTAATTTAAATCTGTATTTCTCTGATTACGCAGGACTAAAAATAATTTAAAACAGCAAATAAAATTCTTTTTTCCTCAAATGTTTGTCTAAATAATGTAAAATCATTTTATTTTTTTGAGGAAAAAGACATTTCAACTTTTTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC

MSTNP3：

MSTNP4：

TTTAGTCAGGAAAACAAGTTTCTCAAATTATAGCTGAATATATTTTACTAGTATCACAATCTTAAATTTTAATTCAGGTCTTCCTAATTTAAATCTGTATTTCTCTGATTACGCAGGACTAAAAATAATTTAAAACAGCAAATAAAATTCTTTTTTCCTCAAATGTTTGTCTAAATAATGTAAAATCATTTTATTTTTTTGAGGAAAAAGACATTTCAACTTTTTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC

MSTNP5：

TTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC

MSTNP6：

3. the preparation method of the promoter, fusion MSTNp2-EnhancerNX of a pig muscle tissue specific expression, its step is following:

MSTNPF：TTCAGGGCATCTGGTTTGTGTCT；

MSTNPR：GGGACCAGCAACAATCAGCA；

MSTNPF1：GGGGTACCCAGGGCATCTGGTTTGTG；

MSTNPF2：GGGGTACCTTCCCCAAAAGGAGTAGG；

MSTNPF3：GGGGTACCTGCAACTTTAGGATAGGA；

MSTNPF4：GGGGTACCTTTAGTCAGGAAAACAAG；

MSTNPF5：GGGGTACCTTAAGTATGAAGTGTAAAAG；

MSTNPF6：GGGGTACCTGGAGCAAGAGCCAATCA；

MSTNP：

MSTNP1：

CAGGGCATCTGGTTTGTGTCTGTTTTTCCTTAATCTTTAATGATGAG?CAAGTCTAATGCATTATGTAAGGCCATTTTTCTCAAGTGATGTAGATACCTCCTAAGAATTTGATGAAAATGCATTAACTTTTCAGGCTACTGAGTTGCATTTTAGTGCACTGAGGCAGTAAATGAGTGTACAATGTGCAAAAGTAGTGACCTAAAAAATAAATATTTGATATGAACCACTGCATTCTCTTGGAAAAAAAAAAAGTAATGGATTAACTCTCTTAGGAGTCCTTAGCTTCCCCAAAAGGAGTAGGAAGAATAAATCTCCTGTGGCCTGGAAACAGCTTCTGTTTCTCACTGGCTATGTTTGTTTAGCTCTTTAATAGTTCATTTGATTAGATCTTGTGGCTCCTAAAGCTAAGGTTGAGAGTTTGAGCTCTACAGAGGCCACTTAAATTTAGAGAACAAAAAGCTCTATTCTCTGCTCCCAGACCTTACCCCAAATCCCTGCCAGGTGTCTGCCCTCTGGTCAAATGAGAAACTGGCAAAGGGGTGCAAACCTAGCACAGAATTGGGAAACAGAAAAATGGGCACCCTTTATTATGGTGCTCCTTCTCTTTTATGTGTTTACAATACTTGGGCATAATTTACAGAGAATAGATACTACATTTTTTACTTTCACCACTGGAAATCTGAGGCAAACTGCATTATCAGTCATAAAATTCATTATCTTTCTATTCTAAGTTATTCTAAGCTTATTCTAAGCTCAGATAGCTGACATTATCCTCTTGGTAATAAACAATGAAAAAACACATCTTCTGAGCAATATTAATCTGCAACTTTAGGATAGGAGAAAATCAGTTGAAAACTGAGCACGATTTTCACGTGAATAAAAGATATTATTTAAAAATAATTCCATGTGTAATATAACAGAATAAGTATGATTTTCATTATGTACTAGAAATTTAGTCAGGAAAACAAGTTTCTCAAATTATAGCTGAATATATTTTACTAGTATCACAATCTTAAATTTTAATTCAGGTCTTCCTAATTTAAATCTGTATTTCTCTGATTACGCAGGACTAAAAATAATTTAAAACAGCAAATAAAATTCTTTTTTCCTCAAATGTTTGTCTAAATAATGTAAAATCATTTTATTTTTTTGAGGAAAAAGACATTTCAACTTTTTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC

MSTNP2：

TTCCCCAAAAGGAGTAGGAAGAATAAATCTCCTGTGGCCTGGAAACAGCTTCTGTTTCTCACTGGCTATGTTTGTTTAGCTCTTTAATAGTTCATTTGATTAGATCTTGTGGCTCCTAAAGCTAAGGTTGAGAGTTTGAGCTCTACAGAGGCCACTTAAATTTAGAGAACAAAAAGCTCTATTCTCTGCTCCCAGACCTTACCCCAAATCCCTGCCAGGTGTCTGCCCTCTGGTCAAATGAGAAACTGGCAAAGGGGTGCAAACCTAGCACAGAATTGGGAAACAGAAAAATGGGCACCCTTTATTATGGTGCTCCTTCTCTTTTATGTGTTTACAATACTTGGGCATAATTTACAGAGAATAGATACTACATTTTTTACTTTCACCACTGGAAATCTGAGGCAAACTGCATTATCAGTCATAAAATTCATTATCTTTCTATTCTAAGTTATTCTAAGCTTATTCTAAGCTCAGATAGCTGACATTATCCTCTTGGTAATAAACAATGAAAAAACACATCTTCTGAGCAATATTAATCTGCAACTTTAGGATAGGAGAAAATCAGTTGAAAACTGAGCACGATTTTCACGTGAATAAAAGATATTATTTAAAAATAATTCCATGTGTAATATAACAGAATAAGTATGATTTTCATTATGTACTAGAAATTTAGTCAGGAAAACAAGTTTCTCAAATTATAGCTGAATATATTTACTAGTATCACAATCTTAAATTTTAATTCAGGTCTTCCTAATTTAAATCTGTATTTCTCTGATTACGCAGGACTAAAAATAATTTAAAACAGCAAATAAAATTCTTTTTTCCTCAAATGTTTGTCTAAATAATGTAAAATCATTTTATTTTTTTGAGGAAAAAGACATTTCAACTTTTTAAGTATGAAGTGTAAAAGAATTACTTATTTAAATTACAATTTTAAAGTTTCACTAATAAAGATTAATAATATTTAAGTGCAGTTTATATTATTGTTAACATAGATTTTAATTTTTCAAATGTCACATATATCTTTCATTATTTGTAGATTTATTTCTTTTATGAAGTAGTCAAATGAATCAGCTCACCCTTGACTGTAACAAAATACTGTTTGGTGACTTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC

MSTNP3：

MSTNP4：

MSTNP5：

MSTNP6：

TGGAGCAAGAGCCAATCATAGATCCTGACGACACTTGTCTCATCAAGTGGAATATAAAAAGCCACTTGGAATACAGTATAAAAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACAGTGCAGGCATTAAAATTTTGCTTGGCGTTACTCAAAAGCAAAAGTAAAAGGAAGAAATAAGAACAAGGAGAAAGATTGTATTGATTTTAAAATCATGCAAAAACTGCAAATCTATGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTC 。

4. the application of the described promoter regulation gene of claim 1 in the pig muscle tissue expression.