CN102399864A - Methylated DNA detection method based on primer protection releasing - Google Patents

Abstract

The invention relates to a methylated DNA detection method, comprising the following steps: step1. treating a DNA to be detected with sulfite; step 2. selecting a segment of continuous sequence in a target area to be detected and synthesizing a PCR primer with a tailed primer sequence; step 3. adding a TaqDNA polymerase and a DNA polymerase with 3'-5' exonuclease activity to carry out PCR amplification reaction; step 4. carrying out a secondary PCR amplification with a tailed primer with fluorescent label; step 5. determining mobility of the DNA fragment in a capillary electrophoresis and determining whether methylated DNA exists in the sample. The invention enhances reliability of the detection result and has high sensitivity and great significance on early stage detection of tumour, customized treatment, condition determination and relapse monitor, etc.

Description

The detection method of the methylate DNA that protection is removed based on primer

Technical field

The present invention relates to a kind of methylate DNA detection method, relate in particular to a kind of detection method of the methylate DNA that protection is removed based on primer.

Background technology

Dna methylation be meant CpG site on the DNA chain cytosine(Cyt) (C) residue 5 'Modified a methyl on the carbon.Dna methylation is one of dna modification of finding the earliest, is the important component part of epigenetics.Occur on the cytosine(Cyt) residue of the CpG dinucletide on the DNA chain to the dna methylation characteristic, this is common in gene 5 'The end expression regulation sequence.Dna methylation has vital role in the regulation and control of genetic expression, participated in processes such as animal embryo growth, the gene marking and x chromosome inactivation.Research shows that the change of dna methylation can cause the change of chromatin Structure, DNA conformation, dna stability and protein interaction mode, thereby controlling gene is expressed.

The change of dna methylation state is an important factor that causes tumour.The unusual rising of the local methylation level in CpG island can cause not expressing of genomic instability and cancer suppressor gene.If activated allelic inactivation in the cancer suppressor gene, the probability that cancer then takes place will improve.So the noticeable place of dna methylation is exactly the application in the early detection of tumour, because showing the variation of epigenetic, research follows the generation and the development of tumour, the change that detects dna methylation can help the early discovery of tumour.

The methylated research of tumour at present mainly concentrates on cancer suppressor gene.This is the generation of tumour possibly methylate with the CpG island of cancer suppressor gene promoter region to cause cancer suppressor gene to close relevant because it is found that.Because the local height on CpG island methylates early than the neoplasm of cell, so the detection of dna methylation can be used for tumorigenic early prediction.

The methylated detection method in CpG island is numerous, and its principle is respectively based on methylating responsive digestion with restriction enzyme method and based on the PCR detection method of S-WAT modifying DNA.The susceptibility that methylates restriction enzyme/Southern method (methylation-sensitive restriction Endonuclease/Southern, MSRE-Southern) is more traditional method, and sensitivity is low, and the sample requirement is big.(Methylation Specific PCR MSP) and deutero-methylate DNA detection method, is the domestic method that detects dna methylation at present to methylate DNA specific PCR method, has the highly sensitive while, and false positive rate is also very high.

Summary of the invention

The invention provides a kind of detection method of methylate DNA, have fluorescently-labeled tail primer, DNA is carried out pcr amplification, carry out the method for electrophoresis detection then, judge whether to exist methylate DNA through design.

The detection method of methylate DNA of the present invention, step is following:

Step 1 is with sulfiting and purifying DNA to be measured, the non-methylate DNA of standard and standard methylation DNA;

Step 2 is confirmed the surveyed area of testing gene, the gene region that will detect, select one section sequence that contains a plurality of CpG site to carry out design of primers, with 5 of this section sequence as the target detect sequence 'One section sequence of end is as the PCR forward primer, with 3 of this section sequence 'The complementary sequence of one section sequence of end is as the PCR reverse primer; At 5 of bilateral primer 'End adds the preceding paragraph tail primer sequence, at forward primer 5 'End adds the preceding paragraph T7 tail primer sequence, at reverse primer 5 'End adds the preceding paragraph T3 tail primer sequence; Synthesize T7 tail primer and T3 tail primer, and T7 tail primer is carried out fluorescent mark;

Step 3, standard methylation DNA that crosses with sulfiting and non-methylate DNA add the Taq archaeal dna polymerase and have 3 as pcr template '~ 5 'The 5 prime excision enzyme activity archaeal dna polymerase, with described forward and inverse PCR primer, the DNA to be measured that sulfiting is crossed carries out pcr amplification; And the non-methylate DNA of crossing with sulfiting of standard and standard methylation DNA are as contrast;

Step 4 is a template with the PCR product of step 3 gained, carries out the pcr amplification second time with said tail primer;

Step 5 is with the dna fragmentation of the foranalysis of nucleic acids appearance determination step 3 gained pcr amplification products mobility at capillary electrophoresis;

With result that step 5 is surveyed and the contrast of standard DNA sample result, if occur the mobility signal consistent with standard methylation DNA sample in the testing sample, then there is methylate DNA in step 6; Otherwise,, then show not have methylate DNA in the testing sample if do not occur the mobility signal consistent in the testing sample with standard methylation DNA sample.

In the said step 1; Used sulphite is S-WAT; Use the treatment step of said sulfiting DNA to be measured to be: with 0.3M NaOH sex change DNA to be measured, add the mixed solution by 5M S-WAT, 0.5mM quinhydrones, pH5.0,60 ℃ of lucifuge temperature were bathed 4 hours; Desulfurization and purify DNA.

In the said step 2, in the gene order that will detect, select one section sequence that contains a plurality of CpG site to carry out design of primers, with 5 of this section sequence as the target detect sequence 'One section sequence of end is as the PCR forward primer, with 3 of this section sequence 'The complementary sequence of one section sequence of end is as the PCR reverse primer, and the dna fragmentation size that makes pcr amplification is 80 ~ 180 base length, makes in the sequence of pcr amplification to contain a plurality of CpG site, is generally 8 ~ 20.Preferably, the PCR primer that is designed is 18 ~ 32 base length, and contained CpG site is no more than 3 in the sequence of primer, and in the position of the C in said CpG site, forward primer can mix replaced C with C/T, and reverse primer can mix with G/A and replace G.Last base of 3 ' end that makes the forward primer that designed is just in time in the position of the C of CpG, and making this base is T, and makes 3 of this base 'Phosphate group of carbon atom mark; Or last base of 3 ' end that makes the reverse primer that designed is just in time in the position of the C of CpG, and making this base is A, and makes 3 of this base 'Phosphate group of carbon atom mark.

Wherein, CpG is meant cytosine(Cyt) (C), guanine (G) and is connected the site that the two phosphoric acid ester bond (p) is formed.A is meant VITAMIN B4, and T is meant thymus pyrimidine.

In the said step 3, used have 3 '~ 5 'The 5 prime excision enzyme activity archaeal dna polymerase is that ancient pyrenomycetes belongs to the archaeal dna polymerase in source or the archaeal dna polymerase of same nature; Further be preferably the pfu archaeal dna polymerase.

In the said step 4, used tail primer mark can be D4.

In the said step 5, used foranalysis of nucleic acids appearance can be a CEQ8000 DNA sequenator,

Said DNA to be measured is the human genome DNA, non-methylate DNA of said standard and standard methylation DNA for be complementary in DNA to be measured, the fixed pure non-human genome DNA of methylating and the fixed pure human genome DNA that methylates.

Wherein, the said DNA sample to be measured sample that can be human normal cell DNA, cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum DNA, body fluid DNA or movement DNA.As:

Said cancer cells is lung carcinoma cell, stomach cancer cell, colon cancer cell, rectum cancer cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell;

Said tumor tissues is cancerous lung tissue, stomach organization, colon cancer tissue, rectum cancer tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or carcinoma of the pancreas tissue;

Said body fluid comprises blood, csf, gastric juice and various Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion or the like.

Methylate DNA provided by the invention is compared existing state of the art with non-methylate DNA stripping technique has advantages such as separation efficiency is high, simple to operate, quick and with low cost.Effectively separated methylate DNA and non-methylate DNA, made that safety improves in detecting methylate DNA and PCR process, methylation level is detected by sensitive.Have great significance at aspects such as tumour early detection, personalized treatment, state of an illness judgement and recurrence monitoring.

In sum, a kind of methylate DNA detection method of the present invention has that the scope of application is big, method is simple, need sample size little, be difficult for being disturbed, being suitable for advantages such as mixing sample.Have great significance at aspects such as tumour early detection, personalized treatment, state of an illness judgement and recurrence monitoring.

Description of drawings

Fig. 1 is a methylate DNA detection method schema of the present invention.

Embodiment

With reference to Fig. 1, introduce as follows methylate DNA detection method of the present invention is concrete:

Embodiment (one):

The PCR design of primers is following: in the gene order that will detect, select one section sequence that contains a plurality of CpG site to carry out design of primers, with 5 of this section sequence as the target detect sequence 'One section sequence of end is as the PCR forward primer, with 3 of this section sequence 'The complementary sequence of one section sequence of end is as the PCR reverse primer, and the dna fragmentation size that makes pcr amplification is 80 ~ 180 base length, makes in the sequence of pcr amplification to contain a plurality of CpG site, is generally 8 ~ 20.Preferably, the PCR primer that is designed is 18 ~ 32 base length, and in the sequence of primer no more than 3 of contained CpG site, in the position of the C in said CpG site, forward primer can mix replaced C with C/T, reverse primer can mix with G/A and replace G; And make 3 of the forward primer that designed 'Just in time in the position of the C of CpG, make this base is T to last base of end, and in 3 of this base 'Phosphate group of carbon atom mark.

Methylating of P16 genetic transcription promoter region is the characteristic that multiple cancer cell such as lung cancer have.The sequence of P16 genetic transcription promoter region is following, and the part that underscore is arranged is the selected zone that will detect.

Homo?sapiens?p16?protein?(CDKN2A)?gene，CpG?island?and?partial?cds，DQ325544.1

CGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGCTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCACCGAATAGTTACGGTCGGAGGCCG

Methylate DNA sequence, underscore be the zone for detecting partly;

CGGATCGCGTGCGTTCGGCG GTTGCGGAGAGGGGGAGAGTAGGTAGCGGGCGGCGGGGAGTAGTATGGAGCGGGCGGCGGGGAGTAGTATGGAGTTTTCGGTTGATTGGTTGGTTACGGTCGCGGTTCGGGTTCGGGTAGAGGAGGTGCGGGCGTTGTTGGAGGCGGGGGCGTTGTTTAACGTATCGAATAGTTACGGTCGGAGGTCG

Non-methylate DNA sequence, underscore be the zone for detecting partly;

TGGATTGTGTGTGTTTGGTG GTTGTGGAGAGGGGGAGAGTAGGTAGTGGGTGGTGGGGAGTAGTATGGAGTGGGTGGTGGGGAGTAGTATGGAGTTTTTGGTTGATTGGTTGGTTATGGTTGTGGTTTGGGTTTGGGTAGAGGAGGTGTGGGTGTTGTTGGAGGTGGGGGTGTTGTTTAATGTATTGAATAGTTATGGTTGGAGGTTG

The PCR primer that is designed

Forward primer 5 '-GTTGYGGAGAGGGGGAGAGTAGGTAGT [P]-3 '

Reverse primer 5 '-TTAAACAACRCCCCCRCCTCCAACAAC-3 '

Y=C/T mixes, and R=G/A mixes, P=phosphate group (phosphate)

At 5 of forward and reverse primer 'End adds that respectively T7 and T3 primer are as the tail primer.

The T7 promoter sequence, 5 '-[F] TAATACGACTCACTATAGGG-3 '

The T3 promoter sequence, 5 '-ATTAACCCTCACTAAAGGGA-3 '

F is a fluorescent mark, like D4.

Embodiment (two)

On embodiment (one's) basis, with institute's designed primer, detect as testing sample, to confirm specificity of the present invention and sensitivity with the non-methylate DNA and the methylate DNA of standard.

Step 1: adopt sulfiting and non-methylate DNA of the known standard of purifying and methylate DNA.The non-methylate DNA of standard with a certain amount of S-WAT was handled mixes with the standard methylation DNA that the S-WAT of gradient dilution was handled, as testing sample;

Wherein, said sulphite is specially S-WAT; The treatment step of said sulfiting DNA to be measured does, with 0.2M NaOH sex change DNA to be measured, adds the mixed solution by 5M S-WAT, 0.5mM quinhydrones, pH5.0,60 ℃ of lucifuge temperature baths 4 hours; Desulfurization and purify DNA.

Step 2: confirm the testing gene surveyed area, according to designing and synthesizing forward PCR primer and inverse PCR primer in the described method of embodiment (); At 5 of forward primer 'End adds the T7 promoter sequence of 20 base length of the preceding paragraph as T7 tail primer sequence, at 5 of reverse primer 'End adds the T3 promoter sequence of 20 base length of the preceding paragraph as T3 tail primer sequence.

Step 3:PCR amplification; The PCR operating process; By step 1 blended DNA sample to be measured as template (Template), by step 2 design and synthetic forward and inverse PCR primer (primer), pcr amplification damping fluid (Buffer), with to the archaeal dna polymerase of uridylic sensitivity, four kinds of triphosphate deoxyribose nucleotides (dNTPs), to have 3 '~ 5 'The archaeal dna polymerase of 5 prime excision enzyme activity and Taq archaeal dna polymerase proportional mixing carry out pcr amplification;

Be the archaeal dna polymerase that ancient pyrenomycetes belongs to the source wherein, be specially the pfu archaeal dna polymerase the responsive archaeal dna polymerase of uridylic.

Step 4: with the PCR product of step 3 as the PCR reaction template, with T3 tail primer with fluorescently-labeled T7 tail primer, under the condition identical, carry out the pcr amplification second time with step 3;

Wherein, the same terms is meant the PCR primer with step 3 same concentrations, pcr amplification damping fluid (Buffer), Taq archaeal dna polymerase and four kinds of triphosphate deoxyribose nucleotides, identical PCR condition and pcr amplification appearance;

Wherein, the fluorescent mark of said T7 tail primer is D4;

Step 5: measure the mobility of pcr amplification product dna fragmentation with the foranalysis of nucleic acids appearance, judge detected result at capillary electrophoresis;

Wherein, said foranalysis of nucleic acids appearance is a CEQ8000 dna sequencing appearance;

Judge whether to exist methylate DNA; Determination methods by: with in the step 5 result and the signal of standard model of survey DNA sample to be measured compare; If occur the mobility signal consistent in the testing sample, then show to have methylate DNA in the testing sample with the methylate DNA standard model; Otherwise, then do not exist.

A kind of methylate DNA detection method of the present invention is checked specificity of the present invention and sensitivity through above-mentioned steps.

At medical field, can accurately and delicately measure whether there is methylate DNA among the DNA, just can judge and the recurrence monitoring of cancer provides a kind of good index for the early detection of tumour, the state of an illness.

Embodiment (three)

On embodiment (twos') basis, be testing sample with the DNA of actual clinical sample extraction, under the condition identical, check practicality of the present invention with above-mentioned embodiment (two).

Wherein, in the identical condition of embodiment (two), the DNA that refers to divided by the actual clinical sample extraction is outside the testing sample with above-mentioned, and all operations is with above-mentioned identical at embodiment (two).

The DNA sample to be measured of said clinical extraction, the sample of and cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum DNA, various body fluid DNA or various movement DNAs normal for the mankind.

Said cancer cells can be lung carcinoma cell, stomach cancer cell, colon cancer cell, rectum cancer cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell; Said tumor tissues can be cancerous lung tissue, stomach organization, colon cancer tissue, rectum cancer tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or carcinoma of the pancreas tissue; Said various body fluid can be blood, csf, gastric juice and various Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion etc.

Foregoing is giving an example of specific embodiment of the present invention, for the wherein not reagent of detailed description, equipment, working method etc., is to be understood that to taking the existing common and conventional reagent in this area, equipment, working method to wait and implement.

More than specific embodiment of the present invention is described in detail, but it is just as example, the present invention is not restricted to the specific embodiment of above description.To those skilled in the art, any equivalent modifications that the present invention is carried out with substitute also all among category of the present invention.Therefore, not breaking away from impartial conversion and the modification of being done under the spirit and scope of the present invention, all should contain within the scope of the invention.

Claims (10)

1. the detection method of a methylate DNA of removing based on primer protection is characterized in that step is following:

Step 1 is with sulfiting and purifying DNA to be measured, the non-methylate DNA of standard and standard methylation DNA;

Step 2 is confirmed the surveyed area of testing gene, in the gene order that will detect, select one section sequence that contains a plurality of CpG site to carry out design of primers, with 5 of this section sequence as the target detect sequence 'One section sequence of end is as the PCR forward primer, with 3 of this section sequence 'The complementary sequence of one section sequence of end is as the PCR reverse primer; And the T7 sequence of 20 base length is added in 5 of forward primer 'End is as T7 tail primer sequence, and the T3 sequence of 20 base length is added in 5 of reverse primer 'End is as T3 tail primer sequence; Synthesize T7 tail primer and T3 tail primer, and T7 tail primer is carried out fluorescent mark;

Step 3, standard methylation DNA that crosses with sulfiting and non-methylate DNA add the Taq archaeal dna polymerase and have 3 as pcr template '~ 5 'The 5 prime excision enzyme activity archaeal dna polymerase, with described forward and inverse PCR primer, the DNA to be measured that sulfiting is crossed carries out pcr amplification; And the non-methylate DNA of crossing with sulfiting of standard and standard methylation DNA are as contrast;

Step 4 is a template with the PCR product of step 3 gained, carries out the pcr amplification second time with said T3 and fluorescently-labeled T7 tail primer;

Step 5 is with the dna fragmentation of the foranalysis of nucleic acids appearance determination step 4 gained pcr amplification products mobility at capillary electrophoresis;

With result that step 5 is surveyed and the contrast of standard DNA sample result, if occur the mobility signal consistent with standard methylation DNA sample in the testing sample, then there is methylate DNA in step 6; Otherwise,, then show not have methylate DNA in the testing sample if do not occur the mobility signal consistent in the testing sample with standard methylation DNA sample.

2. detection method according to claim 1 is characterized in that sulphite is specially S-WAT described in the step 1; The treatment step of said sulfiting DNA to be measured is: with 0.3M NaOH sex change DNA to be measured, add the mixed solution by 5M S-WAT, 0.5mM quinhydrones, pH5.0,60 ℃ of lucifuge temperature were bathed 4 hours; Desulfurization and purify DNA.

3. detection method according to claim 1; It is characterized in that in the said step 2, the PCR primer that is designed is 18 ~ 32 base length; And the dna fragmentation size that makes pcr amplification is 80 ~ 180 base length, and makes in the sequence of pcr amplification and contain a plurality of CpG site.

4. detection method according to claim 3 is characterized in that, contained CpG site is no more than 3 in the sequence of primer; And position at the C in said CpG site; Forward primer can mix replaced C with C/T, and reverse primer can mix replace G with G/A, and last base of 3 ' end that makes the forward primer that is designed is just in time in the position of the C of CpG; Making this base is T, and makes 3 of this base 'Phosphate group of carbon atom mark; Or last base of 3 ' end that makes the reverse primer that designed is just in time in the position of the C of CpG, and making this base is A, and makes 3 of this base 'Phosphate group of carbon atom mark.

5. detection method according to claim 1 is characterized in that, in the said step 3, used have 3 '~ 5 'The 5 prime excision enzyme activity archaeal dna polymerase is the mixing of the archaeal dna polymerase of the ancient pyrenomycetes archaeal dna polymerase or the same nature that belong to the source.

6. detection method according to claim 5 is characterized in that, said have 3 '~ 5 'The 5 prime excision enzyme activity archaeal dna polymerase is the pfu archaeal dna polymerase, and described foranalysis of nucleic acids appearance is a CEQ8000 DNA sequenator, and the fluorescent mark of used T7 tail primer is D4.

7. detection method according to claim 1 is characterized in that, said T7 and T3 sequence length are 20 bases.

8. detection method according to claim 1; It is characterized in that; Said DNA to be measured is the human genome DNA, non-methylate DNA of said standard and standard methylation DNA for be complementary in DNA to be measured, the fixed pure non-human genome DNA of methylating and the fixed pure human genome DNA that methylates.

9. detection method according to claim 8 is characterized in that, said DNA sample to be measured is the sample of human normal cell DNA, cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum DNA, body fluid DNA or movement DNA.

10. detection method according to claim 9 is characterized in that,

Said cancer cells is lung carcinoma cell, stomach cancer cell, colon cancer cell, rectum cancer cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell;

Said tumor tissues is cancerous lung tissue, stomach organization, colon cancer tissue, rectum cancer tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or carcinoma of the pancreas tissue;

Said body fluid comprises blood, csf, gastric juice and various Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion.

Images