CN102399863A - Methylated DNA detection method based on fragment length analysis - Google Patents

Abstract

The present invention relates to a methylated DNA detection method. The method comprises the following steps: 1, adopting a sulfite to treat DNA requiring detection; 2, selecting a section of contiguous sequence in the target region requiring detection, and synthesizing forward primer with a tail primer sequence and reverse primer with a tail primer sequence; 3, carrying out PCR amplification for the DNA sample requiring detection by the specific DNA polymerase; 4, carrying out the secondary PCR amplification by the tail primer with the fluorescence labeling; 5, carrying out determination and analysis for the fragment length of the PCR product, and determining whether the methylated DNA exists in the sample. The methylated DNA detection method of the present invention has advantages of wide application scope, simple method, small required sample size, invulnerability to interference, application of mixing samples, and the like, and provides important significances for early detections of a plurality of tumor diseases, personalization treatments, condition judgments, recurrence monitoring and other aspects.

Description

A kind of methylate DNA detection method of analyzing based on fragment length

Technical field

The present invention relates to a kind of methylate DNA detection method, relate in particular to and a kind ofly the responsive specific archaeal dna polymerase of uridylic is carried out PCR react the method that detects methylate DNA through using.

Background technology

Dna methylation be meant CpG site on the DNA chain cytosine(Cyt) (C) residue 5 'Modified a methyl on the carbon.Dna methylation is one of dna modification of finding the earliest, is the important component part of epigenetics.Occur on the cytosine(Cyt) residue of the CpG dinucletide on the DNA chain to the dna methylation characteristic, this is common in gene 5 'The end expression regulation sequence.Dna methylation has vital role in the regulation and control of genetic expression, participated in processes such as animal embryo growth, the gene marking and x chromosome inactivation.Research shows that the change of dna methylation can cause the change of chromatin Structure, DNA conformation, dna stability and protein interaction mode, thereby controlling gene is expressed.

The change of dna methylation state is an important factor that causes tumour.The unusual rising of the local methylation level in CpG island can cause not expressing of genomic instability and cancer suppressor gene.If activated allelic inactivation in the cancer suppressor gene, the probability that cancer then takes place will improve.So the noticeable place of dna methylation is exactly the application in the early detection of tumour, because showing the variation of epigenetic, research follows the generation and the development of tumour, the change that detects dna methylation can help the early discovery of tumour.

The methylated research of tumour at present mainly concentrates on cancer suppressor gene.This is the generation of tumour possibly methylate with the CpG island of cancer suppressor gene promoter region to cause cancer suppressor gene to close relevant because it is found that.Because the local height on CpG island methylates early than the neoplasm of cell, so the detection of dna methylation can be used for tumorigenic early prediction.

The methylated detection method in CpG island is numerous, and its principle is respectively based on methylating responsive digestion with restriction enzyme method and based on the PCR detection method of S-WAT modifying DNA.The susceptibility that methylates restriction enzyme/Southern method (methylation-sensitive restriction Endonuclease/Southern, MSRE-Southern) is more traditional method, and sensitivity is low, and the sample requirement is big.(Methylation Specific PCR MSP) and deutero-methylate DNA detection method, is the domestic method that detects dna methylation at present to methylate DNA specific PCR method, has the highly sensitive while, and false positive rate is also very high.

Summary of the invention

The present invention provides a kind of methylate DNA detection method.Can get rid of the influence of non-methylate DNA effectively, make the methylate DNA in the sample be able to enrichment, the prior art detection sensitivity is low, method is complicated in order to solve, easily by shortcomings such as interference.

Methylation detecting method of the present invention, step is following:

Step 1 adopts sulfiting DNA to be measured and non-methylate DNA of standard and standard methylation DNA;

Step 2 in the target area that will detect, is selected one section successive sequence, with this section continuous sequence or with this section continuous 5 'The end a part as forward primer, with selected sequence 3 'The complementary sequence of one section sequence in end downstream is as reverse primer; At 5 of forward primer 'End adds the T7 promoter sequence of 20 base length of the preceding paragraph as T7 tail primer, at 5 of reverse primer 'End adds the T3 promoter sequence of 20 base length of the preceding paragraph as T3 tail primer; Synthesize T3 tail primer and T7 tail primer, and T7 tail primer is carried out fluorescent mark;

Step 3, the DNA to be measured that crosses with sulfiting uses the archaeal dna polymerase responsive to uridylic as template, designs also synthetic PCR primer with step 2, and DNA sample to be measured is carried out pcr amplification; And with the non-methylate DNA of known standard and methylate DNA as contrast, obtain the PCR product;

Step 4 is a template with the PCR product of step 3 gained, uses the Taq archaeal dna polymerase, carries out the pcr amplification second time with T3 tail primer and fluorescently-labeled T7 tail primer;

Step 5, use dna sequence analysis appearance carries out the fragment length determination and analysis of PCR product, and contrasts with the standard DNA sample result; If it is consistent with the standard DNA sample to detect the dna fragmentation of pcr amplification product, then there is methylate DNA; If do not detect the specific DNA fragments consistent, then show not have methylate DNA in the sample with the pcr amplification product of standard methylation DNA.

In the said step 1, said sulphite is specially S-WAT; The method of said sulfiting DNA to be measured does, with the NaOH sex change DNA to be measured of 0.3M, adds the pH value that contains 5M S-WAT, 0.5mM quinhydrones and be 5.0 mixed solution, 60 ℃ of lucifuge temperature baths 4 hours; Desulfurization and purify DNA.

In the said step 2, selected continuous sequence is greater than 8 bases and include at least one and be in the middle part of selected continuous sequence or near 3 'The CpG site of the position of end, but the C except that the CpG site does not appear.

Wherein, the CpG phosphoric acid ester bond (p) that refers to cytosine(Cyt) (C), guanine (G) and be connected the two is formed the site; T refers to thymus pyrimidine, and A refers to VITAMIN B4.

In the said step 3, the responsive archaeal dna polymerase of uridylic is preferably in the archaeal dna polymerase in heat-resisting ancient pyrenomycetes source one or more, further is preferably the pfu archaeal dna polymerase.

In the above-mentioned detection method, used dna sequence analysis appearance is preferably CEQ8000 dna sequencing appearance; The used dyestuff of T7 tail primer fluorescent mark is preferably D4.

In the above-mentioned detection method, said template DNA is preferably the human genome DNA who from various samples, is extracted according to DNA requirement to be measured; Said DNA to be measured is the human genome DNA, non-methylate DNA of said standard and standard methylation DNA for be complementary in DNA to be measured, the fixed pure non-human genome DNA of methylating and the fixed pure human genome DNA that methylates.

In the above-mentioned detection method, said DNA sample to be measured can be human normal DNA, the sample of cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum DNA, body fluid DNA or movement DNA.As:

Said cancer cells is lung carcinoma cell, stomach cancer cell, colon cancer cell, rectum cancer cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell;

Said tumor tissues is cancerous lung tissue, stomach organization, colon cancer tissue, rectum cancer tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or carcinoma of the pancreas tissue;

Said body fluid is blood, csf, gastric juice, Digestive system, seminal fluid, saliva, tear, sweat, urine or vaginal secretion.

The cytosine(Cyt) (C) that is changed into uridylic (U) GC site when methylating owing to non-methylated cytosine(Cyt) (C) among the DNA to be measured that crosses with sulfiting remains unchanged because of methylating.Because the archaeal dna polymerase in ancient pyrenomycetes source can not be discerned or only can postpone to discern uridylic (U); Thereby make with such polysaccharase; When the DNA that crosses with sulfiting carries out the PCR reaction as template, because of at selected surveyed area, because of there is not the C except that the CG site in the direction of reverse primer extension; Make with the methylate DNA to be that the chain of template can normally extend; Non-methylate DNA is that the chain of template then can not extend, thereby makes this technology can detect the methylate DNA that exists in the sample, or even low-abundance methylate DNA.

In sum, methylate DNA detection method provided by the invention detects the existence of methylate DNA in the DNA sample to be measured, have that the scope of application is big, method is simple, highly sensitive, need sample size little, be difficult for being disturbed, being suitable for advantages such as mixing sample.Have great significance at aspects such as tumour early detection, personalized treatment, state of an illness judgement and recurrence monitoring.

Description of drawings

Fig. 1 is a methylate DNA detection method schema of the present invention.

Embodiment

With reference to Fig. 1, introduce as follows methylate DNA detection method of the present invention is concrete:

Embodiment (one):

Step 1: adopt sulfiting DNA to be measured and non-methylate DNA of known standard and methylate DNA.The non-methylate DNA of standard with a certain amount of S-WAT was handled mixes with the standard methylation DNA that the S-WAT of gradient dilution was handled, as testing sample.

Wherein, said sulphite is specially S-WAT; The DNA to be measured of sulfiting can be specially the human genome gene.The treatment step of said sulfiting DNA to be measured does, with 0.2M NaOH sex change DNA to be measured, adds the pH value that contains 5M S-WAT, 0.5mM quinhydrones and be 5.0 mixed solution, 60 ℃ of lucifuge temperature baths 4 hours; Desulfurization and purify DNA.

Step 2, the non-methylate DNA of crossing according to testing gene sequences Design and the synthetic sulfiting that can increase simultaneously and the forward PCR primer and the inverse PCR primer of methylate DNA; And the T7 sequence of 20 base length is added in 5 of forward primer 'End is added in 5 of reverse primer with the T3 sequence of 20 base length 'End respectively as T7 and T3 tail primer sequence, and makes said T7 tail primer have fluorescent mark.

Preferably, in the said step 2, selected continuous sequence is greater than 8 bases; And include at least one in this continuous sequence and be in the middle part of selected continuous sequence or near 3 'The CpG site of the position of end, and the C except that the CpG site does not appear.

Wherein, the used dyestuff of fluorescent mark is D4.

Step 3, with step 1 blended DNA sample to be measured as template (Template), add with the archaeal dna polymerase responsive uridylic, design also with step 2 that synthetic forward and inverse PCR primer carry out pcr amplification, obtain the PCR product

Wherein, Described pcr amplification reaction system; By the dna profiling (Template) that forward and inverse PCR primer, pcr amplification damping fluid (Buffer), Taq archaeal dna polymerase, four kinds of triphosphate deoxyribose nucleotides (dNTPs), said S-WAT were handled, pure water is formed.

Wherein, the used specific archaeal dna polymerase that uridylic is had susceptibility of pcr amplification reaction is one or more in the archaeal dna polymerase in heat-resisting ancient pyrenomycetes source.Like the fpu archaeal dna polymerase.

Step 4 is a template with the PCR product of step 3 gained, under the condition identical with step 3, adds archaeal dna polymerase, carries out the pcr amplification second time with T3 tail primer with fluorescently-labeled T7 tail primer.

Wherein, the same terms is meant the PCR primer with step 3 same concentrations, pcr amplification damping fluid (Buffer), Taq archaeal dna polymerase and four kinds of triphosphate deoxyribose nucleotides, identical PCR condition and pcr amplification appearance.

The fluorescent mark of said T7 tail primer can be D4.

Step 5 uses the dna sequence analysis appearance to carry out the fragment length determination and analysis of PCR product, judges detected result.

Wherein, used dna sequence analysis appearance can be a CEQ8000 dna sequencing appearance.

Step 6 judges whether to exist methylate DNA.

The method that judges whether to exist methylate DNA by: with in the step 5 result and the signal of standard model of survey DNA sample to be measured compare, if it is consistent with the standard DNA sample to detect the dna fragmentation of pcr amplification product, then have methylate DNA; If do not detect the specific DNA fragments consistent, then show not have methylate DNA in the sample with the pcr amplification product of standard methylation DNA.

A kind of methylate DNA detection method of the present invention is checked specificity of the present invention and sensitivity through above-mentioned steps.

At medical field, can accurately and delicately measure whether there is methylate DNA among the DNA, just can judge and the recurrence monitoring of cancer provides a kind of good index for the early detection of tumour, the state of an illness.

Embodiment (two)

On embodiment (one's) basis, be testing sample with the DNA of actual clinical sample extraction, under the condition identical, check practicality of the present invention with above-mentioned embodiment ().

Wherein, in the identical condition of embodiment (), the DNA that refers to divided by the actual clinical sample extraction is outside the testing sample with above-mentioned, and all operations is with above-mentioned identical at embodiment ().

The DNA sample to be measured of said clinical extraction, the sample of and cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum DNA, various body fluid DNA or various movement DNAs normal for the mankind.

Said cancer cells can be lung carcinoma cell, stomach cancer cell, colon cancer cell, rectum cancer cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell; Said tumor tissues can be cancerous lung tissue, stomach organization, colon cancer tissue, rectum cancer tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or carcinoma of the pancreas tissue; Said various body fluid can be blood, csf, gastric juice and various Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion etc.

Embodiment (three)

On embodiment () and (twos') basis, be example with the sequence of P16 genetic transcription promoter region, concrete PCR design of primers is following:

Methylating of P16 genetic transcription promoter region is the characteristic that multiple cancer cell such as lung cancer have.The sequence of P16 genetic transcription promoter region is following, and the part that underscore is arranged is the selected zone that will detect.

Homo?sapiens?p16?protein（CDKN2A）gene，CpG?island?and?partial?cds，DQ325544.1

CGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGCTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCACCGAATAGTTACGGTCGGAGGCCG

Methylate DNA sequence, underscore partly are selected surveyed area, runic UFor non-methylated " C " handles the uridylic that changes into through S-WAT

UGGA UUGCGTGCGCT UGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGC UTT UGGCTGA UTGGCTGGC UA UGGC UGCGGC UUGGGCT UGGGTAGAGGAGGTGCGG GCGCTGCTGGAGGCGGGGGCGCTGC UUAA UGCA UUGAATAGTTA UGGT UGG AGGC UG

Non-methylate DNA sequence, underscore partly are selected surveyed area, runic UFor non-methylated " C " handles the uridylic that changes into through S-WAT

UGGA UUG UGTG UG UT UGG UGG UTG UGGAGAGGGGGAGAG UAGG UAG UGGG UGG UGGGGAG UAG UATGGAG UGGG UGG UGGGGAG UAG UATGGAG UUTT UGG UTGA UTGG UTGG UUA UGG UUG UGG UUUGGG UT UGGGTAGAGGAGGTG UGG G UG UTG UTGGAGG UGGGGG UG UTG UUUAA UG UA UUGAATAGTTA UGGT UGG AGG UUG

The forward primer 5 of design '- GCGCTGCTGGAGGCGGGGGCGCTGC-3 '

The reverse primer (R=G/A) 5 of design '- CCAACCATAACTATTCAATRCATTAA-3 '

The T7 promoter sequence that adds 20 base length of the preceding paragraph at 5 ' end of forward primer is as T7 tail primer sequence, and the T3 promoter sequence that adds 20 base length of the preceding paragraph at 5 ' end of reverse primer is as T3 tail primer sequence.Wherein:

The T7 promoter sequence is 5 '-TAATACGACTCACTATAGGG-3 '

The T3 promoter sequence is 5 '-ATTAACCCTCACTAAAGGGA-3 '

Then, according to the described method of embodiment (), detect.

Foregoing is giving an example of specific embodiment of the present invention, for the wherein not reagent of detailed description, equipment, working method etc., is to be understood that to taking the existing common and conventional reagent in this area, equipment, working method to wait and implement.

More than specific embodiment of the present invention is described in detail, but it is just as example, the present invention is not restricted to the specific embodiment of above description.To those skilled in the art, any equivalent modifications that the present invention is carried out with substitute also all among category of the present invention.Therefore, not breaking away from impartial conversion and the modification of being done under the spirit and scope of the present invention, all should contain within the scope of the invention.

Claims (9)

1. methylate DNA detection method of analyzing based on fragment length is characterized in that step is following:

Step 1 is with sulfiting DNA to be measured, standard methylation DNA and the non-methylate DNA of standard;

Step 2 in the target area that will detect, is selected one section successive sequence, with selected sequence or with institute's selections sequence 5 'The end a part as forward primer, with selected sequence 3 'The complementary sequence of one section sequence in end downstream is as reverse primer; At 5 of forward primer 'End adds the T7 promoter sequence of 20 base length of the preceding paragraph as T7 tail primer sequence, at 5 of reverse primer 'End adds the T3 promoter sequence of 20 base length of the preceding paragraph as T3 tail primer sequence; Synthesize T7 tail primer and T3 tail primer, and T7 tail primer is carried out fluorescent mark;

Step 3 adds the archaeal dna polymerase responsive to uridylic, designs and synthetic PCR primer with step 2, and the DNA sample to be measured that sulfiting is crossed carries out pcr amplification; And carry out pcr amplification respectively as contrast with the non-methylate DNA of known standard and methylate DNA, obtain the PCR product;

Step 4 is a template with the PCR product of step 3 gained, adds the Taq archaeal dna polymerase, carries out the pcr amplification second time with T3 tail primer and fluorescently-labeled T7 tail primer;

Step 5, use dna sequence analysis appearance carries out the fragment length determination and analysis of PCR product, and contrasts with the standard DNA sample result; If it is consistent with the standard DNA sample to detect the dna fragmentation of pcr amplification product, then there is methylate DNA; If do not detect the specific DNA fragments consistent, then show not have methylate DNA in the sample with the pcr amplification product of standard methylation DNA.

2. detection method according to claim 1 is characterized in that, in the said step 2, selected continuous sequence is greater than 8 bases and include at least one and be in the middle part of selected continuous sequence or near 3 'The CpG site of the position of end, but the C except that the CpG site does not appear.

3. detection method according to claim 1 is characterized in that, in the said step 3, said is in the archaeal dna polymerase in heat-resisting ancient pyrenomycetes source one or more to the responsive archaeal dna polymerase of uridylic.

4. detection method according to claim 3 is characterized in that, said is the pfu archaeal dna polymerase to the responsive archaeal dna polymerase of uridylic.

5. detection method according to claim 1 is characterized in that sulphite is specially S-WAT described in rapid 1,

The treatment step of said sulfiting DNA to be measured does, with 0.3M NaOH sex change DNA to be measured, adds the mixed solution by 5M S-WAT, 0.5mM quinhydrones, pH5.0,60 ℃ of lucifuge temperature baths 4 hours; Desulfurization and purify DNA.

6. detection method according to claim 1 is characterized in that, used dna sequence analysis appearance is a CEQ8000 dna sequencing appearance; The used dyestuff of T7 tail primer fluorescent mark is D4.

7. detection method according to claim 1; It is characterized in that; Said DNA to be measured is the human genome DNA, non-methylate DNA of said standard and standard methylation DNA for be complementary in DNA to be measured, the fixed pure non-human genome DNA of methylating and the fixed pure human genome DNA that methylates.

8. detection method according to claim 7 is characterized in that, said DNA sample to be measured is the sample of human normal cell DNA, cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum DNA, body fluid DNA or movement DNA.

9. detection method according to claim 8 is characterized in that,

Said cancer cells is lung carcinoma cell, stomach cancer cell, colon cancer cell, rectum cancer cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell;

Said tumor tissues is cancerous lung tissue, stomach organization, colon cancer tissue, rectum cancer tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or carcinoma of the pancreas tissue;

Said body fluid comprises blood, csf, gastric juice and various Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion.

Images