CN102373277B - PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery - Google Patents
PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery Download PDFInfo
- Publication number
- CN102373277B CN102373277B CN 201110330683 CN201110330683A CN102373277B CN 102373277 B CN102373277 B CN 102373277B CN 201110330683 CN201110330683 CN 201110330683 CN 201110330683 A CN201110330683 A CN 201110330683A CN 102373277 B CN102373277 B CN 102373277B
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- swine dysentery
- dna
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery. A group of primers for detecting the swine dysentery have the nucleotide sequences disclosed in a sequence table SEQIDNo: 1 and a sequence table SEQIDNo: 2. The invention has the advantages that compared with etiology separation culture, the PCR technology applied in the detection of the swine dysentery is faster and more convenient, the bacterium separation culture method at least needs 10 days and hard culture conditions, strict anaerobic culture is needed, and the PCR can be completed only in 5 hours; and compared with etiology separation, the PCR needs relatively simple equipment, is more convenient to master and operate from a technical perspective, is more convenient to apply and popularize in areas with insufficient conditions and is more conductive to the diagnosis and monitoring of the swine dysentery.
Description
Technical field
The present invention relates to a kind of PCR test kit and primer that detects swine dysentery, belong to inspection and quarantine field.
Background technology
Swine dysentery (Swine dysentery
SD) pathogenic agent be a kind of gram-negative anaerobism spirochete, successively called after be by Treponema Hyodysenteriae (
Treponema hyodysenteriae; T.h), the swine dysentery Serpulina (
Serpulinahyodysenteriae;S.h).Now unified called after swine dysentery Brachyspira (
Brachyspira hyodysenteriaeB.h), present this title of Treponema Hyodysenteriae is owing to the reason of history also is widely used.This disease is a kind of infectious intestinal disease of pig, take mucus or mucus hemorrhagic diarrhea as feature.Sickness rate in swinery is quite high, and sick pig growth and development is obstructed, and feed consumption increases, and causes very large financial loss for the various places pig industry.The feed intake rate of sick pig is 2 times of normal pig according to statistics, and rate of body weight gain only is 1/2 of normal pig.According to the statistics of nineteen eighty-three Lyson, be the medicine that the control swine dysentery is added, every pig cost 2.5-2.8 dollar in feed.According to the calculating of (1988) such as Wood, the feed intake of swine dysentery swinery, every listing pig will be spent more 12.6 dollars, and every pig also will be spent more 2.4 dollars of expenses simultaneously.Estimate annual owing to swine dysentery is lost 6,400 ten thousand dollars in the U.S..
This disease spreads all over more than 50 countries and regions, five continents.In a single day in China, there is the existence of this disease in many provinces, city, and import swinery into, if do not take strict treatment measures to be difficult to eradicate.
In October, 1978, service industries of Shanghai port is after making a definite diagnosis swine dysentery from the quarantine of 451 market pigs of imported from America, in China's pig, make a definite diagnosis swine dysentery again at the beginning of 1979, and separate from domestic pig and to obtain the pure culture of swine dysentery Brachyspira, cause China animal doctor's circle attention, and be put into " People's Republic of China (PRC) enter the territory one, two class transmissible diseases ".
In the bilateral agreements of importing and exporting the U.S., Britain, Australia, New Zealand, Holland, Denmark, Ireland, and the import pig of the states such as Japan require to carry out the detection of swine dysentery Brachyspira.Existing testing conditions requires high (strict anaerobism is cultivated), and common laboratory is difficult to satisfy the requirement that detects.
Up to the present, this disease does not also have the detection method of satisfied simple possible.In detecting, immigration adopts industry standard SN/T 1207-2003 " swine dysentery Brachyspira separation and Culture working specification ", round of visits is wanted two time-of-weeks, and strict anaerobism is cultivated monitoring, therefore be badly in need of a kind of fast, the detection method of responsive, high specificity to be to substitute or to replenish these rules.
Polymerase chain reaction (English full name: Polymerase Chain Reaction), be called for short PCR, PCR is a kind of method of the synthetic specific DNA fragment of external enzymatic, by a few step reaction composition one-period such as high-temperature denatured, low-temperature annealing (renaturation) and thermophilic extensions, loop, make target DNA be able to rapid amplification, have high specificity, highly sensitive, easy and simple to handle, the characteristics such as save time.It not only can be used for the fundamental researchs such as gene isolation, clone and nucleic acid sequence analysis, also can be used for diagnosis or any DNA of having of disease, the place of RNA.Polymerase chain reaction (Polymerase Chain Reaction is called for short PCR) claims again cell-free molecular cloning or the directed enzymatic amplification technique of the external primer of specific DNA sequences.
Round pcr has following advantage:
1. high specificity
The specificity determinative of PCR reaction is:
1. the special correct combination of primer and template DNA;
2. basepairing rule;
3. the fidelity of Taq archaeal dna polymerase building-up reactions;
4. the specificity of target gene and conservative property.
Wherein the correct combination of primer and template is crucial.Basepairing rule is followed in the combination of primer and template and the extension of primer strand.The fidelity of polysaccharase building-up reactions and Taq archaeal dna polymerase high thermal resistance, the combination (renaturation) of template and primer can be carried out under higher temperature, in conjunction with specificity greatly increase, the target fragment that is amplified also just can keep very high correctness.By selecting specificity and the high target gene district of conservative property, its degrees of specificity is just higher again.
2. highly sensitive
The growing amount of PCR product increases with exponential manner, can be with pik (pg=10
-12) template amplification initial to be measured of magnitude is to microgram (μ g=10
-6) level.Can from 1,000,000 cells, detect a target cell; In Detecting, the sensitivity of PCR can reach 3 RFU (plaque forming unit); Minimum recall rate is 3 bacteriums in bacteriology.
3. easy, quick
PCR reaction is with resistant to elevated temperatures Taq archaeal dna polymerase, once reaction solution is added get well after, namely carry out sex change-annealing-extension at DNA cloning liquid and water-bath, generally finished amplified reaction at 2~4 hours.Amplified production is generally used electrophoretic analysis, not necessarily will use isotropic substance, no radioactivity pollute, easily popularization.
Do not need isolated viral or bacterium and culturing cell to the purity requirement of sample is low, DNA raw product and RNA all can be used as amplification template.Can be directly with clinical samples such as blood, coelomic fluid, wash the DNA cloning such as the liquid of coughing, hair, cell, living tissue and detect.
The present invention is applied to round pcr first swine dysentery in China and detects, and provides for swine dysentery weak point/treponema specific primer sequence, test kit and detection method.Compare with traditional pathogen separation method and to have quick, efficient, simple and direct characteristics.
Summary of the invention
First technical problem that the present invention will solve provides one group of that use as primer, as to detect swine dysentery oligonucleotide sequence.
Second technical problem that the present invention will solve provide a kind of special, sensitive, detect the test kit of swine dysentery efficiently.
For solving first technical problem, the present invention by the following technical solutions:
One group of primer that detects swine dysentery, the oligonucleotide sequence for shown in sequence table SEQ ID No:1 and the SEQ ID No:2 sees table 1 for details.
Table 1. primer sequence
Title | Sequence (5 '-3 ') | The sequence table numbering |
Primer I | ATGATGAAATCCCATCTGTAATA | SEQ ID No:1 |
Primer I I | TATGATAGGCATAGAATATAAAAGT | SEQ ID No:2 |
Annotate: cytosine(Cyt) (C), guanine (G), VITAMIN B4 (A), thymus pyrimidine (T).
Wherein aligning primer I and primer I I are respectively sense primer and the antisense primer that detects swine dysentery.
For solving second technical problem, the present invention by the following technical solutions:
A kind of PCR test kit that detects swine dysentery is stored in-20 ℃, is comprised of following reagent:
(1) DNA extraction liquid I:5mL/ pipe * 5 pipes; Its compound method is PEG 8000 20.74g, adds NaCl 17.53 g, is settled to 100mL with tri-distilled water, packing 5.0mL/ pipe;
(2) DNA extraction liquid II:500 μ L/pipe * 1 pipe; Its compound method is 1.0 mol/L Tris-Cl 2.0mL, 2.0 mol/L KCl 5.0mL, and 0.5 mol/L EDTA 0.5mL, NP-40 1.0 mL are settled to 100mL with tri-distilled water, packing 500 μ L/ pipe;
(3) PCR reaction solution, 750 μ L * 2 pipes comprise: 1 * PCR damping fluid, 3.0mM MgCl
2, 0.2mM dNTP, 0.4 μ M primer I, 0.4 μ M primer I I; Wherein, the nucleotide sequence of primer I is shown in sequence table SEQ ID NO:1, and the nucleotide sequence of primer I I is shown in sequence table SEQ ID NO:2;
(4) Taq archaeal dna polymerase 5 U/ μ L, 15 μ L * 1 pipe;
(5) without the sterilization purified water of DNA enzyme, manage 1mL * 1;
(6) negative control: 1mL * 1 pipe: DEPC water;
(7) positive control: 1mL * 1 pipe; Be swine dysentery weak point/treponema tlyA gene fragment, the nucleotide sequence of described tlyA gene fragment is shown in sequence table SEQ ID NO:3.
The present invention also provides a kind of method of detection swine dysentery, comprises the steps:
1) extracts sample DNA;
2) sample DNA that extracts is carried out pcr amplification:
Primer sequence is 1) 5 '-ATGATGAAATCCCATCTGTAATA-3 '
2)5’-TATGATAGGCATAGAATATAAAAGT-3’
92 ℃ of the first steps: 3 min, 1 circulation;
92 ℃ of second steps: 10 sec, 46 ℃: 30 sec, 72 ℃: 1min, 30 circulations;
72 ℃ of the 3rd steps: 7min;
4 ℃ of the 4th steps: preserve.
3) agarose gel electrophoresis
Take by weighing 1.5 g agaroses in 100 mL, 1 * TAE electrophoretic buffer, fully heating is dissolved, and adds 3 μ L GoldView I type nucleic acid staining agent (perhaps like product), a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices glue.In electrophoresis chamber, add electrophoretic buffer, make liquid level just not have gel.5 μ L pcr amplification products are mixed with an amount of sample loading buffer respectively, point sample, and put 5 μ L Marker DL2000 in contrast.The 9V/cm constant voltage, electrophoresis 20 min~30 min.Observe electrophoresis result and record under the Ultraviolet Detector.
4) result describes and judges
1. quality control standard:
Positive control has the specific amplification band at the 470bp place.
Negative control is without the specific amplification band.
Be discontented with the upper condition that is enough to such as negative control and positive condition, it is invalid that this time test is considered as.
2. the result judges:
Positive: as at the 470bp place specific amplification band to be arranged, have swine dysentery weak point/treponema in the expression sample.To the pcr amplification product order-checking, carry out validation test in case of necessity.
Negative: as without the specific amplification band, to show in the sample without swine dysentery weak point/treponema.
The contriver detects template with PCR among the present invention, has verified the specificity of the method.The result of the comparative experiments of PCR and traditional isolated culture shows that also two kinds of methods are detecting not notable difference.
The present invention has carried out sensitivity experiments with by the template detection to dilution.Experimental result shows, minimumly can detect 10
3The dna profiling amount of copy/reaction has higher sensitivity.
With the method 318 parts of pig manure swabs that 7 pig farms gather are detected.Experimental result shows that the method is a kind of special, sensitive, efficient detection method.This technology all has great application prospect in the monitoring of clinical plague and diagnosis, the inspection and quarantine requirement of area or laboratory especially can not satisfy to(for) plant of basic unit or culture condition.
Advantage of the present invention is: round pcr is applied in the detection of swine dysentery, compare with Isolation and culture of agent, 1, PCR is faster, more convenient, the bacterium isolation cultivation method needed at least 10 days and culture condition harsh, need strict anaerobism to cultivate, and PCR only need just can finish in about 5 hours; 2, it is relative simple to compare the equipment that PCR needs with pathogen separation, is more convenient for grasping and operation from technological layer, is more convenient for applying in the area of condition deficiency, more is conducive to diagnosis and monitoring to swine dysentery.By the optimization of reaction conditions, this PCR is minimum to be detected to 10
3The amount of bacteria of copy/reaction.The method also detects 318 parts of pig manure swabs that 7 pig farms gather.Experimental result shows that the method is a kind of special, sensitive, efficient detection method.This technology all has great application prospect in the monitoring of clinical plague and diagnosis, the inspection and quarantine requirement of area or laboratory especially can not satisfy to(for) plant of basic unit or culture condition.
The invention will be further described below in conjunction with specification drawings and specific embodiments, all any this areas of doing according to the disclosure of invention be equal to replacement, all belong to protection scope of the present invention.
Description of drawings
After Fig. 1 is the PCR reaction system optimization, the specificity electrophoretic band that obtains; Wherein, M:Marker DL2000; 1: positive; 2: negative sample;
Fig. 2 is the specific test result of the PCR detection kit of detection swine dysentery; Wherein, M:Marker DL2000; 1: positive control; 2-8:B.h(ATCC numbering is followed successively by 27164,31212,31287,49526,49527,49886,49887); 9:B.i (ATCC numbering: 29796); 10: Salmonellas; 11: intestinal bacteria; 12: swine streptococcus (deactivation);
Fig. 3 is the susceptibility detected result of the PCR detection kit of detection swine dysentery; Wherein, M:Marker DL2000; 1-8:10
8-1.0 copy/microlitres (making successively 10 times of gradient dilutions); 9: negative control.
Embodiment
The used Brachyspira hyodysenteriae(B.h of the present invention), Brachyspira innocens(B.i), intestinal bacteria and Salmonellas, be Inspection and Quarantine Technology Center, Beijing Entry-Exit Inspection and Q and preserve, the swine streptococcus of deactivation is provided by China Veterinery Drug Inspection Office.
Embodiment 1: the design of primer is with synthetic
Swine dysentery weak point/treponemal genes involved sequence according to logining among the Genbank compares with DNAMAN software, selects respectively the zone of tlyA gene high conservative, uses Oligo6.0 software, designs the primer for Treponema Hyodysenteriae.With table 1.
Primer is synthetic by Shanghai rising sun hat Bioisystech Co., Ltd.
Embodiment 2: the extraction of swine dysentery weak point/treponema DNA
Extract swine dysentery weak point/treponema DNA with DNA extraction reagent.
Concrete operations are as follows:
1. get n 1.5 mL sterilization centrifuge tube, wherein n is sample number to be checked, a pipe positive control and a pipe negative control sum, and each pipe is numbered mark.
2. every pipe adds 200 μ L DNA extraction liquid I, then adds respectively each 200 μ L of sample to be tested, negative control and positive control, and a sample is used a suction nozzle instead; Concussion mixing 5s on the vortex mixer.Under 4 ℃ ~ 25 ℃ conditions, centrifugal 10 min of 13000 r/min.
3. inhale as far as possible and abandon supernatant and do not bump precipitation, add again 10 μ L DNA extraction liquid II, concussion mixing 5 s on the vortex mixer.Under 4 ℃ ~ 25 ℃ conditions, centrifugal 10 s of 2000 r/min.
4. do bath or boiling water bath 10min for 100 ℃; The centrifugal 5s of 5000 r/min fully vibrates, and 5000 r/min recentrifuge 5s add 90 μ L without the sterilization purified water of DNA enzyme, after fully vibrating, and centrifugal 5 min of 5000 r/min, supernatant is the DNA of extraction, saves backup on ice.
5. the DNA that extracts must carry out pcr amplification or be positioned over-80 ℃ of refrigerators in 2 h.
The foundation of embodiment 3:PCR system
One, probe and primer concentration, magnesium ion concentration and enzyme concn are optimized respectively, have set up the reaction system of PCR.
Obtain swine dysentery weak point/treponema DNA according to embodiment 2 methods, template concentrations is about 10
4-10
6Copy/microlitre carries out PCR, optimizing reaction system.
(1) optimization of primer concentration
Probe and primer are optimized respectively.The primer concentration that increases progressively with 0.1 μ M spacing from 0.1 μ M to 0.8 μ M and intersect proportioning from the concentration and probe concentration that 0.1 μ M to 0.5 μ M increases progressively with 0.1 μ M spacing carries out PCR in real time, to select the suitableeest primer and concentration and probe concentration.The reaction system part sees Table 2, and the primer and probe sequence see Table 1:
Table 2 primer probe optimization PCR reaction system
Component | Add-on/ |
10×PCR buffer | 2.5μl |
2.5 mM dNTP | 2μl |
25 mM MgCl 2 | 3.0mM |
Primer I (10 μ M) | xμM |
Primer I I (10 μ M) | yμM |
Template DNA | 5μl |
5 U/ μ l Taq DNA polysaccharases | 0.25μl |
Mend the sterilization deionized water | To 25 μ l |
(2) optimization of magnesium ion concentration
By adding MgCl
2Solution (25mM) carries out the optimization of magnesium ion concentration, and the magnesium ion concentration (increasing progressively with 0.5 mM) with 1.0 mM-5.0 mM carries out PCR respectively, to determine the optimal concentration of magnesium ion in the reaction system.Other condition sees Table 3 in the reaction system, and the primer probe sequence sees Table 1.
Table 3 magnesium ion SSR-PCR optimization
Component | Add-on/ |
10×PCR buffer | 2.5μl |
2.5 mM dNTP | 2μl |
25 mM MgCl 2 | xμl |
Primer I (10 μ M) | 2μl |
Primer I I (10 μ M) | 2μl |
Template DNA | 5μl |
5 U/ μ l Taq DNA polysaccharases | 0.25μl |
Mend the sterilization deionized water | To 25 μ l |
Two, result:
Be defined as 0.4 μ M through the final primer concentration of test of many times; Magnesium ion concentration is defined as 3.0mM.After Fig. 1 is the PCR reaction system optimization, the swine dysentery weak point/treponema specificity electrophoretic band that obtains.
Embodiment 4: a kind of PCR test kit and use thereof that detects swine dysentery
One, the composition of test kit (48 tests/ boxes are stored in-20 ℃)
(1) DNA extraction liquid I:5ml/ pipe * 6 pipes, compound method is PEG 8000 20.74g, adds NaCl 17.53 g, is settled to 100mL with tri-distilled water, packing 5.0mL/ pipe;
(2) DNA extraction liquid II:500 μ L/pipe * 1 pipe, compound method is 1.0 mol/L Tris-Cl(pH 8.9) 2.0mL, 2.0 mol/L KCl 5.0mL, 0.5 mol/L EDTA (ethylenediamine tetraacetic acid (EDTA)) 0.5mL, the NP-40(Nonidet P40) 1.0 mL, be settled to 100mL with tri-distilled water, packing 500 μ L/ pipe;
(3) PCR reaction solution, 750 μ L * 2 pipes comprise: 1 * PCR damping fluid, 3.0mM MgCl
2, 0.2mM dNTP, 0.4 μ M primer I, 0.4 μ M primer I I; Wherein, the nucleotide sequence of primer I is shown in sequence table SEQ ID NO:1, and the nucleotide sequence of primer I I is shown in sequence table SEQ ID NO:2;
Consisting of of 10 * PCR damping fluid: 500mmol/L KCl, 100mmol/L Tris-HCl (pH9.0,25 ℃), 1.0%Triton X-100, the needs according to concentration during use dilute;
(4) Taq archaeal dna polymerase 5 U/ μ L, 15 μ L * 1 pipe (Shanghai Promega, article No. M1665S);
(5) without the sterilization purified water of DNA enzyme, manage 1mL * 1;
(6) negative control: 1mL * 1 pipe: DEPC water;
(7) positive control: 1mL * 1 pipe; Be swine dysentery weak point/treponema tlyA gene fragment, the nucleotide sequence of described swine dysentery weak point/treponema tlyA gene fragment is shown in sequence table SEQ ID NO:3, and Development Co., Ltd is synthetic by Shanghai rising sun hat biotechnology.
Two, the use of test kit
(1) DNA of extraction sample, i.e. template DNA concrete operations are as follows:
1. get n 1.5 mL sterilization centrifuge tube, wherein n is sample number to be checked, a pipe positive control and a pipe negative control sum, and each pipe is numbered mark.
2. every pipe adds 200 μ L DNA extraction liquid I, then adds respectively each 200 μ L of sample to be tested, negative control and positive control, and a sample is used a suction nozzle instead; Concussion mixing 5s on the vortex mixer.Under 4 ℃ ~ 25 ℃ conditions, centrifugal 10 min of 13000 r/min.
3. inhale as far as possible and abandon supernatant and do not bump precipitation, add again 10 μ L DNA extraction liquid II, concussion mixing 5 s on the vortex mixer.Under 4 ℃ ~ 25 ℃ conditions, centrifugal 10 s of 2000 r/min.
4. do bath or boiling water bath 10min for 100 ℃; The centrifugal 5s of 5000 r/min fully vibrates, and 5000 r/min recentrifuge 5s add 90 μ L without the sterilization purified water of DNA enzyme, after fully vibrating, and centrifugal 5 min of 5000 r/min, supernatant is the DNA of extraction, saves backup on ice.
5. the DNA that extracts must carry out pcr amplification or be positioned over-80 ℃ of refrigerators in 2 h.
(2) carry out the PCR reaction, the optimal reaction system is as follows:
Table 4 real-time PCR reactions composing system
Component | Volume |
The PCR reaction solution | 20 μl |
Taq DNA polysaccharase (5 U/ μ l) | 0.25 μl |
Template DNA | 5μl |
(3) reaction conditions:
92 ℃ of the first steps: 3 min, 1 circulation;
92 ℃ of second steps: 10 sec, 46 ℃: 30 sec, 72 ℃: 1min, 30 circulations;
72 ℃ of the 3rd steps: 7min;
4 ℃ of the 4th steps: preserve.
(4) agarose gel electrophoresis
Take by weighing 1.5 g agaroses in 100 mL, 1 * TAE electrophoretic buffer, fully heating is dissolved, and adds 3 μ L GoldView I type nucleic acid staining agent (perhaps like product), a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices glue.In electrophoresis chamber, add electrophoretic buffer, make liquid level just not have gel.5 μ L pcr amplification products are mixed with an amount of sample loading buffer respectively, point sample, and put 5 μ L Marker DL2000 in contrast.The 9V/cm constant voltage, electrophoresis 20 min~30 min.Observe electrophoresis result and record under the Ultraviolet Detector.
(5) result describes and judges
1. quality control standard:
Positive control has the specific amplification band at the 470bp place.
Negative control is without the specific amplification band.
Be discontented with the upper condition that is enough to such as negative control and positive condition, it is invalid that this time test is considered as.
2. the result judges:
Positive: as at the 470bp place specific amplification band to be arranged, have swine dysentery weak point/treponema in the expression sample.To the pcr amplification product order-checking, carry out validation test in case of necessity.
Negative: as without the specific amplification band, to show in the sample without swine dysentery weak point/treponema.
Embodiment 5: a kind of specific test that detects the PCR test kit of swine dysentery
One, method
Extract Brachyspira hyodysenteriae(7 strain) and the DNA of Brachyspira innocens, Salmonellas, intestinal bacteria and swine streptococcus (seeing table 5 for details) as template, with test kit and method that embodiment 4 sets up the DNA that extracts is carried out the PCR detection, to determine the specificity of detection kit.
The bacterial strain that is applied in the table 5 method research process
Bacterial strain | The source |
B. (ATCC numbers h: 27164) | Draw from ATCC, preserve in this laboratory |
B. (ATCC numbers h: 31212) | Draw from ATCC, preserve in this laboratory |
B. (ATCC numbers h: 31287) | Draw from ATCC, preserve in this laboratory |
B. (ATCC numbers h: 49526) | Draw from ATCC, preserve in this laboratory |
B. (ATCC numbers h: 49527) | Draw from ATCC, preserve in this laboratory |
B. (ATCC numbers h: 49886) | Draw from ATCC, preserve in this laboratory |
B. (ATCC numbers h: 49887) | Draw from ATCC, preserve in this laboratory |
B. (ATCC numbers i: 29796) | Draw from ATCC, preserve in this laboratory |
Salmonellas | Preserve in this laboratory |
Intestinal bacteria | Preserve in this laboratory |
Swine streptococcus (deactivation) | China Veterinery Drug Inspection Office |
Two. the result
The results are shown in Figure 2.The result shows that 7 strains distinctive amplification electrophoretic band all occurred from the B.h that ATCC introduces, and other 4 strain pathogen enterobacteria results are all negative.Prove that thus the method has stronger specificity.
Embodiment 6: a kind of sensitivity test that detects the PCR test kit of swine dysentery
One. method:
With test kit and method that embodiment 4 sets up embodiment 4 described positive criteria product are carried out the PCR in real time detection, to determine the sensitivity of reaction.After the dilution, obtain DNA concentration and be respectively 10
8, 10
7, 10
6, 10
5, 10
4, 10
3, 10
2, the solution of 10,1.0 copy/microlitres.
Two. the result
Positive criteria product (10 to dilution
8-1.0 copy/microlitres) carry out PCR in real time and detect, the result as shown in Figure 3.The result shows that PCR in real time (is respectively 10 from left to right to the positive criteria product of serial gradient dilution
8-1.0 copies/result corresponding to reaction) detecting, is 10 in template concentrations
3Copy/when reacting, weak specific band is arranged, 10
2The copy/reaction template concentrations the time without specific band.So PCR is to minimum the detection to 10 of swine dysentery weak point/treponema template
3Copy/reaction.
Embodiment 7: the detection of clinical sample
One. method
With reference to industry standard SN/T 1207-2003 " swine dysentery Brachyspira separation and Culture working specification " collected specimens is carried out pathogen separation.The sample that gathers carries out PCR with reference to the method for example 4 simultaneously and detects.
Two. the result
Table 6 PCR detected result and pathogen separation method result gather
The results are shown in Table 6, with the method 318 parts of pig manure swabs that 7 pig farms gather are detected.Experimental result shows that the method is a kind of special, sensitive, efficient detection method.This technology all has great application prospect in the monitoring of clinical plague and diagnosis, the inspection and quarantine requirement of area or laboratory especially can not satisfy to(for) plant of basic unit or culture condition.
Sequence table
<110〉People's Republic of China Beijing Entry-Exit Inspection and Quarantine Bureau
China Veterinery Drug Inspection Office
Beijing Agricultural College
<120〉a kind of PCR test kit and primer that detects swine dysentery
<130>
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213〉synthetic primer I
<400> 1
atgatgaaat cccatctgta ata 23
<210> 2
<211> 25
<212> DNA
<213〉synthetic primer I I
<400> 2
tatgataggc atagaatata aaagt 25
<210> 3
<211> 801
<212> DNA
<213〉swine dysentery weak point/treponema tlyA gene fragment
<400> 3
atgcagaact atttagactt attaaagaaa gtattagaag aaggcgaaga gactaaagat 60
agaaccggag taggtacaag aaggatattt ggtccgcaat taagatttaa atttgaagga 120
aataaaatac caataataac aacaaaaaga gtttttatga aaggcgttat tatagaatta 180
ctttggtttt tgcaaggatc tacaaatata aaattcttat tagaaaataa tgttcatata 240
tgggatgagt gggctgatga tatgggagag cttggacctg tatatggaaa acagtggaga 300
gcttgggaaa ctaaagaagg aaataaaata gatcaaatat caaatatagt gaatacatta 360
agaaataatc ctgcaagcag aagaattatt ttaaatgcat ggaatgtggg agagattgat 420
caaatgcatc ttcctccatg ccatatgatg tgccagtttt cggttaatag caaaggagga 480
atcattactc atttatacca aagatctgcc gatttatttt tgggagttcc ttttaatata 540
agttcttatg ctatacttac aaggctttta gctatgcata gcggacttca tgcttcagaa 600
ttaataatga cattcggaga tgcacatatt tataataatc atatagagca ggttaaactt 660
cagctttcaa gagagccttt agagcagaca actgaattat ttatagataa tcgtcctaat 720
atttttagtc atgtttatga ggatttcaaa ttagaaggtt ataaatacta cccaactata 780
aaagcggagg tagcagtttg a 801
Claims (3)
1. one group of primer that detects swine dysentery is characterized in that, this primer sequence is shown in sequence table SEQ ID NO:1 to SEQ ID NO:2, and wherein SEQ ID NO:1 is for detecting the primer I of swine dysentery, and SEQ ID NO:2 is for detecting the primer I I of swine dysentery.
2. a test kit that detects swine dysentery is characterized in that, and is composed of the following components:
(1) DNA extraction liquid I: its compound method is PEG 8000 20.74g, adds NaCl 17.53 g, is settled to 100mL with tri-distilled water;
(2) DNA extraction liquid II: its compound method is 1.0 mol/L Tris-Cl 2.0mL, 2.0 mol/L KCl 5.0mL, and 0.5 mol/L EDTA 0.5mL, NP-40 1.0 mL are settled to 100mL with tri-distilled water;
(3) PCR reaction solution comprises: PCR damping fluid, MgCl
2, dNTP, primer I, primer I I; Wherein, the nucleotide sequence of primer I is shown in sequence table SEQ ID NO:1, and the nucleotide sequence of primer I I is shown in sequence table SEQ ID NO:2;
(4) Taq archaeal dna polymerase;
(5) without the sterilization purified water of DNA enzyme;
(6) negative control: DEPC water;
(7) positive control: be swine dysentery weak point/treponema tlyA gene fragment, the nucleotide sequence of described tlyA gene fragment is shown in sequence table SEQ ID NO:3.
3. the test kit of detection swine dysentery according to claim 2, it is characterized in that: described PCR reaction solution is 1 * PCR damping fluid, 3.0mM MgCl
2, 0.2mM dNTP, 0.4 μ M primer I, 0.4 μ M primer I I.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110330683 CN102373277B (en) | 2011-10-27 | 2011-10-27 | PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110330683 CN102373277B (en) | 2011-10-27 | 2011-10-27 | PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102373277A CN102373277A (en) | 2012-03-14 |
CN102373277B true CN102373277B (en) | 2013-01-02 |
Family
ID=45792504
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201110330683 Expired - Fee Related CN102373277B (en) | 2011-10-27 | 2011-10-27 | PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102373277B (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1616681A (en) * | 2002-12-12 | 2005-05-18 | 山东澳兰生物工程研究院 | Diagnostic gene chip for pig infectious diarrhea and its use |
CN101175856A (en) * | 2005-05-12 | 2008-05-07 | 诺瓦提斯公司 | Novel genes and proteins of brachyspira hyodysenteriae and use of same for diagnosis and therapy |
CN101228276A (en) * | 2005-06-23 | 2008-07-23 | 诺瓦提斯公司 | Novel genes and proteins of brachyspira pilosicoli and use of same for diagnosis and therapy |
-
2011
- 2011-10-27 CN CN 201110330683 patent/CN102373277B/en not_active Expired - Fee Related
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1616681A (en) * | 2002-12-12 | 2005-05-18 | 山东澳兰生物工程研究院 | Diagnostic gene chip for pig infectious diarrhea and its use |
CN101175856A (en) * | 2005-05-12 | 2008-05-07 | 诺瓦提斯公司 | Novel genes and proteins of brachyspira hyodysenteriae and use of same for diagnosis and therapy |
CN101228276A (en) * | 2005-06-23 | 2008-07-23 | 诺瓦提斯公司 | Novel genes and proteins of brachyspira pilosicoli and use of same for diagnosis and therapy |
Also Published As
Publication number | Publication date |
---|---|
CN102373277A (en) | 2012-03-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103725796B (en) | Mark parting fluorescence PCR detection kit and preparation thereof in a kind of bovine viral diarrhea virus | |
CN102191321B (en) | Detection kit for ureaplasma urealyticum (UU) nucleic acid by utilizing RNA constant-temperature amplification | |
CN105018628B (en) | Differentiate the kit of brucella A19 vaccine strains and street strain | |
CN101144775B (en) | Bacteria real-time fluorescence quantitative polymerase chain reaction detection reagent kit | |
CN103498000A (en) | Primer group, kit and method for detecting rice quarantine pathogenic bacteria by multiplex PCR (polymerase chain reaction) method | |
CN103103273A (en) | Method for rapidly and qualitatively detecting mycoplasma pneumoniae of sheep | |
CN101481742B (en) | Detection kit for Mycoplasma hyopneumoniae and use thereof | |
CN101492741A (en) | Method for quantitative detection of mycoplasma hyopneumoniae | |
CN104263845A (en) | Treble PCR method for simultaneously detecting mycoplasma hyopneumoniae, porcine pasteurella multocida and haemophilus parasuis | |
CN106967839A (en) | Primer, probe, kit and the method for B races streptococcus fluorescence quantitative PCR detection | |
CN103045721B (en) | The fluorescence quantitative detecting method of ureaplasma urealyticum and ureaplasma parvum | |
CN103146846A (en) | Single standard product-based four-color fluorogenic quantitative PCR (Polymerase Chain Reaction) method and kit | |
CN101469326A (en) | Nucleotide specific to ITS of Balcillus proteus mirabilis and use thereof | |
CN113249517A (en) | Primer, probe and kit for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of bovine plague | |
KR20120045917A (en) | Specific primers for rapid detection of bakanae disease pathogen(fusarium fujikuroi) and method for detection using the same | |
CN104232789A (en) | RT-PCR (reverse transcription-polymerase chain reaction) technique capable of simultaneously identifying porcine reproductive and respiratory syndrome virus (PRRSV) | |
CN107653308A (en) | One group is used to distinguishing active tuberculosis patient and is combined with the primer pair of non-tuberculous pneumonia patient and kit | |
CN103160587A (en) | Genetic typing chip of 10 common pathogenic legionella and detection kit | |
CN102373277B (en) | PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery | |
CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
CN102676678B (en) | PCR (Polymerase Chain Reaction) primer group for distinguishing five types of shellfish bait microalgae | |
CN106103714A (en) | In vivo infection microorganism, parasitic microbe, the noncoding RNA of symbiotic microorganism and qualification thereof and application | |
CN104561341B (en) | Primers and kit for detecting macrolide drug-resistance genes of bacteria | |
CN102154466B (en) | Nucleotides with specificity to internal transcribed spacer(ITS) of neisseria meningitidis and application thereof | |
CN103627801B (en) | Primer, probe and kit for detecting specific sequence of group B streptococcus |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130102 Termination date: 20201027 |
|
CF01 | Termination of patent right due to non-payment of annual fee |