CN102373277A - PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery - Google Patents
PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery Download PDFInfo
- Publication number
- CN102373277A CN102373277A CN2011103306833A CN201110330683A CN102373277A CN 102373277 A CN102373277 A CN 102373277A CN 2011103306833 A CN2011103306833 A CN 2011103306833A CN 201110330683 A CN201110330683 A CN 201110330683A CN 102373277 A CN102373277 A CN 102373277A
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- swine dysentery
- dna
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery. A group of primers for detecting the swine dysentery have the nucleotide sequences disclosed in a sequence table SEQIDNo: 1 and a sequence table SEQIDNo: 2. The invention has the advantages that compared with etiology separation culture, the PCR technology applied in the detection of the swine dysentery is faster and more convenient, the bacterium separation culture method at least needs 10 days and hard culture conditions, strict anaerobic culture is needed, and the PCR can be completed only in 5 hours; and compared with etiology separation, the PCR needs relatively simple equipment, is more convenient to master and operate from a technical perspective, is more convenient to apply and popularize in areas with insufficient conditions and is more conductive to the diagnosis and monitoring of the swine dysentery.
Description
Technical field
The present invention relates to a kind of PCR test kit and primer that detects swine dysentery, belong to inspection and quarantine field.
Background technology
Swine dysentery (Swine dysentery
SD) pathogenic agent be a kind of gram-negative oxyphobe spirochete, successively called after be by the swine dysentery treponema (
Treponema hyodysenteriae; T.h), the snakelike spirochete of swine dysentery (
Serpulinahyodysenteriae;S.h).The short spirochete of now unified called after swine dysentery (
Brachyspira hyodysenteriaeB.h), this title of swine dysentery treponema also is widely used owing to historical reasons at present.This disease is a kind of infectious intestinal disease of pig, is characteristic with mucus or mucus hemorrhagic diarrhea.Sickness rate in swinery is quite high, and sick pig growth and development is obstructed, and feed consumption increases, and causes very big financial loss for the various places pig industry.The feed intake rate of sick pig is 2 times of normal pig according to statistics, and rate of body weight gain is merely 1/2 of normal pig.According to the statistics of nineteen eighty-three Lyson, be the medicine that the control swine dysentery is added, every pig cost 2.5-2.8 dollar in feed.According to the calculating of (1988) such as Wood, the feed intake of swine dysentery swinery, every listing pig will be spent more 12.6 dollars, and every pig also will be spent more 2.4 dollars of expenses simultaneously.Estimate annual owing to swine dysentery is lost 6,400 ten thousand dollars in the U.S..
This disease spreads all over more than 50 countries and regions, five continents.In a single day in China, all there is the existence of this disease in many provinces, city, and import swinery into, if do not take strict treatment measures to be difficult to eradicate.
In October, 1978; The port, Shanghai is after making a definite diagnosis swine dysentery from the quarantine of 451 market pigs of U.S.'s import; Merely hit China pig again at the beginning of 1979 and make a definite diagnosis swine dysentery; And only separate from domestic pig and to obtain the short spirochete pure culture of swine dysentery, cause China animal doctor's circle attention, and be put into " the People's Republic of China enter the territory one, two type of transmissible disease ".
In the bilateral agreements of importing and exporting the U.S., Britain, Australia, nz, Holland, Denmark, Ireland, and the import pig of states such as Japan require to carry out the short spirochetal detection of swine dysentery.Existing testing conditions requires high (strict anaerobism is cultivated), and common laboratory is difficult to satisfy the requirement that detects.
Up to the present, this disease does not also have the detection method of satisfied simple possible., immigration adopts industry standard SN/T 1207-2003 " the short spirochete separation and Culture of swine dysentery working specification " in detecting; Round of visits is wanted two time-of-weeks; And strict anaerobism is cultivated and is monitored, and therefore is badly in need of a kind of detection method quick, responsive, high specificity and perhaps replenishes these rules to substitute.
Polymerase chain reaction (English full name: Polymerase Chain Reaction); Be called for short PCR; PCR is a kind of method of the synthetic specific DNA fragment of external enzymatic, forms one-period by a few step reactions such as high-temperature denatured, low-temperature annealing (renaturation) and thermophilic extension, and circulation is carried out; Make target DNA be able to rapid amplification, have high specificity, highly sensitive, easy and simple to handle, characteristics such as save time.It not only can be used for fundamental researchs such as gene isolation, clone and nucleic acid sequence analysis, also can be used for diagnosis or any DNA of having of disease, the place of RNA.Polymerase chain reaction (Polymerase Chain Reaction is called for short PCR) is claimed cell-free molecular cloning or the directed enzymatic amplification technique of the external primer of specific DNA sequences again.
Round pcr has following advantage:
1. high specificity
The specificity determinative of PCR reaction is:
1. primer and special correct the combining of template DNA;
2. basepairing rule;
3. the fidelity of Taq archaeal dna polymerase building-up reactions;
4. the specificity of target gene and conservative property.
Wherein primer is crucial with correct combination of template.Primer and template combine and basepairing rule is followed in the extension of primer strand.The fidelity of polysaccharase building-up reactions and Taq archaeal dna polymerase high thermal resistance; Template can be carried out under higher temperature with combine (renaturation) of primer; The bonded specificity increases greatly, and the target fragment that is increased also just can keep very high correctness.Through selecting specificity and the high target gene district of conservative property, its degrees of specificity is just higher again.
2. highly sensitive
The growing amount of PCR product increases with exponential manner, can be with pik (pg=10
-12) template amplification initial to be measured of magnitude is to microgram (μ g=10
-6) level.Can from 1,000,000 cells, detect a target cell; In the detection of virus, the sensitivity of PCR can reach 3 RFU (plaque forming unit); Minimum recall rate is 3 bacteriums in bacteriology.
3. easy, quick
PCR reaction is with resistant to elevated temperatures Taq archaeal dna polymerase, once with reaction solution add good after, promptly on DNA cloning liquid and water-bath, carry out sex change-annealing-extension, generally at 2～4 hours completion amplified reactions.Amplified production is generally used electrophoretic analysis, not necessarily will use isotropic substance, "dead" pollution, the easy popularization.
Do not need isolated viral or bacterium and culturing cell to the purity requirement of sample is low, DNA raw product and RNA all can be used as amplification template.Can be directly with clinical samples such as blood, coelomic fluid, wash DNA cloning such as the liquid of coughing, hair, cell, living tissue and detect.
The present invention is applied to swine dysentery with round pcr first in China and detects, and provides to swine dysentery weak point/treponema specific primer sequence, test kit and detection method.Compare with traditional pathogen separation method and to have quick, efficient, simple and direct characteristics.
Summary of the invention
First technical problem that the present invention will solve provides one group of that use as primer, as to detect swine dysentery oligonucleotide sequence.
Second technical problem that the present invention will solve provide a kind of special, sensitive, detect the test kit of swine dysentery efficiently.
For solving first technical problem, the present invention adopts following technical scheme:
One group of primer that detects swine dysentery, the oligonucleotide sequence for shown in sequence table SEQ ID No:1 and the SEQ ID No:2 sees table 1 for details.
Table 1. primer sequence
| Title | Sequence (5 '-3 ') | The sequence table numbering |
| Primer I | ATGATGAAATCCCATCTGTAATA | SEQ ID No：1 |
| Primer I I | TATGATAGGCATAGAATATAAAAGT | SEQ ID No：2 |
Annotate: cytosine(Cyt) (C), guanine (G), VITAMIN B4 (A), thymus pyrimidine (T).
Wherein aligning primer I and primer I I are respectively sense primer and the antisense primer that detects swine dysentery.
For solving second technical problem, the present invention adopts following technical scheme:
A kind of PCR test kit that detects swine dysentery is stored in-20 ℃, is made up of following reagent:
(1) DNA extraction liquid I:5mL/ pipe * 5 pipes; Its compound method is PEG 8000 20.74g, adds NaCl 17.53 g, is settled to 100mL with tri-distilled water, packing 5.0mL/ pipe;
(2) DNA extraction liquid II:500 μ L/pipe * 1 pipe; Its compound method is 1.0 mol/L Tris-Cl 2.0mL, 2.0 mol/L KCl 5.0mL, and 0.5 mol/L EDTA 0.5mL, NP-40 1.0 mL are settled to 100mL with tri-distilled water, packing 500 μ L/ pipe;
(3) PCR reaction solution, 750 μ L * 2 pipes comprise: 1 * PCR damping fluid, 3.0mM MgCl
2, 0.2mM dNTP, 0.4 μ M primer I, 0.4 μ M primer I I; Wherein, the nucleotide sequence of primer I is shown in sequence table SEQ ID NO:1, and the nucleotide sequence of primer I I is shown in sequence table SEQ ID NO:2;
(4) Taq archaeal dna polymerase 5 U/ μ L, 15 μ L * 1 pipe;
(5) the sterilization purified water of no DNA enzyme, 1mL * 1 pipe;
(6) negative control: 1mL * 1 pipe: DEPC water;
(7) positive control: 1mL * 1 pipe; Be swine dysentery weak point/treponema tlyA gene fragment, the nucleotide sequence of said tlyA gene fragment is shown in sequence table SEQ ID NO:3.
The present invention also provides a kind of method of detection swine dysentery, comprises the steps:
1) extracts sample DNA;
2) sample DNA that extracts is carried out pcr amplification:
Primer sequence is 1) 5 '-ATGATGAAATCCCATCTGTAATA-3 '
2）5’-TATGATAGGCATAGAATATAAAAGT-3’
92 ℃ of the first steps: 3 min, 1 circulation;
92 ℃ of second steps: 10 sec, 46 ℃: 30 sec, 72 ℃: 1min, 30 circulations;
72 ℃ of the 3rd steps: 7min;
4 ℃ of the 4th steps: preserve.
3) agarose gel electrophoresis
Take by weighing 1.5 g agaroses in 100 mL, 1 * TAE electrophoretic buffer, fully heating is dissolved, and adds 3 μ L GoldView I type nucleic acid staining agent (perhaps like product), a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices glue.In electrophoresis chamber, add electrophoretic buffer, make liquid level just not have gel.5 μ L pcr amplification products are mixed with an amount of sample loading buffer respectively, point sample, and put 5 μ L Marker DL2000 as contrast.The 9V/cm constant voltage, electrophoresis 20 min～30 min.Ultraviolet Detector is observed electrophoresis result and record down.
4) result describes and judges
1. quality control standard:
Positive control has the specific amplification band at the 470bp place.
Negative control does not have the specific amplification band.
Like negative control and the discontented condition that is enough to of positive condition, it is invalid that test this time is regarded as.
2. the result judges:
Positive: as at the 470bp place specific amplification band to be arranged, have swine dysentery weak point/treponema in the expression sample.To the pcr amplification product order-checking, carry out validation test in case of necessity.
Negative: no specific amplification band shows no swine dysentery weak point/treponema in the sample.
The contriver detects template with PCR among the present invention, has verified the specificity of this method.The results of comparative experiment of PCR and traditional isolated culture also shows, two kinds of methods notable difference not on detecting.
The present invention has carried out the susceptibility experiment with through the template detection to dilution.Experimental result shows, minimumly can detect 10
3The dna profiling amount of copy/reaction has higher sensitivity.
318 parts of pig manure swabs 7 pig farms being gathered with this method detect.Experimental result shows, this method is a kind of special, sensitive, detection method efficiently.This technology all has great application prospect in the monitoring of clinical plague and diagnosis, the inspection and quarantine requirement of area or laboratory especially can not satisfy to(for) plant of basic unit or culture condition.
Advantage of the present invention is: round pcr is applied in the detection of swine dysentery; Cultivate with pathogen separation and to compare, 1, PCR sooner, more convenient, the bacterium isolation cultivation method needed 10 days at least and culture condition harsh; Need strict anaerobism to cultivate, and PCR only need just can accomplish in about 5 hours; 2, it is simple relatively to compare the equipment that PCR needs with pathogen separation, says from technological layer and is more convenient for grasping and operation, is more convenient for applying in the insufficient area of condition, more helps diagnosis and monitoring to swine dysentery.Through the optimization of reaction conditions, this PCR is minimum to be detected to 10
3The amount of bacteria of copy/reaction.This method also detects 318 parts of pig manure swabs that gather on 7 pig farms.Experimental result shows, this method is a kind of special, sensitive, detection method efficiently.This technology all has great application prospect in the monitoring of clinical plague and diagnosis, the inspection and quarantine requirement of area or laboratory especially can not satisfy to(for) plant of basic unit or culture condition.
Below in conjunction with Figure of description and embodiment the present invention is described further, all any this areas of doing according to the disclosure of invention be equal to replacement, all belong to protection scope of the present invention.
Description of drawings
After Fig. 1 is the PCR reaction system optimization, the specificity electrophoretic band that obtains; Wherein, M:Marker DL2000; 1: positive; 2: negative sample;
Fig. 2 is the specificity test-results of the PCR detection kit of detection swine dysentery; Wherein, M:Marker DL2000; 1: positive control; (2-8:B.h the ATCC numbering is followed successively by 27164,31212,31287,49526,49527,49886,49887); 9:B.i (ATCC numbering: 29796); 10: Salmonellas; 11: intestinal bacteria; 12: swine streptococcus (deactivation);
Fig. 3 is the susceptibility detected result of the PCR detection kit of detection swine dysentery; Wherein, M:Marker DL2000; 1-8:10
8-1.0 copy/microlitres (making 10 times of gradient dilutions successively); 9: negative control.
Embodiment
The used Brachyspira hyodysenteriae of the present invention (B.h), Brachyspira innocens (B.i), intestinal bacteria and Salmonellas; Be Inspection and Quarantine Technology Center, Beijing Entry-Exit Inspection and Q and preserve, the swine streptococcus of deactivation is provided by China Veterinery Drug Inspection Office.
Embodiment 1: primer design is with synthetic
Swine dysentery weak point/treponemal genes involved sequence according to logining among the Genbank compares with DNAMAN software, selects the zone of tlyA gene high conservative respectively, uses Oligo6.0 software, designs to the treponemal primer of swine dysentery.With table 1.
Primer is synthetic by Shanghai rising sun hat Bioisystech Co., Ltd.
Embodiment 2: the extraction of swine dysentery weak point/treponema DNA
Extract swine dysentery weak point/treponema DNA with DNA extraction reagent.
Concrete operations are following:
1. get n 1.5 mL sterilization centrifuge tube, wherein n is sample number to be checked, a pipe positive control and a pipe negative control sum, and each pipe is numbered mark.
2. every pipe adds 200 μ L DNA extraction liquid I, adds each 200 μ L of sample to be tested, negative control and positive control then respectively, and a sample is used a suction nozzle instead; Concussion mixing 5s on the vortex mixer.Under 4 ℃ ~ 25 ℃ conditions, centrifugal 10 min of 13000 r/min.
3. inhale as far as possible and abandon supernatant and do not bump deposition, add 10 μ L DNA extraction liquid II again, concussion mixing 5 s on the vortex mixer.Under 4 ℃ ~ 25 ℃ conditions, centrifugal 10 s of 2000 r/min.
4. do bath or boiling water bath 10min for 100 ℃; The centrifugal 5s of 5000 r/min fully vibrates, and 5000 r/min recentrifuge 5s add the sterilization purified water that 90 μ L do not have the DNA enzyme, after fully vibrating, and centrifugal 5 min of 5000 r/min, supernatant is the DNA of extraction, preserves subsequent use on ice.
5. the DNA that extracts must carry out pcr amplification or be positioned over-80 ℃ of refrigerators in 2 h.
The foundation of embodiment 3:PCR system
One, probe and primer concentration, magnesium ion concentration and enzyme concn are optimized respectively, set up the reaction system of PCR.
Obtain swine dysentery weak point/treponema DNA according to embodiment 2 methods, template concentrations is about 10
4-10
6Copy/microlitre carries out PCR, optimizing reaction system.
(1) optimization of primer concentration
Probe and primer are optimized respectively.The primer concentration that increases progressively with 0.1 μ M spacing from 0.1 μ M to 0.8 μ M and intersect proportioning from the concentration and probe concentration that 0.1 μ M to 0.5 μ M increases progressively with 0.1 μ M spacing carries out PCR in real time, to select the righttest primer and concentration and probe concentration.The reaction system part is seen table 2, and the primer and probe sequence are seen table 1:
Table 2 primer probe optimization PCR reaction system
| Component | Add-on/ |
| 10×PCR buffer | 2.5μl |
| 2.5 mM? dNTP | 2μl |
| 25 mM MgCl 2 | 3.0mM |
| Primer I (10 μ M) | xμM |
| Primer I I (10 μ M) | yμM |
| Template DNA | 5μl |
| 5 U/ μ l Taq DNA polysaccharases | 0.25μl |
| Mend the sterilization deionized water | To 25 μ l |
(2) optimization of magnesium ion concentration
Through adding MgCl
2Solution (25mM) carries out the optimization of magnesium ion concentration, and the magnesium ion concentration (increasing progressively with 0.5 mM) with 1.0 mM-5.0 mM carries out PCR respectively, to confirm the optimal concentration of mg ion in the reaction system.Other condition is seen table 3 in the reaction system, and the primer probe sequence is seen table 1.
Table 3 mg ion is optimized the PCR reaction system
| Component | Add-on/ |
| 10×PCR buffer | 2.5μl |
| 2.5 mM? dNTP | 2μl |
| 25 mM MgCl 2 | xμl |
| Primer I (10 μ M) | 2μl |
| Primer I I (10 μ M) | 2μl |
| Template DNA | 5μl |
| 5 U/ μ l Taq DNA polysaccharases | 0.25μl |
| Mend the sterilization deionized water | To 25 μ l |
Two, result:
Confirm as 0.4 μ M through the final primer concentration of test of many times; Magnesium ion concentration is confirmed as 3.0mM.After Fig. 1 is the PCR reaction system optimization, the swine dysentery weak point/treponema specificity electrophoretic band that obtains.
Embodiment 4: a kind of PCR test kit and use thereof that detects swine dysentery
One, the composition of test kit (48 tests/ boxes are stored in-20 ℃)
(1) DNA extraction liquid I:5ml/ pipe * 6 pipes, compound method is PEG 8000 20.74g, adds NaCl 17.53 g, is settled to 100mL with tri-distilled water, packing 5.0mL/ pipe;
(2) DNA extraction liquid II:500 μ L/pipe * 1 pipe; Compound method is 1.0 mol/L Tris-Cl (pH 8.9) 2.0mL; 2.0 mol/L KCl 5.0mL, 0.5 mol/L EDTA (YD 30) 0.5mL, NP-40 (Nonidet P40) 1.0 mL; Be settled to 100mL with tri-distilled water, packing 500 μ L/ pipe;
(3) PCR reaction solution, 750 μ L * 2 pipes comprise: 1 * PCR damping fluid, 3.0mM MgCl
2, 0.2mM dNTP, 0.4 μ M primer I, 0.4 μ M primer I I; Wherein, the nucleotide sequence of primer I is shown in sequence table SEQ ID NO:1, and the nucleotide sequence of primer I I is shown in sequence table SEQ ID NO:2;
Consisting of of 10 * PCR damping fluid: 500mmol/L KCl, 100mmol/L Tris-HCl (pH9.0,25 ℃), 1.0%Triton X-100, the needs according to concentration during use dilute;
(4) Taq archaeal dna polymerase 5 U/ μ L, 15 μ L * 1 pipe (Shanghai Promega, article No. M1665S);
(5) the sterilization purified water of no DNA enzyme, 1mL * 1 pipe;
(6) negative control: 1mL * 1 pipe: DEPC water;
(7) positive control: 1mL * 1 pipe; Be swine dysentery weak point/treponema tlyA gene fragment, the nucleotide sequence of said swine dysentery weak point/treponema tlyA gene fragment is shown in sequence table SEQ ID NO:3, and Development Co., Ltd is synthetic by Shanghai rising sun hat biotechnology.
Two, the use of test kit
(1) DNA of extraction sample, i.e. template DNA concrete operations are following:
1. get n 1.5 mL sterilization centrifuge tube, wherein n is sample number to be checked, a pipe positive control and a pipe negative control sum, and each pipe is numbered mark.
2. every pipe adds 200 μ L DNA extraction liquid I, adds each 200 μ L of sample to be tested, negative control and positive control then respectively, and a sample is used a suction nozzle instead; Concussion mixing 5s on the vortex mixer.Under 4 ℃ ~ 25 ℃ conditions, centrifugal 10 min of 13000 r/min.
3. inhale as far as possible and abandon supernatant and do not bump deposition, add 10 μ L DNA extraction liquid II again, concussion mixing 5 s on the vortex mixer.Under 4 ℃ ~ 25 ℃ conditions, centrifugal 10 s of 2000 r/min.
4. do bath or boiling water bath 10min for 100 ℃; The centrifugal 5s of 5000 r/min fully vibrates, and 5000 r/min recentrifuge 5s add the sterilization purified water that 90 μ L do not have the DNA enzyme, after fully vibrating, and centrifugal 5 min of 5000 r/min, supernatant is the DNA of extraction, preserves subsequent use on ice.
5. the DNA that extracts must carry out pcr amplification or be positioned over-80 ℃ of refrigerators in 2 h.
(2) carry out the PCR reaction, the optimal reaction system is following:
Table 4 real-time PCR reactions system is formed
| Component | Volume |
| The PCR reaction solution | 20 μl |
| Taq DNA polysaccharase (5 U/ μ l) | 0.25 μl |
| Template DNA | 5μl |
(3) reaction conditions:
92 ℃ of the first steps: 3 min, 1 circulation;
92 ℃ of second steps: 10 sec, 46 ℃: 30 sec, 72 ℃: 1min, 30 circulations;
72 ℃ of the 3rd steps: 7min;
4 ℃ of the 4th steps: preserve.
(4) agarose gel electrophoresis
Take by weighing 1.5 g agaroses in 100 mL, 1 * TAE electrophoretic buffer, fully heating is dissolved, and adds 3 μ L GoldView I type nucleic acid staining agent (perhaps like product), a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices glue.In electrophoresis chamber, add electrophoretic buffer, make liquid level just not have gel.5 μ L pcr amplification products are mixed with an amount of sample loading buffer respectively, point sample, and put 5 μ L Marker DL2000 as contrast.The 9V/cm constant voltage, electrophoresis 20 min～30 min.Ultraviolet Detector is observed electrophoresis result and record down.
(5) result describes and judges
1. quality control standard:
Positive control has the specific amplification band at the 470bp place.
Negative control does not have the specific amplification band.
Like negative control and the discontented condition that is enough to of positive condition, it is invalid that test this time is regarded as.
2. the result judges:
Positive: as at the 470bp place specific amplification band to be arranged, have swine dysentery weak point/treponema in the expression sample.To the pcr amplification product order-checking, carry out validation test in case of necessity.
Negative: no specific amplification band shows no swine dysentery weak point/treponema in the sample.
Embodiment 5: a kind of specificity test that detects the PCR test kit of swine dysentery
One, method
The DNA that extracts Brachyspira hyodysenteriae (7 strain) and Brachyspira innocens, Salmonellas, intestinal bacteria and swine streptococcus (seeing table 5 for details) is as template; Test kit and method with embodiment 4 is set up are carried out the PCR detection to the DNA that extracts, to confirm the specificity of detection kit.
The bacterial strain that is applied in the table 5 method research process
| Bacterial strain | The source |
| B. (ATCC numbers h: 27164) | Draw from ATCC, preserve in this laboratory |
| B. (ATCC numbers h: 31212) | Draw from ATCC, preserve in this laboratory |
| B. (ATCC numbers h: 31287) | Draw from ATCC, preserve in this laboratory |
| B. (ATCC numbers h: 49526) | Draw from ATCC, preserve in this laboratory |
| B. (ATCC numbers h: 49527) | Draw from ATCC, preserve in this laboratory |
| B. (ATCC numbers h: 49886) | Draw from ATCC, preserve in this laboratory |
| B. (ATCC numbers h: 49887) | Draw from ATCC, preserve in this laboratory |
| B. (ATCC numbers i: 29796) | Draw from ATCC, preserve in this laboratory |
| Salmonellas | Preserve in this laboratory |
| Intestinal bacteria | Preserve in this laboratory |
| Swine streptococcus (deactivation) | China Veterinery Drug Inspection Office |
Two. the result
The result sees Fig. 2.The result shows that 7 strains distinctive amplification electrophoretic band all occurred from the B.h that ATCC introduces, and other 4 strain pathogen enterobacteria results are all negative.Prove that thus this method has strong specificity.
Embodiment 6: a kind of sensitivity test that detects the PCR test kit of swine dysentery
One. method:
Test kit and method with embodiment 4 is set up are carried out the PCR in real time detection to embodiment 4 described positive criteria article, to confirm the sensitivity of reaction.After the dilution, obtain DNA concentration and be respectively 10
8, 10
7, 10
6, 10
5, 10
4, 10
3, 10
2, the solution of 10,1.0 copy/microlitres.
Two. the result
Positive criteria article (10 to dilution
8-1.0 copy/microlitres) carry out PCR in real time and detect, the result is as shown in Figure 3.The result shows that PCR in real time (is respectively 10 from left to right to the positive criteria article of serial gradient dilution
8The result that-1.0 copy/reaction pairs are answered) detecting, is 10 in template concentrations
3During copy/reaction, more weak specific band is arranged, 10
2There is not specific band during the template concentrations of copy/reaction.So PCR is to minimum the detection to 10 of swine dysentery weak point/treponema template
3Copy/reaction.
Embodiment 7: the detection of clinical sample
One. method
With reference to industry standard SN/T 1207-2003 " the short spirochete separation and Culture of swine dysentery working specification " collected specimens is carried out pathogen separation.The sample of gathering carries out PCR with reference to the method for instance 4 simultaneously and detects.
Two. the result
Table 6 PCR detected result and pathogen separation method result gather
The result sees table 6, and 318 parts of pig manure swabs 7 pig farms being gathered with this method detect.Experimental result shows, this method is a kind of special, sensitive, detection method efficiently.This technology all has great application prospect in the monitoring of clinical plague and diagnosis, the inspection and quarantine requirement of area or laboratory especially can not satisfy to(for) plant of basic unit or culture condition.
Sequence table
< 110>People's Republic of China Beijing Entry-Exit Inspection and Quarantine Bureau
China Veterinery Drug Inspection Office
Beijing Agricultural College
< 120>a kind of PCR test kit and primer that detects swine dysentery
<130>
<160> 3
<170> PatentIn?version?3.3
<210> 1
<211> 23
<212> DNA
< 213>synthetic primer I
<400> 1
atgatgaaat?cccatctgta?ata 23
<210> 2
<211> 25
<212> DNA
< 213>synthetic primer I I
<400> 2
tatgataggc?atagaatata?aaagt 25
<210> 3
<211> 801
<212> DNA
< 213>swine dysentery weak point/treponema tlyA gene fragment
<400> 3
atgcagaact?atttagactt?attaaagaaa?gtattagaag?aaggcgaaga?gactaaagat 60
agaaccggag?taggtacaag?aaggatattt?ggtccgcaat?taagatttaa?atttgaagga 120
aataaaatac?caataataac?aacaaaaaga?gtttttatga?aaggcgttat?tatagaatta 180
ctttggtttt?tgcaaggatc?tacaaatata?aaattcttat?tagaaaataa?tgttcatata 240
tgggatgagt?gggctgatga?tatgggagag?cttggacctg?tatatggaaa?acagtggaga 300
gcttgggaaa?ctaaagaagg?aaataaaata?gatcaaatat?caaatatagt?gaatacatta 360
agaaataatc?ctgcaagcag?aagaattatt?ttaaatgcat?ggaatgtggg?agagattgat 420
caaatgcatc?ttcctccatg?ccatatgatg?tgccagtttt?cggttaatag?caaaggagga 480
atcattactc?atttatacca?aagatctgcc?gatttatttt?tgggagttcc?ttttaatata 540
agttcttatg?ctatacttac?aaggctttta?gctatgcata?gcggacttca?tgcttcagaa 600
ttaataatga?cattcggaga?tgcacatatt?tataataatc?atatagagca?ggttaaactt 660
cagctttcaa?gagagccttt?agagcagaca?actgaattat?ttatagataa?tcgtcctaat 720
atttttagtc?atgtttatga?ggatttcaaa?ttagaaggtt?ataaatacta?cccaactata 780
aaagcggagg?tagcagtttg?a 801
Claims (4)
1. one group of primer that detects swine dysentery is characterized in that, this primer sequence is shown in sequence table SEQ ID NO:1 to SEQ ID NO:2, and wherein SEQ ID NO:1 is for detecting the primer I of swine dysentery, and SEQ ID NO:2 is for detecting the primer I I of swine dysentery.
2. a test kit that detects swine dysentery is characterized in that, and is composed of the following components:
(1) DNA extraction liquid I: its compound method is PEG 8000 20.74g, adds NaCl 17.53 g, is settled to 100mL with tri-distilled water;
(2) DNA extraction liquid II: its compound method is 1.0 mol/L Tris-Cl 2.0mL, 2.0 mol/L KCl 5.0mL, and 0.5 mol/L EDTA 0.5mL, NP-40 1.0 mL are settled to 100mL with tri-distilled water;
(3) PCR reaction solution comprises: PCR damping fluid, MgCl
2, dNTP, primer I, primer I I; Wherein, the nucleotide sequence of primer I is shown in sequence table SEQ ID NO:1, and the nucleotide sequence of primer I I is shown in sequence table SEQ ID NO:2;
(4) Taq archaeal dna polymerase;
(5) the sterilization purified water of no DNA enzyme;
(6) negative control: DEPC water;
(7) positive control: be swine dysentery weak point/treponema tlyA gene fragment, the nucleotide sequence of said tlyA gene fragment is shown in sequence table SEQ ID NO:3.
3. the test kit of detection swine dysentery according to claim 2 is characterized in that: said PCR reaction solution is 1 * PCR damping fluid, 3.0mM MgCl
2, 0.2mM dNTP, 0.4 μ M primer I, 0.4 μ M primer I I.
4. a PCR method that detects swine dysentery is characterized in that, comprises the steps:
(1) extracts sample DNA;
(2) sample DNA that extracts is carried out pcr amplification;
(3) reaction conditions:
92 ℃ of the first steps: 3 min, 1 circulation;
92 ℃ of second steps: 10 sec, 46 ℃: 30 sec, 72 ℃: 1min, 30 circulations;
72 ℃ of the 3rd steps: 7min;
4 ℃ of the 4th steps: preserve;
(4) result describes and judges:
1. quality control standard:
Positive control has the specific amplification band at the 470bp place;
Negative control does not have the specific amplification band;
2. the result judges:
Positive: as the specific amplification band to be arranged at the 470bp place;
Negative: no specific amplification band.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110330683 CN102373277B (en) | 2011-10-27 | 2011-10-27 | PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110330683 CN102373277B (en) | 2011-10-27 | 2011-10-27 | PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102373277A true CN102373277A (en) | 2012-03-14 |
| CN102373277B CN102373277B (en) | 2013-01-02 |
Family
ID=45792504
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110330683 Expired - Fee Related CN102373277B (en) | 2011-10-27 | 2011-10-27 | PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102373277B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1616681A (en) * | 2002-12-12 | 2005-05-18 | 山东澳兰生物工程研究院 | Diagnostic gene chip for pig infectious diarrhea and its use |
| CN101175856A (en) * | 2005-05-12 | 2008-05-07 | 诺瓦提斯公司 | Novel genes and proteins of brachyspira hyodysenteriae and use of same for diagnosis and therapy |
| CN101228276A (en) * | 2005-06-23 | 2008-07-23 | 诺瓦提斯公司 | Novel genes and proteins of brachyspira pilosicoli and use of same for diagnosis and therapy |
-
2011
- 2011-10-27 CN CN 201110330683 patent/CN102373277B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1616681A (en) * | 2002-12-12 | 2005-05-18 | 山东澳兰生物工程研究院 | Diagnostic gene chip for pig infectious diarrhea and its use |
| CN101175856A (en) * | 2005-05-12 | 2008-05-07 | 诺瓦提斯公司 | Novel genes and proteins of brachyspira hyodysenteriae and use of same for diagnosis and therapy |
| CN101228276A (en) * | 2005-06-23 | 2008-07-23 | 诺瓦提斯公司 | Novel genes and proteins of brachyspira pilosicoli and use of same for diagnosis and therapy |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102373277B (en) | 2013-01-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104862406B (en) | A kind of primer for field quick detection mycobacterium tuberculosis complex and probe and its kit | |
| CN103773895B (en) | Multiple fluorescence PCR (polymerase chain reaction) kit capable of detecting five DNA (deoxyribonucleic acid) viruses of aquatic animal simultaneously | |
| CN105018628B (en) | Differentiate the kit of brucella A19 vaccine strains and street strain | |
| CN101144775B (en) | Bacteria real-time fluorescence quantitative polymerase chain reaction detection reagent kit | |
| CN103498000A (en) | Primer group, kit and method for detecting rice quarantine pathogenic bacteria by multiplex PCR (polymerase chain reaction) method | |
| CN101974651B (en) | Fluorescence quantitative polymerase chain reaction (PCR) detection method and detection kit for phytophthora capsici leonian | |
| CN102191321A (en) | Detection kit for ureaplasma urealyticum (UU) nucleic acid by utilizing RNA constant-temperature amplification | |
| CN101481742B (en) | Detection kit for Mycoplasma hyopneumoniae and use thereof | |
| CN101492741A (en) | Method for quantitative detection of mycoplasma hyopneumoniae | |
| CN102337342A (en) | Kit for diagnosing and identifying species of babesia bovis and preparation method thereof | |
| CN103045721B (en) | The fluorescence quantitative detecting method of ureaplasma urealyticum and ureaplasma parvum | |
| CN103146846A (en) | Single standard product-based four-color fluorogenic quantitative PCR (Polymerase Chain Reaction) method and kit | |
| CN113249517A (en) | Primer, probe and kit for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of bovine plague | |
| KR20120045917A (en) | Specific primers for rapid detection of bakanae disease pathogen(fusarium fujikuroi) and method for detection using the same | |
| CN103160587A (en) | Genetic typing chip of 10 common pathogenic legionella and detection kit | |
| CN102676678B (en) | PCR (Polymerase Chain Reaction) primer group for distinguishing five types of shellfish bait microalgae | |
| CN102373277B (en) | PCR (Polymerase Chain Reaction) kit and primers for detecting swine dysentery | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN102002523A (en) | Method and detection kit for detecting aeromonas sobria scaleless fish pathogenic bacteria | |
| CN106103714A (en) | In vivo infection microorganism, parasitic microbe, the noncoding RNA of symbiotic microorganism and qualification thereof and application | |
| CN110295240B (en) | Specific primers for multiple serotypes of enterobacter cloacae and multiplex PCR detection method | |
| CN113416797A (en) | Fluorescent quantitative PCR detection kit for simultaneously detecting 7 types of adenoviruses | |
| CN104313163A (en) | Method and kit for triple PCR detection of porcine infectious actinobacillus pleuropneumonia serum types 2, 3 and 6 and application of porcine infectious actinobacillus pleuropneumonia serum types 2, 3 and 6 | |
| CN111172306A (en) | Composition and kit for detecting mycobacterium tuberculosis and/or brucella and application of composition and kit | |
| CN102154466B (en) | Nucleotides with specificity to internal transcribed spacer(ITS) of neisseria meningitidis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130102 Termination date: 20201027 |