CN102373211A - Set of trypsin nucleic acid aptamers, preparation method thereof, and application thereof - Google Patents
Set of trypsin nucleic acid aptamers, preparation method thereof, and application thereof Download PDFInfo
- Publication number
- CN102373211A CN102373211A CN2010102541193A CN201010254119A CN102373211A CN 102373211 A CN102373211 A CN 102373211A CN 2010102541193 A CN2010102541193 A CN 2010102541193A CN 201010254119 A CN201010254119 A CN 201010254119A CN 102373211 A CN102373211 A CN 102373211A
- Authority
- CN
- China
- Prior art keywords
- seq
- nucleotide sequence
- nucleic acid
- trypsinase
- described nucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention belongs to the technical field of biology; provides a set of trypsin nucleic acid aptamers, a preparation method thereof, and an application thereof; and provides a trypsin reactor and a preparation method thereof. The invention aims at a defect in existing technologies of the vacancy of trypsin nucleic acid aptamer, and provides a set of trypsin nucleic acid aptamers. The nucleotide sequences of the trypsin nucleic acid aptamers are selected from SEQ ID No. 1 to SEQ ID No. 25 in the sequence list. According to the invention, with a combination of a SELEX technology and surface-modified magnetic beads, an original random oligonucleotide library is screened, amplified, and sequenced, such that the set of trypsin nucleic acid aptamers is obtained. The set of trypsin nucleic acid aptamers can be used for detecting, separating, purifying and immobilizing trypsin, and for preparing a biosensor. The set of trypsin nucleic acid aptamers can be used for analyzing and detecting a target substance, and can be used for preparing clinical diagnosing agents and medicines used for treating diseases. The set of trypsin nucleic acid aptamers can also be used for preparing the trypsin reactor. The molecular weights of the nucleic acid aptamers are low, the nucleic acid aptamers can be synthesized chemically, and the cost of the nucleic acid aptamers is low. The nucleic acid aptamers are advantaged in high compatibility and specificity, easy marking, good repeatability, good stability, and easy storage.
Description
Technical field
The present invention relates to one group of trypsinase nucleic acid aptamer; Specially refer to the SELEX technology of utilizing in the Protocols in Molecular Biology; It is phyletic evolution index concentration technology; Prepare one group and have the nucleic acid aptamer and the application thereof of high specific and high-affinity, belong to biological technical field with trypsinase.
Background technology
Trypsinase is a kind of proteolytic enzyme commonly used, has the strong characteristics of restriction enzyme site specificity, and it can cut off the carboxyl side in Methionin in the polypeptied chain and the arginine residues.It not only plays digestive ferment, and can also limit the precursor of other enzymes such as decomposing chymotrypsinogen, proearboxypeptidase, phosphatide proenzyme, plays activation.Trypsinase is the stronger proteolytic enzyme of specificity, has become a kind of indispensable instrument of protein amino acid sequence of measuring.Based on above tryptic characteristic, in the research of proteomics, trypsinase receives increasing attention, and has been widely used.
The SELEX technology, promptly phyletic evolution index concentration technology is a kind of new combinatorial chemistry technique of the nineties in last century by people such as Tuerk and Ellington invention.It utilizes Protocols in Molecular Biology, makes up the random oligonucleotide library of synthetic, and wherein generally about 20～40nt, generally about 20nt, the library capacity is greatly about 10 for the two ends primer sequence for stochastic sequence length
14～10
15In the scope.Because single stranded oligonucleotide stochastic sequence; Especially the RNA sequence forms secondary structures such as bulge loop, hair fastener, false joint, the G-tetramer easily; So can with protein, peptide section, medicine, amino acid, organic chemistry material, or even metals ion combines, and forms the complex body with very strong bonding force.
The SELEX technology has economy, characteristics such as easy, quick.Compare with other combinatorial chemical libraries such as random peptide library, antibody library and phage display library; The nucleic acid aptamer that from the oligonucleotide random library, filters out has a lot of advantages: the molecular weight of (1) oligonucleotide own is less; Be easy to synthesize, be convenient to follow-up test; (2) some nucleic acid aptamer has affinity and the specificity that is better than antibody, non-immunogenicity; (3) chemical structure of Nucleotide and character provide the characteristic that is easy to mark; (4) good stability is easy to storage and transport, and is insensitive to high temperature and intense environment.Therefore, oligonucleotide aptamer is in the preparation of biological inductor, the analyzing and testing of target substance, and all has a good application prospect in clinical diagnosis and the disease treatment.
At present, still do not have about with trypsinase have high specific and high-affinity nucleic acid aptamer and its production and application research report.
Summary of the invention
The objective of the invention is to overcome deficiency of the prior art, one group of trypsinase nucleic acid aptamer is provided, said nucleic acid aptamer and trypsinase have high specific and high-affinity.
Second purpose of the present invention provides the preparation method of one group of trypsinase nucleic acid aptamer; Said method is utilized the SELEX technology in the Protocols in Molecular Biology; Be that phyletic evolution index concentration technology is means; The use of the paramagnetism magnetic bead that mating surface is modified is screened, is increased and check order tryptic nucleic acid aptamer, the final one group of nucleic acid aptamer that obtains to have with trypsinase high specific and high-affinity.
The 3rd purpose of the present invention provides the application of one group of trypsinase nucleic acid aptamer; Said nucleic acid aptamer combines with trypsinase; Have high specific and high-affinity with the trypsinase that combines; Can be used for to trypsinase detect, separation, purifying and immobilization, be applied to the preparation of biological inductor, the analyzing and testing of target substance, and preparation is used for the reagent of clinical diagnosis and the medicine of disease treatment.
The 4th purpose of the present invention provides a kind of trypsinase reactor drum and preparation method thereof, and said trypsinase reactor drum serves as that the basis prepares with one of described one group of trypsinase nucleic acid aptamer.
One group of trypsinase nucleic acid aptamer of the present invention has very strong suitability, economy in the research of proteomics new technologies gordian technique and in using.
Technical scheme of the present invention is following:
One group of trypsinase nucleic acid aptamer; The nucleotide sequence of said trypsinase nucleic acid aptamer is selected from represented sequence identifier 1～25 described nucleotide sequence of numeric identifier < 210>in the nucleotides sequence tabulation, i.e. SEQ IDNo.1～SEQ ID No.25 in the nucleotides sequence tabulation.
The described nucleotide sequence of said SEQ ID No.1 has following structure:
The described nucleotide sequence of said SEQ ID No.2 has following structure:
The described nucleotide sequence of said SEQ ID No.3 has following structure:
The described nucleotide sequence of said SEQ ID No.4 has following structure:
The described nucleotide sequence of said SEQ ID No.5 has following structure:
The described nucleotide sequence of said SEQ ID No.6 has following structure:
The described nucleotide sequence of said SEQ ID No.7 has following structure:
The described nucleotide sequence of said SEQ ID No.8 has following structure:
The described nucleotide sequence of said SEQ ID No.9 has following structure:
The described nucleotide sequence of said SEQ ID No.10 has following structure:
The described nucleotide sequence of said SEQ ID No.11 has following structure:
The described nucleotide sequence of said SEQ ID No.12 has following structure:
The described nucleotide sequence of said SEQ ID No.13 has following structure:
The described nucleotide sequence of said SEQ ID No.14 has following structure:
The described nucleotide sequence of said SEQ ID No.15 has following structure:
The described nucleotide sequence of said SEQ ID No.16 has following structure:
The described nucleotide sequence of said SEQ ID No.17 has following structure:
The described nucleotide sequence of said SEQ ID No.18 has following structure:
The described nucleotide sequence of said SEQ ID No.19 has following structure:
The described nucleotide sequence of said SEQ ID No.20 has following structure:
The described nucleotide sequence of said SEQ ID No.21 has following structure:
The described nucleotide sequence of said SEQ ID No.22 has following structure:
The described nucleotide sequence of said SEQ ID No.23 has following structure:
The described nucleotide sequence of said SEQ ID No.24 has following structure:
The described nucleotide sequence of said SEQ ID No.25 has following structure:
Said SEQ ID No.1～described nucleotide sequence structure of SEQ ID No.25 is to classify the basis as with SEQ ID No.1～described nucleotides sequence of SEQ IDNo.25; Generate through the online software of Internet-tool Mfold, said software network address is: http://frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/dna-forml.cgi.
Said nucleic acid aptamer is that one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 sequence identity is more than 60% in tabulating with nucleotides sequence, and has the nucleotide sequence of identical function.
Said nucleic acid aptamer is to hybridize with one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 in the nucleotides sequence tabulation, and has the oligonucleotide sequence of identical function.
Said nucleic acid aptamer is the RNA sequence that one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 is transcribed in the nucleotides sequence tabulation.
Said nucleic acid aptamer is that the A that is no less than a position or T or C or the G of one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 in the nucleotides sequence tabulation is by rare base methylate purine or dihydrouracil or the resulting nucleotide sequence with identical function of xanthoglobulin displacement.
Said nucleic acid aptamer is any position deletion of one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 in the nucleotides sequence tabulation or increases the resulting nucleotide sequence with identical function of part oligonucleotide residue.
Said nucleic acid aptamer is that the position that is no less than of one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 is carried out phosphorylation or methylated or amination or sulfhydrylation or isotropic substanceization or combine vitamin H or combine digoxin or combined with fluorescent material or combining nano luminescent material or enzyme labelling are modified resulting nucleotide sequence with identical function in the nucleotides sequence tabulation.
A kind of trypsinase nucleic acid aptamer preparation method may further comprise the steps:
(1) as the preparation of ssDNA (single stranded DNA) of screening: use the downstream primer of upstream primer and biotin modification that pcr amplification is carried out in original random oligonucleotide storehouse; Product after the amplification is through agarose gel electrophoresis purifying and recovery; The product that obtains reclaiming has the paramagnetism magnetic bead reaction that Streptavidin is modified with product that reclaims and surface, utilizes alkaline denaturation again; Magneticseparation is removed magnetic bead; Obtain ssDNA solution, after said ssDNA solution is neutralized with acid, obtain ssDNA random library as screening;
(2) ssDNA of pcr amplification and trypsinase specific combination gets into the next round screening afterwards;
(3) be no less than 10 and take turns the round-robin screening, obtain the PCR product of purpose nucleic acid aptamer amplification back high copy number; Wherein, whenever take turns round-robin and screen, carry out 1 anti-screening at a distance from 3; Promptly utilize not combine tryptic immobilized matrix to be target, carry out the screening of ssDNA, and remove the immobilized matrix after the anti-screening; Like this, just be excluded with the non-purpose ssDNA of immobilized substrate specificity bonded;
(4) with last take turns ssDNA that screening obtains through the product cloning of pcr amplification to bacterial strain, under appropriate condition, cultivate, obtain choosing bacterium, order-checking behind the bacterium colony, obtain the nucleotide sequence of one group of trypsinase nucleic acid aptamer of the present invention.
The application of one group of trypsinase nucleic acid aptamer; Said nucleic acid aptamer can be used for to trypsinase detect, separation, purifying and immobilization; Be applied to the preparation of biological inductor, the analyzing and testing of target substance, and preparation is used for the reagent of clinical diagnosis and the medicine of disease treatment; Particularly be applied to enzyme reactor and prepare tryptic immobilization in the process, and the research and the application of the trypsinase reactor drum after the immobilization.。
A kind of trypsinase reactor drum, said trypsinase reactor drum are that the trypsinase nucleic acid aptamer of one of SEQ ID No.1～said nucleotide sequence of SEQ IDNo.25 in tabulating with nucleotides sequence is that the basis prepares.
A kind of preparation method of trypsinase reactor drum is characterized in that: said preparation method may further comprise the steps:
(1) silica gel particle and the LUTARALDEHYDE of surface amino groups modification react; The trypsinase nucleic acid aptamer that then adds one of SEQ ID No.1～said nucleotide sequence of SEQ ID No.25 in the amido modified nucleotides sequence tabulation of 5 ' end; Continue magnetic agitation, finally obtain the silica gel particle that surface grafting has the amido modified trypsinase nucleic acid aptamer of said 5 ' end;
(2) use dynamic vortex mixer that said silica gel particle is filled in the polyetheretherketone chromatogram microtrabeculae;
(3) fill solid after; With the said polyetheretherketone chromatogram of Tris-HCl damping fluid balance microtrabeculae system; Then trypsinase is dissolved in the Tris-HCl damping fluid; With moving phase mode sample introduction, make flow through said polyetheretherketone chromatogram microtrabeculae and carry out dynamic immobilization of trypsinase, obtain the trypsinase reactor drum;
(4) the trypsinase reactor drum for preparing carries out the enzyme digestion reaction of protein-based sample as the online enzymolysis reactor of protein-based sample, is used for the research of protein and proteomics;
(5) after said enzyme digestion reaction finishes; Use acetonitrile solution to wash as moving phase, the trypsinase wash-out in can immobilizedly tabulating to nucleotides sequence on the trypsinase nucleic acid aptamer of one of SEQ ID No.1～said nucleotide sequence of SEQ ID No.25, the trypsin solution behind the wash-out place≤preserve under-20 ℃ of conditions; Before reusing it is thawed; Repeating said steps (3) is immobilized again with it, and the trypsinase reactor drum gets final product restore funcitons, reach recycle, reproducible purpose.
Wherein, the described acetonitrile solution of step (5) is preferably 60% acetonitrile solution; The preservation condition of the trypsin solution behind the said wash-out is preferably-20 ℃.
Beneficial effect
1. the technology of the present invention's employing can be screened the nucleic acid aptamer that has high specific and high-affinity with trypsinase in high-throughput ground;
2, nucleic acid aptamer has some advantages that antibody does not possess, like in-vitro screening, synthesize, be easy to modify and characteristics such as stable height;
What 3, filter out has the nucleic acid aptamer of high specific and high-affinity with trypsinase, can specific combination trypsinase, become the immobilized immobilized subsidiary material of trypsinase.
Description of drawings
Fig. 1 is among the preparation method of a kind of trypsinase nucleic acid aptamer involved in the present invention, and the 1st～9 takes turns the electrophorogram that product that the ssDNA that obtains after the SELEX screening obtains through PCR obtains behind 3% agarose gel electrophoresis.
Fig. 2 is among the preparation method of a kind of trypsinase nucleic acid aptamer involved in the present invention, and the 10th takes turns the electrophorogram that product that the ssDNA that obtains after the SELEX screening obtains after through pcr amplification obtains behind 3% agarose gel electrophoresis.
Fig. 3 is among the preparation method of a kind of trypsinase nucleic acid aptamer involved in the present invention, and the 1st～10 takes turns the variation diagram that ssDNA that SELEX filters out and trypsinase bonding force are measured.
Fig. 4 is among the preparation method of a kind of trypsinase nucleic acid aptamer involved in the present invention; The 10th take turns SELEX screening the PCR product after pEASY-T1 clone test kit is cloned into the Tran1-T1 carrier, the bacterial plaque growing state after cultivating 12 hours on the LB solid medium that contains kantlex.
Embodiment
In order to prove absolutely the mode of characteristic of the present invention and embodiment of the present invention, provide embodiment below.
A kind of trypsinase nucleic acid aptamer is characterized in that having one of SEQ ID No.1 in the sequence table～described nucleotide sequence of SEQ ID No.25.
The described nucleotide sequence of SEQ ID No.1:
cccaagcttg?ggtatgagag?aagtgagatc?aaaatggagc?cggatatggt?tggtggcgaa 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.2:
cccaagcttg?ggtatgagag?gagcagaacc?tggggacgga?ccagatggtt?agagcatggt 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.3:
cccaagcttg?ggtatgagag?gcgacatgcg?gccggggctg?ggtggaagtg?tcgagttctg 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.4:
cccaagcttg?ggtatgagag?tagacgtaag?gaacccttgt?acaataacag?acgagccgtc 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.5:
cccaagcttg?ggtatgagag?accatgatgt?tgagaggtcg?aatggctgct?aagcggcgag 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.6:
cccaagcttg?ggtatgagag?gcggcggctc?agtagaagta?tggagggcaa?gaatataaga 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.7:
cccaagcttg?ggtatgagag?ggaaattaca?ggctcgtcga?attttaatgt?gttgtccggg 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.8:
cccaagcttg?ggtatgagag?agcaccgggt?cgaaaatggt?gtgctcctag?tagggaggag 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.9:
cccaagcttg?ggtatgagag?gttggttgtt?aggtagttcg?aattagctcc?cgcaaggggg 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.10:
cccaagcttg?ggtatgagag?ggggaggtgg?gcaaacattg?cttgagcggt?atcccgggta 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.11:
cccaagcttg?ggtatgagag?gggtggctgg?tccagggtat?gtggttcggg?tgacggagag 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.12:
cccaagcttg?ggtatgagag?gccctacttc?gagaaagatc?ggctagtggg?cggcgtacac 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.13:
cccaagcttg?ggtatgagag?gtacatgatt?gtgttacgga?acacatgtta?aatgacctga 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.14:
cccaagcttg?ggtatgagag?cacacggcgg?aaagggctgc?cgtaacgtgg?gcgctatgtg 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.15:
cccaagcttg?ggtatgagag?tgtgcccaga?acgagattgg?ggggaacacg?cataccagac 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.16:
cccaagcttg?ggtatgagag?gtggcgcttt?tagtactatc?aacttacgcc?gtgttaaaag 60
aagttatcgc?ggatccgcg 79
The described nucleotide sequence of SEQ ID No.17:
cccaagcttg?ggtatgagag?tgggagatgc?acgtacgggc?catctggcgt?gtgtaggagg 60
aagttatcgc?ggatccgcg 79
The described nucleotide sequence of SEQ ID No.18:
cccaagcttg?ggtatgagag?caggtggatc?gtacaagtag?tggatttgag?gccgttagaa 60
gttatcgcgg?atccgcg 77
The described nucleotide sequence of SEQ ID No.19:
cccaagcttg?ggtatgagag?cggggtgggc?ttgctgattg?ctctcggcga?agtcgcgagg 60
aagttatcgc?ggatccgcg 79
The described nucleotide sequence of SEQ ID No.20:
cccaagcttg?ggtatgagag?gattgatgtt?ttcctgaggg?caaagtacct?gggcctgacg 60
aagttatcgc?ggatccgcg 79
The described nucleotide sequence of SEQ ID No.21:
cccaagcttg?ggtatgagag?ccccgtaccc?tgtagcgaat?aggcattgga?atgccgacag 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.22:
cccaagcttg?ggtatgagag?aacgaattct?agcttcttat?tggctctttg?gcgcgttgag 60
aagttatcgc?ggatccgcg 79
The described nucleotide sequence of SEQ ID No.23:
cccaagcttg?ggtatgagag?gacagccaca?tgtactgagg?tagacttggg?tgggggacag 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.24:
cccaagcttg?ggtatgagag?cataaaccgg?gcggcctggc?tgctccattg?cactggctcg 60
gaagttatcg?cggatccgcg 80
The described nucleotide sequence of SEQ ID No.25:
cccaagcttg?ggtatgagag?gtacttaatt?tgaggtgacg?ggcacgtgaa?acaggcgagg 60
aagttatcgc?ggatccgcg 79
A kind of preparation method of trypsinase nucleic acid aptamer may further comprise the steps:
(1) at first the amplification of full storehouse is carried out in original random oligonucleotide storehouse,, be convenient to the carrying out of screening to increase its copy number.Downstream primer with upstream primer and biotin modification carries out pcr amplification to original random oligonucleotide storehouse, uses and purchases the test kit in the PCR of Promega company.Reaction system is following:
Upstream primer 100pmol (5 ' CCCAAGCTTGGGTATGAGAG 3 ')
Downstream primer 100pmol (5 '-biotin-C6-CGCGGATCCGCGATAACTTC 3 ')
GAAGTTATCGCGGATCCGCG?3’)
Wherein, said downstream primer is the downstream primer of biotin modification.
The PCR reaction conditions is: 94 ℃ of preparatory sex change 5 minutes, and thermal cycling totally 20 times, thermal cycle conditions is 94 ℃ of sex change 1 minute, 55 ℃ of renaturation 50 seconds, 72 ℃ were extended 50 seconds, and last 72 ℃ were extended 10 minutes.
Obtain the product of pcr amplification, said product is carried out 3% agarose gel electrophoresis, target stripe is carried out glue reclaim, to remove polysaccharase and unreacted primer.Use Eppendorf BioPhotometer Plus that the DNA that reclaims is carried out quantitatively, and according to the amount decision table mask of DNA the paramagnetism magnetic bead add-on of Streptavidin modification is arranged, the mol ratio of said DNA and magnetic bead is 1: 3.After DNA and magnetic bead hatched 30 minutes; With PBS-T buffer solution for cleaning magnetic bead 2 times, the NaOH with 200 μ L100mM makes dsDNA (double-stranded DNA) sex change, magneticseparation then; Remove magnetic bead; Obtain ssDNA solution, after said ssDNA solution is neutralized with acid, obtain ssDNA random library as screening.
(2) magnetic bead of tosyl group modification is purchased the Si Er one-tenth company in Beijing; The working instructions of pressing magnetic bead with trypsinase with the covalent attachment form fix on the magnetic bead that said tosyl group is modified; Obtain the magnetic bead that the tryptic tosyl group of covalent attachment is modified, the magnetic bead of modifying with the tryptic tosyl group of said covalent attachment is that target carries out the 1st of trypsinase nucleic acid aptamer and takes turns the SELEX screening: the magnetic bead that the tryptic tosyl group of said covalent attachment is modified with under 37 ℃, hatched 2 hours as the ssDNA random library that screens described in the step (1), carry out magneticseparation afterwards; And with PBS buffer solution for cleaning magnetic bead 2 times; Add 100 μ L PBS damping fluids, in 94 ℃ of water-baths, left standstill 10 minutes, capable afterwards magneticseparation magnetic bead; Obtain the PBS solution that 100 μ L contain ssDNA; With the PBS solution of the said ssDNA of containing is template, carries out PCR with the downstream primer of upstream primer (5 ' CCCAAGCTTGGGTATGAGAG 3 ') and biotin modification (5 '-biotin-C6-CGCGGATCCGCGATAACTTC 3 '), and carries out electrophoresis detection; Obtaining cutting glue after the target stripe of 80bp reclaims; Carry out the preparation of ssDNA once more, in the same step of the preparation method of said ssDNA (1) target stripe is carried out glue and reclaim working method afterwards, obtain the 1st and take turns the ssDNA library that SELEX filters out; Taking turns ssDNA library that SELEX filters out with the said the 1st is that template is carried out the 2nd and taken turns the SELEX screening.
(3) each takes turns SELEX screening all according to the 1st taking turns the SELEX method for screening and carry out in the said step (2) afterwards; Different is the carrying out along with screening; The consumption of primer and times of thermal cycle reduce gradually among the PCR, and concrete is: the 1st take turns～the 3rd take turns primer consumption 100pmol, thermal cycling 25 times; The 4th take turns～the 7th take turns primer consumption 80pmol, thermal cycling 20 times; The 8th take turns～the 10th take turns primer consumption 60pmol, thermal cycling 15 times.Wherein, Whenever take turns SELEX at a distance from 3 and screen, carry out 1 anti-screening, promptly use fixing tryptic tosyl group magnetic bead to be target; Hatch with the ssDNA library that previous round SELEX screening obtains; Magneticseparation is removed magnetic bead after 2 hours, so just can avoid the influence of magnetic bead to screening with removing with magnetic bead specificity bonded ssDNA.As shown in Figure 1, ladder (molecular weight ladder) is 10bp, the left side be negative control; The ladder right side from left to right be the 1st to take turns to the 9th PCR product of taking turns successively; The band of all PCR products all is presented at the 80bp place, and the negative control band concentrates on the 20bp place, is the index strip of primer.
Through the screening of 10 SELEX that take turns, with per 1 take turns the ssDNA for preparing with etc. the trypsinase of molar mass carry out enzyme-linked immunosorbent assay, each is taken turns ssDNA tryptic binding capacity and binding ability is characterized.As shown in Figure 3; The left side ordinate zou is represented absorbancy (absorbency) among Fig. 3; X-coordinate 1～10 represent respectively the 1st～10 take turns SELEX the ssDNA for preparing of screening with etc. the trypsinase of molar mass carry out the sample behind the enzyme-linked immunosorbent assay, X-coordinate 11 and 12 is the blank sample.Can see that through 10 screenings taken turns, the bonding force of trypsinase and ssDNA no longer raises, the state that reaches capacity is so after the 10th takes turns screening, stop the SELEX screening.
(4) obtain the 10th take turns the ssDNA that SELEX filters out after; Take turns the ssDNA that SELEX filters out to the said the 10th and carry out pcr amplification; The primer that uses is literalness upstream primer (5 ' CCCAAGCTTGGGTATGAGAG 3 ') 50pmol and literalness downstream primer (5 ' CGCGGATCCGCGATAACTTC 3 ') 50pmol, and times of thermal cycle is 15 times, and amplification finishes rear electrophoresis and detects; The result is as shown in Figure 2; The ladder both sides of 10bp be the 10th take turns pcr amplification product, the band of all products all is presented at the 80bp place, the product band is limpid in sight.Use pEASY-T1 clone test kit with the 10th take turns ssDNA that SELEX filters out through the product cloning of pcr amplification to the Tran1-T1 competent cell, after heat shock, hatching, uniformly it is coated on the LB solid medium that contains kantlex; Cultivated 12 hours for 37 ℃, strain growth goes out, and is as shown in Figure 4; The bacterial strain bacterium colony round spot shape that is white in color, clear obviously, select single bacterium colony wherein; Place the LB liquid nutrient medium; Cultivated 4 hours for 37 ℃, check order then, finally obtain the nucleotide sequence of one group of trypsinase nucleic acid aptamer of the present invention; Said nucleotides sequence is classified one of SEQ ID No.1 in the nucleotide sequence table～said nucleotide sequence of SEQ ID No.25 as, and said nucleic acid aptamer and Trypsin have high specific and high-affinity.
The random nucleotide library that is used for the SELEX screening in the present embodiment is synthetic by TaKaRa company; Primer sequence is synthetic by Invitrogen company; 40 bases are arranged for producing at random in the wherein original random nucleotide library; Sequence is: 5 ' CCCAAGCTTGGGTATGAGAG-40N-GAAGTTATCGCGGATCCGCG 3 ', storage capacity are 1015, and the upstream primer sequence is: 5 ' CCCAAGCTTGGGTATGAGAG 3 '; The downstream primer sequence is: 5 ' CGCGGATCCGCGATAACTTC 3 '; The downstream primer sequence of biotin modification is: the magnetic bead that 5 '-biotin-C6-CGCGGATCCGCGATAACTTC 3 ', tosyl group modify purchases in Beijing with the magnetic bead of Streptavidin modification that Si Er becomes company, and the PCR test kit is purchased the company in Promega; Tran1-T1 carrier and pEASY-T1 clone test kit is purchased the full formula King Company in Beijing, and trypsinase is purchased the company in Sigma.
The preparation and the application of the trypsinase reactor drum that is the basis with the trypsinase nucleic acid aptamer of one of SEQ ID No.1～said nucleotide sequence of SEQ ID No.25 in the nucleotides sequence tabulation.
Silica gel particle, LUTARALDEHYDE and polyetheretherketone (PEEKsil) the chromatogram microtrabeculaes that the trypsinase nucleic acid aptamer that obtains among the embodiment 2 (SEQ ID No.1 in the nucleotides sequence tabulation), surface amino groups are modified etc. are as experiment material; Trypsinase carry out dynamic fixingization, and step is following:
(1) takes by weighing the silica gel particle that the 40mg surface amino groups is modified, continue magnetic agitation reaction 2 hours with LUTARALDEHYDE under the room temperature, use NaCO after the reaction
3/ NaHCO
3(20mM, pH=9.2) buffer solution for cleaning is 3 times, cleans 3 times with tri-distilled water again, adds the amido modified trypsinase nucleic acid aptamer of 5 ' end (SEQ ID No.1 in the nucleotides sequence tabulation) afterwards, continues the magnetic agitation reaction after 3 hours, uses NaCO
3/ NaHCO
3Buffer solution for cleaning 3 times, tri-distilled water clean 3 times, finally obtain the silica gel particle that surface grafting has the amido modified trypsinase nucleic acid aptamer of said 5 ' end;
(2) said silica gel particle is encased in the magnetic agitation chamber of dynamic vortex mixer; End erection column front filter with polyetheretherketone chromatogram microtrabeculae; The front filter hole diameter of sieve (perforated) plate is 2 μ m, to prevent the loss of filler particles, the other end of polyetheretherketone chromatogram microtrabeculae is received on the four-way valve of dynamic vortex mixer; Magnetic stirring apparatus in the dynamic vortex mixer is linked to each other with the miniflow pump, prepare to fill;
(3) at first use 0.1mL min
-1The pure acetonitrile of the chromatographic grade of flow velocity is filled the magnetic agitation chamber 5 minutes of dynamic vortex mixer.Flow velocity with said acetonitrile is adjusted to 0.01mL min afterwards
-1There is acetonitrile to flow out up to polyetheretherketone chromatogram microtrabeculae end; The switch of opening magnetic stirring apparatus begins to load polyetheretherketone chromatogram microtrabeculae, closes pump, and pressure after reducing to zero unloads polyetheretherketone chromatogram microtrabeculae; And at the other end erection column front filter of polyetheretherketone chromatogram microtrabeculae, the polyetheretherketone chromatogram microtrabeculae that obtains preparing; The polyetheretherketone chromatogram microtrabeculae for preparing is received in the miniflow liquid phase systems, used 0.1mL min
-1The tri-distilled water flushing balance of flow velocity;
(4) after the balance, with 10mM Tris-HCl (pH=8.0) damping fluid balance polyetheretherketone chromatogram microtrabeculae system 30 minutes, flow velocity was set at 5 μ L min
-1Then trypsinase is dissolved in the said Tris-HCl damping fluid,, lets said the flow through polyetheretherketone chromatogram microtrabeculae and carry out dynamic fixingization of tryptic Tris-HCl damping fluid that contains in polyetheretherketone chromatogram microtrabeculae inside with moving phase mode sample introduction; Detect the Trypsin absorption peak in the 273nm wavelength; Immobilization process finishes after 30 minutes, continues with chromatographic grade pure acetonitrile flushing polyetheretherketone chromatogram microtrabeculae, balance 30 minutes; Obtain trypsinase polyetheretherketone reactor drum, i.e. trypsinase reactor drum after the immobilization;
(5) with the said trypsinase reactor drum for preparing, with 5 μ Lmin
-1Flow velocity enzymolysis 100 μ L 1mg mL respectively
-13 kinds of albumen of bovine serum albumin, myohaemoglobin, Lrax; And said 3 kinds of proteic mixtures, the sample after 1 hour behind the collection enzymolysis, lyophilize; With the laggard HPLC-ESI-Trap of chromatogram flow phase (aqueous solution that contains 0.1% formic acid) dissolving system, detect;
(6) through 3 kinds of albumen and 3 kinds of proteic mixtures behind the enzymolysis; Pass through mass spectrometric detection; 3 of enzymolysis kinds of proteic peptide section fraction of coverage are respectively respectively: bovine serum albumin 16%, myohaemoglobin 63%, Lrax 68%; Peptide section fraction of coverage is respectively behind 3 kinds of proteic mixture enzymolysis: bovine serum albumin 17%, myohaemoglobin 59%, Lrax 61%; Carried out parallel laboratory test in continuous three days, it is not obvious that the result differs, and explains that the trypsinase vigor in the polyetheretherketone chromatogram microtrabeculae keeps better;
Trypsinase wash-out, the trypsin solution behind the wash-out place-20 ℃ of preservations, and the trypsin solution that thaws before reusing utilizes the immobilized again trypsinase of dynamic fixing method, and it is active that little enzyme reactor can recover;
(7) after experiment finishes; Use 60% acetonitrile solution to wash as moving phase, can be with immobilized trypsinase wash-out to the said nucleic acid aptamer, the trypsin solution behind the wash-out places-20 ℃ of preservations; Before reusing it is thawed; Utilize the dynamic fixing method, promptly step (4) is immobilized again with it, and said trypsinase reactor drum gets final product restore funcitons;
(8) carry out three times with the enzymolysis device pair cell pigment C after recovering and repeated enzymolysis; Peptide section fraction of coverage is respectively 59%, 53%, 56%; Like this, utilize nucleic acid aptamer to be the little enzyme reactor of the immobilization on basis, reached the high-level efficiency of enzymolysis; And realized tryptic recovery and regeneration, practiced thrift experimental cost.
(8) carry out 3 times with the trypsinase reactor drum pair cell pigment C behind the said restore funcitons and repeated enzymolysis; Peptide section fraction of coverage is respectively 59%, 53%, 56%; Like this, utilize the trypsinase reactor drum of said trypsinase nucleic acid aptamer, reached the high-level efficiency of enzymolysis for the basis; And realized tryptic recovery and regeneration, practiced thrift experimental cost.
According to the invention have one group of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 in the nucleotides sequence tabulation totally 25 trypsinase nucleic acid aptamers are the mixtures that after SELEX screening 10 is taken turns, obtain; Obtain through transfection, clone, order-checking; What the SELEX technology referred to itself is exactly that index concentration is evolved; In the end one take turns promptly and the 10th take turns the product that obtains; No matter it is 25 or 250 even more; Its binding ability to part (trypsinase) is consistent with specificity, because the weak sequence with the specificity difference of binding ability is eliminated in screening process before, the meaning of index concentration just is that the avidity and the specificity of new round screening product have all obtained exponential other lifting than the avidity and the specificity of last round of product; Along with one take turns screening carrying out; The 10th take turns in the product what avidity no longer promoted, the avidity that said 25 each bars of trypsinase nucleic acid aptamer show is consistent with specificity, is at least on the same order of magnitude; So, in the tabulation of the nucleotides sequence that obtains among the embodiment 2 in described 25 the trypsinase nucleic acid aptamers of SEQ ID No.1～SEQ ID No.25 any one all representative.In the nucleotides sequence tabulation the described trypsinase nucleic acid aptamer of SEQ ID No.1 obtains though the data of embodiment 3 are just used; But the representativeness with science can prove that the described trypsinase nucleic acid aptamer of SEQ ID No.2～SEQ ID No.25 all has same function.
The present invention includes but be not limited to above embodiment, every any replacement or local improvement of being equal to of under spirit of the present invention and principle, carrying out all will be regarded as within protection scope of the present invention.
Claims (14)
1. one group of trypsinase nucleic acid aptamer, it is characterized in that: the nucleotide sequence of said nucleic acid aptamer is selected from the SEQ ID No.1～SEQ ID No.25 in the sequence table.
2. one group of trypsinase nucleic acid aptamer according to claim 1 is characterized in that: the described nucleotide sequence of said SEQ ID No.1 has following structure:
The described nucleotide sequence of said SEQ ID No.2 has following structure:
The described nucleotide sequence of said SEQ ID No.3 has following structure:
The described nucleotide sequence of said SEQ ID No.4 has following structure:
The described nucleotide sequence of said SEQ ID No.5 has following structure:
The described nucleotide sequence of said SEQ ID No.6 has following structure:
The described nucleotide sequence of said SEQ ID No.7 has following structure:
The described nucleotide sequence of said SEQ ID No.8 has following structure:
The described nucleotide sequence of said SEQ ID No.9 has following structure:
The described nucleotide sequence of said SEQ ID No.10 has following structure:
The described nucleotide sequence of said SEQ ID No.11 has following structure:
The described nucleotide sequence of said SEQ ID No.12 has following structure:
The described nucleotide sequence of said SEQ ID No.13 has following structure:
The described nucleotide sequence of said SEQ ID No.14 has following structure:
The described nucleotide sequence of said SEQ ID No.15 has following structure:
The described nucleotide sequence of said SEQ ID No.16 has following structure:
The described nucleotide sequence of said SEQ ID No.17 has following structure:
The described nucleotide sequence of said SEQ ID No.18 has following structure:
The described nucleotide sequence of said SEQ ID No.19 has following structure:
The described nucleotide sequence of said SEQ ID No.20 has following structure:
The described nucleotide sequence of said SEQ ID No.21 has following structure:
The described nucleotide sequence of said SEQ ID No.22 has following structure:
The described nucleotide sequence of said SEQ ID No.23 has following structure:
The described nucleotide sequence of said SEQ ID No.24 has following structure:
The described nucleotide sequence of said SEQ ID No.25 has following structure:
3. one group of trypsinase nucleic acid aptamer according to claim 1; It is characterized in that: said nucleic acid aptamer is that one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 sequence identity is more than 60% in tabulating with nucleotides sequence, and has the nucleotide sequence of identical function.
4. one group of trypsinase nucleic acid aptamer according to claim 1; It is characterized in that: said nucleic acid aptamer is to hybridize with one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 in the nucleotides sequence tabulation, and has the oligonucleotide sequence of identical function.
5. one group of trypsinase nucleic acid aptamer according to claim 1 is characterized in that: said nucleic acid aptamer is the RNA sequence that one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 is transcribed in the nucleotides sequence tabulation.
6. one group of trypsinase nucleic acid aptamer according to claim 1 is characterized in that: said nucleic acid aptamer is that the A that is no less than a position or T or C or the G of one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 in the nucleotides sequence tabulation is by rare base methylate purine or dihydrouracil or the resulting nucleotide sequence with identical function of xanthoglobulin displacement.
7. one group of trypsinase nucleic acid aptamer according to claim 1 is characterized in that: said nucleic acid aptamer is any position deletion of one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 in the nucleotides sequence tabulation or increases the resulting nucleotide sequence with identical function of part oligonucleotide residue.
8. one group of trypsinase nucleic acid aptamer according to claim 1 is characterized in that: said nucleic acid aptamer is that the position that is no less than of one of SEQ ID No.1～described nucleotide sequence of SEQ ID No.25 is carried out phosphorylation or methylated or amination or sulfhydrylation or isotropic substanceization or combine vitamin H or combine digoxin or combined with fluorescent material or combining nano luminescent material or enzyme labelling are modified resulting nucleotide sequence with identical function in the nucleotides sequence tabulation.
9. the preparation method of a trypsinase nucleic acid aptamer, it is characterized in that: said preparation method may further comprise the steps:
(1) as the preparation of ssDNA of screening: use the downstream primer of upstream primer and biotin modification that pcr amplification is carried out in original random oligonucleotide storehouse, the product after the amplification is through agarose gel electrophoresis purifying and recovery, the product that obtains reclaiming; Product that reclaims and surface had the paramagnetism magnetic bead reaction that Streptavidin is modified; Utilize alkaline denaturation again, magneticseparation is removed magnetic bead, obtains ssDNA solution; With said ssDNA solution with the acid neutralization after, obtain ssDNA random library as screening;
(2) ssDNA of pcr amplification and trypsinase specific combination gets into the next round screening afterwards;
(3) be no less than 10 and take turns the round-robin screening, obtain the PCR product of purpose nucleic acid aptamer amplification back high copy number; Wherein, whenever take turns round-robin and screen, carry out 1 anti-screening, promptly utilize not combine tryptic immobilized matrix to be target, carry out the screening of ssDNA, and remove the immobilized matrix after the anti-screening at a distance from 3;
(4) with last take turns ssDNA that screening obtains through the product cloning of pcr amplification to bacterial strain, under appropriate condition, cultivate, obtain choosing bacterium, order-checking behind the bacterium colony, obtain the nucleotide sequence of one group of trypsinase nucleic acid aptamer of the present invention.
10. according to the application of each described one group of trypsinase nucleic acid aptamer of claim 1～8; It is characterized in that: be used for to trypsinase detect, separation, purifying and immobilization; Be applied to the preparation of biological inductor, the analyzing and testing of target substance, and preparation is used for the reagent of clinical diagnosis and the medicine of disease treatment.
11. the application of one group of trypsinase nucleic acid aptamer according to claim 10 is characterized in that: said nucleic acid aptamer is used for tryptic immobilization, and the research and the application of the trypsinase reactor drum after the immobilization.
12. a trypsinase reactor drum is characterized in that: said trypsinase reactor drum is that the trypsinase nucleic acid aptamer of one of SEQ IDNo.1～said nucleotide sequence of SEQ ID No.25 in tabulating with nucleotides sequence is that the basis prepares.
13. the preparation method of a kind of trypsinase reactor drum according to claim 12 is characterized in that: said preparation method may further comprise the steps:
(1) silica gel particle and the LUTARALDEHYDE of surface amino groups modification react; The trypsinase nucleic acid aptamer that then adds one of SEQ ID No.1～said nucleotide sequence of SEQ ID No.25 in the amido modified nucleotides sequence tabulation of 5 ' end; Continue magnetic agitation, finally obtain the silica gel particle that surface grafting has the amido modified trypsinase nucleic acid aptamer of said 5 ' end;
(2) use dynamic vortex mixer that said silica gel particle is filled in the polyetheretherketone chromatogram microtrabeculae;
(3) fill solid after; With the said polyetheretherketone chromatogram of Tris-HCl damping fluid balance microtrabeculae system; Then trypsinase is dissolved in the Tris-HCl damping fluid; With moving phase mode sample introduction, make flow through said polyetheretherketone chromatogram microtrabeculae and carry out dynamic immobilization of trypsinase, obtain the trypsinase reactor drum;
(4) the trypsinase reactor drum for preparing carries out the enzyme digestion reaction of protein-based sample as the online enzymolysis reactor of protein-based sample, is used for the research of protein and proteomics;
(5) after said enzyme digestion reaction finishes; Use acetonitrile solution to wash as moving phase, the trypsinase wash-out in can immobilizedly tabulating to nucleotides sequence on the trypsinase nucleic acid aptamer of one of SEQ ID No.1～said nucleotide sequence of SEQ ID No.25, the trypsin solution behind the wash-out place≤preserve under-20 ℃ of conditions; Before reusing it is thawed; Repeating said steps (3) is immobilized again with it, and the trypsinase reactor drum gets final product restore funcitons, reach recycle, reproducible purpose.
14. the preparation method of a kind of trypsinase reactor drum according to claim 13 is characterized in that: the described acetonitrile solution of said step (5) is preferably 60% acetonitrile solution; The preservation condition of the trypsin solution behind the said wash-out is preferably-20 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102541193A CN102373211A (en) | 2010-08-16 | 2010-08-16 | Set of trypsin nucleic acid aptamers, preparation method thereof, and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102541193A CN102373211A (en) | 2010-08-16 | 2010-08-16 | Set of trypsin nucleic acid aptamers, preparation method thereof, and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102373211A true CN102373211A (en) | 2012-03-14 |
Family
ID=45792442
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102541193A Pending CN102373211A (en) | 2010-08-16 | 2010-08-16 | Set of trypsin nucleic acid aptamers, preparation method thereof, and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102373211A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104694543A (en) * | 2015-02-05 | 2015-06-10 | 北京理工大学 | Nucleic acid aptamer sequences capable of specifically recognizing deta-glucuronidase and application of nucleic acid aptamer sequences capable of specifically recognizing deta-glucuronidase |
| CN111778255A (en) * | 2020-05-29 | 2020-10-16 | 扬州大学 | Screening and identifying method of pepsin ssDNA aptamer |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101148666A (en) * | 2006-09-22 | 2008-03-26 | 国家纳米技术与工程研究院 | Nucleic acid aptamer with high specificity and high affinity to human breast carcinoma tissue, preparation method and application thereof |
| JP2008167688A (en) * | 2007-01-11 | 2008-07-24 | Ribomic Inc | Ribonucleic acid combined with mtg8 taf domain |
| CN101497882A (en) * | 2006-07-20 | 2009-08-05 | 武汉大学 | Anti- mycobacterium tuberculosis infection small molecule nucleotide DNA aptamer and preparation thereof |
-
2010
- 2010-08-16 CN CN2010102541193A patent/CN102373211A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101497882A (en) * | 2006-07-20 | 2009-08-05 | 武汉大学 | Anti- mycobacterium tuberculosis infection small molecule nucleotide DNA aptamer and preparation thereof |
| CN101148666A (en) * | 2006-09-22 | 2008-03-26 | 国家纳米技术与工程研究院 | Nucleic acid aptamer with high specificity and high affinity to human breast carcinoma tissue, preparation method and application thereof |
| JP2008167688A (en) * | 2007-01-11 | 2008-07-24 | Ribomic Inc | Ribonucleic acid combined with mtg8 taf domain |
Non-Patent Citations (3)
| Title |
|---|
| 《Advanced Drug Delivery Reviews》 20071231 Tetsuro et al Hepatitis C viral life cycle"，Tetsuro et al，Advanced Drug Delivery Reviews 第1203页左栏第3段 1-3,5-7 , * |
| KOTARO ET AL: "Isolation and characterization of RNA aptamers specific for the hepatitis C virus nonstructural protein 3 protease", 《EUR. J. BIOCHEM》 * |
| TETSURO ET AL: "Hepatitis C viral life cycle"，Tetsuro et al，Advanced Drug Delivery Reviews", 《ADVANCED DRUG DELIVERY REVIEWS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104694543A (en) * | 2015-02-05 | 2015-06-10 | 北京理工大学 | Nucleic acid aptamer sequences capable of specifically recognizing deta-glucuronidase and application of nucleic acid aptamer sequences capable of specifically recognizing deta-glucuronidase |
| CN111778255A (en) * | 2020-05-29 | 2020-10-16 | 扬州大学 | Screening and identifying method of pepsin ssDNA aptamer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9404919B2 (en) | Multiplexed analyses of test samples | |
| US7855054B2 (en) | Multiplexed analyses of test samples | |
| CA2693453C (en) | Multiplexed analyses of test samples | |
| Kim et al. | Advances in aptamer screening and small molecule aptasensors | |
| EP2859121B1 (en) | Aptamer-based multiplexed assays | |
| CN101538613B (en) | Molecular probe related to disease and method for producing the same | |
| CN101430334A (en) | Detection method for target substance based on aptamer and its solid phase biological inductor | |
| WO2011105071A1 (en) | Method for screening nucleic acid ligand | |
| CN102373211A (en) | Set of trypsin nucleic acid aptamers, preparation method thereof, and application thereof | |
| CN102373212A (en) | Chymotrypsin nucleic acid aptamers, preparation method and application thereof | |
| EP3814496B1 (en) | Sample preparation method and system | |
| CN115232865A (en) | Aptamer and CRISPR/Cas12a system based biosensor, composition, kit and application thereof | |
| AU2017202493B2 (en) | Multiplexed analyses of test samples | |
| WO2018038076A1 (en) | Cell scaffold material using e-cadherin-binding nucleic acid aptamer | |
| CN111676226B (en) | Hexavalent chromium aptamer, aptamer derivative and application thereof | |
| CN115838728B (en) | In vitro screening method for novel coronavirus full-length nucleocapsid protein DNA aptamer | |
| US20240093270A1 (en) | Generation and selection of affinity reagents | |
| AU2013203360B2 (en) | Multiplexed analyses of test samples | |
| CN117402881A (en) | DNA aptamer capable of specifically recognizing MMP-13 and application thereof | |
| CN116970611A (en) | Nucleic acid aptamer combined with monkey pox virus surface envelope protein and application thereof | |
| CN106636103A (en) | Insulin aptamer INS5 and preparation method thereof | |
| CN111961711A (en) | Universal hybridization enhancers and methods for targeted sequencing | |
| JP2005245254A (en) | Method for screening aptamer, and aptamer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20120314 |