CN102367454B - Transgenic animal and preparation method thereof - Google Patents
Transgenic animal and preparation method thereof Download PDFInfo
- Publication number
- CN102367454B CN102367454B CN201110306701.4A CN201110306701A CN102367454B CN 102367454 B CN102367454 B CN 102367454B CN 201110306701 A CN201110306701 A CN 201110306701A CN 102367454 B CN102367454 B CN 102367454B
- Authority
- CN
- China
- Prior art keywords
- cell
- nucleotide sequence
- carrier
- present
- attachment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a vector group for cell transformation, a transgenic cell preparation method, a non-human transgenic animal cell, a preparation method of the non-human transgenic animal cell, and a non-human transgenic animal or a descendant of the non-human transgenic animal. In enforcements of the invention, the vector group comprises first vectors containing adhesion subsequences and second vectors containing target nucleic acid sequences. Through the vector group for cell transformation, unmarked transgenic cells can be effectively constructed.
Description
Technical field
The present invention relates to biological technical field.Relate to transgenic animal and preparation method thereof particularly.Relate more specifically to one group of carrier being suitable for transformant, a kind of be suitable for transformant carrier, a kind ofly prepare the method for transgenic cell, a kind of non-human transgenic animal's cell, a kind ofly prepare the method for non-human transgenic animal, a kind of non-human transgenic animal or its offspring.
Background technology
The safety issue of transgenic animal is current of paramount importance social concerns, and the transgenic technology of safety is the important leverage of genetically modified organism kind safety.Foreign gene in genetically modified animals and plants mainly contains two large classes, i.e. goal gene and marker gene.Marker gene is the class foreign gene helping to carry out genetically modified organism engineering body screening and identification, and it comprises selectable marker gene and reporter gene.Under selective pressure, do not contain non-transformed cell and the tissue die of marker gene and product thereof, and transformant is owing to there being resistance, can continue survival, is thus conducive to selecting transformed clone from a large amount of non-transformed cells and tissue.When preparing transgenic animal, introduce the screening that marker gene mainly facilitates transgenic positive material.Transgenosis is once after success, selectable marker gene just no longer plays a role, and becomes potential danger on the contrary.The maximum dispute that selected marker causes is exactly transgene escape problem, and the gene between the nontarget organisms such as the marker gene namely imported and its wild relatives flows, thus likely destroys the whole ecosystem; Another one worry is the toxicity of selected marker's coded product, may affect the health of body; Finally, resistant maker gene and protokaryon sequence also can affect the expression of goal gene, likely cause the silence expressed.
But the current method preparing transgenic animal still haves much room for improvement.
Summary of the invention
The present invention is intended at least to solve one of technical problem existed in prior art.
According to a first aspect of the invention, the present invention proposes the carrier that a group is suitable for transformant.According to embodiments of the invention, one group of described carrier being suitable for transformant comprises: the first carrier, and described first carrier comprises attachment subsequence; And Second support, described Second support comprises object nucleotide sequence.Owing to comprising attachment subsequence and object nucleotide sequence in the first carrier and Second support respectively, thus adhere to subsequence and can promote that object nucleotide sequence is incorporated in the karyomit(e) of host cell, and simultaneously because attachment subsequence self can not be integrated with karyomit(e), can not containing attachment subsequence in the karyomit(e) of the host cell thus finally obtained, external object nucleotide sequence is only included in the genome of the transgenic cell thus finally obtained, and there is not attachment subsequence, can effectively build unmarked transgenic cell thus.
According to embodiments of the invention, above-mentioned one group of carrier being suitable for transformant can also have following additional technical feature:
According to one embodiment of present invention, described attachment sub-series of packets contains the nucleotide sequence of Encoded Chromosomes skeleton land and/or matrix attachment region.Thus, utilize this attachment subsequence, can effectively object nucleotide sequence be positioned in nucleus, and then effectively promote that the karyomit(e) of object nucleotide sequence and host cell is integrated.
According to one embodiment of present invention, described first carrier comprises the nucleotide sequence of coding replication origin further.According to concrete example of the present invention, preferred described replication origin is oriP.Thus, utilize replication origin, attachment subsequence can in host cell self-replicating, thus there is the probability integrated in the karyomit(e) improving object nucleotide sequence and host cell.
According to one embodiment of present invention, described first carrier comprises the nucleotide sequence of coding selection markers further.Thus, can effectively screen the host cell proceeding to the first carrier, improve the efficiency preparing transgenic cell.According to examples more of the present invention, described selection markers is be selected from the gene of encoding light generating proteins, at least one of drug resistance gene.According to concrete example of the present invention, preferred described luminescent protein is at least one being selected from GFP and EGFP.According to concrete example of the present invention, preferred described drug resistance gene is at least one being selected from neomycin phosphotransferase and hygromycin B resistant gene.Thus, the screening of transgenic cell can be carried out easily, improve the efficiency preparing transgenic cell further.
According to one embodiment of present invention, described Second support comprises promotor further, and described promotor is operably connected with described object nucleotide sequence.According to examples more of the present invention, preferred described promotor is eukaryotic cell promotor.According to concrete example of the present invention, more preferably described eukaryotic cell promotor is at least one being selected from CAG promotor and PGK promotor.According to a concrete example of the present invention, most preferably described eukaryotic cell promotor is CAG promotor.Thus, the expression efficiency of object nucleotide sequence in host cell can be improved.
According to one embodiment of present invention, described eukaryotic cell promotor is tissue-specific promoter.Thus, according to the type of host cell, suitable promotor can be selected, thus obtain the tissue specific expression that can realize object nucleotide sequence.
According to one embodiment of present invention, described Second support comprises enhancer sequence further, and described enhancer sequence is operably connected with described object nucleotide sequence.According to examples more of the present invention, preferred described enhanser is CHS4 enhanser.Thus, the expression efficiency of object nucleotide sequence in host cell can be improved further.
According to one embodiment of present invention, the two ends of described object nucleotide sequence have the nucleotide sequence being suitable for homologous recombination respectively.Thus, the probability that object nucleotide sequence and host cell chromosome occur to integrate can be improved.According to examples more of the present invention, the nucleotide sequence being suitable for homologous recombination is preferably the NOT-function fragment in cellular genome.Thus, while the probability integrated occurs for raising object nucleotide sequence and host cell chromosome, the introducing of object nucleotide sequence does not affect expression and the function of host cell normal gene.
According to a second aspect of the present invention, the present invention proposes a kind of carrier being suitable for transformant.According to embodiments of the invention, this carrier comprises attachment subsequence.Utilize this carrier, can promote that object nucleotide sequence is incorporated in the karyomit(e) of host cell, and simultaneously because attachment subsequence self can not be integrated with karyomit(e), external object nucleotide sequence is only included in the genome of the transgenic cell thus finally obtained, and there is not attachment subsequence, can effectively build unmarked transgenic cell thus.
According to embodiments of the invention, the above-mentioned carrier being suitable for transformant can also have following additional technical feature:
According to one embodiment of present invention, described attachment sub-series of packets contains the nucleotide sequence of Encoded Chromosomes skeleton land and/or matrix attachment region.Thus, utilize this attachment subsequence, can effectively object nucleotide sequence be positioned in nucleus, and then effectively promote that the karyomit(e) of object nucleotide sequence and host cell is integrated.
According to one embodiment of present invention, described carrier comprises the nucleotide sequence of coding replication origin further.According to concrete example of the present invention, preferred described replication origin is oriP.Thus, utilize replication origin, attachment subsequence can in host cell self-replicating, thus there is the probability integrated in the karyomit(e) improving object nucleotide sequence and host cell.
According to one embodiment of present invention, described carrier comprises the nucleotide sequence of coding selection markers further.Thus, can effectively screen the host cell proceeding to carrier, improve the efficiency preparing transgenic cell.According to examples more of the present invention, described selection markers is be selected from the gene of encoding light generating proteins, at least one of drug resistance gene.According to concrete example of the present invention, preferred described luminescent protein is at least one being selected from GFP and EGFP.According to concrete example of the present invention, preferred described drug resistance gene is at least one being selected from neomycin phosphotransferase and hygromycin B resistant gene.Thus, the screening of transgenic cell can be carried out easily, improve the efficiency preparing transgenic cell further.
According to a third aspect of the invention we, the present invention proposes a kind of method preparing transgenic cell.According to embodiments of the invention, this method preparing transgenic cell comprises the following steps: use foregoing one group of vector host cell being suitable for transformant, to obtain transgenic cell; And separation transgenic cell, containing described object nucleotide sequence in the karyomit(e) of wherein said transgenic cell.As previously mentioned, owing to comprising attachment subsequence and object nucleotide sequence in the first carrier and Second support respectively, thus adhere to subsequence and can promote that object nucleotide sequence is incorporated in the karyomit(e) of host cell, and simultaneously because attachment subsequence self can not be integrated with karyomit(e), can not containing attachment subsequence in the karyomit(e) of the host cell thus finally obtained, external object nucleotide sequence is only included in the genome of the transgenic cell thus finally obtained, and there is not attachment subsequence, can effectively build unmarked transgenic cell thus.
According to embodiments of the invention, the above-mentioned method preparing transgenic cell can also have following additional technical feature:
According to one embodiment of present invention, described host cell is eukaryotic cell.According to examples more of the present invention, preferred described eukaryotic cell is zooblast, and described zooblast is come from the somatocyte of at least one being selected from people, ox, sheep, pig and rabbit.Present inventor is surprised to find, and prepares the method for transgenic cell according to an embodiment of the invention, is particularly suitable for preparing eucaryon transgenic cell, especially zooblast.When be applied to be selected from people, ox, sheep, pig and rabbit the somatocyte of at least one time, the transgenic cell obtained, can be applied to preparation transgenic animal by the method for handmade cloning.
According to one embodiment of present invention, host cell described in described first carrier and described Second support cotransformation is utilized.According to examples more of the present invention, carry out described cotransformation preferably by liposome method.Thus, can improve the efficiency in the first carrier and Second support introducing host cell.
According to one embodiment of present invention, comprise further: verified the step containing described object nucleotide sequence in the genome of described transgenic cell by PCR method.Thus, successfully there is the transgenic cell integrated in the karyomit(e) that can screen object nucleotide sequence and host cell easily, thus, improves the efficiency preparing transgenic cell further.
According to a forth aspect of the invention, the present invention proposes a kind of non-human transgenic animal's cell or its culture.According to embodiments of the invention, described non-human transgenic animal's cell obtains according to the method preparing transgenic cell recited above.Thus, in the genome of this non-human transgenic animal's cell or its culture, do not comprise marker gene, thus, disadvantageous effect can not be caused to the normal operation of transgenic cell.
According to a fifth aspect of the invention, the present invention proposes a kind of method preparing non-human transgenic animal.According to embodiments of the invention, this method preparing non-human transgenic animal comprises the following steps: the nucleus extracting non-human transgenic animal's cell noted earlier or its culture; Described nucleus is introduced in the seedless ovocyte of described animal, merges ovocyte to obtain; Described fusion ovocyte is cultivated under appropriate conditions, to obtain described non-human transgenic animal.Thus, effectively can obtain non-human transgenic animal, meanwhile, not containing marker gene in the karyomit(e) of the non-human transgenic animal obtained, thus the normal operation of animal individual self can not be affected.
According to embodiments of the invention, the method for the above-mentioned non-human transgenic animal of preparation can also have following additional technical feature:
According to one embodiment of present invention, the genetic material that described seedless ovocyte is removed in ovum by handmade cloning method obtains.Thus, the efficiency obtaining seedless ovocyte can be improved, and the efficiency accepting foreign cell core can be improved.
According to a fifth aspect of the invention, the present invention proposes a kind of non-human transgenic animal or its offspring.According to embodiments of the invention, described non-human transgenic animal obtains according to the foregoing method preparing non-human transgenic animal.Thus, do not contain marker gene according in the karyomit(e) of the non-human transgenic animal of the embodiment of the present invention, thus the normal operation of animal individual self can not be affected.
Additional aspect of the present invention and advantage will part provide in the following description, and part will become obvious from the following description, or be recognized by practice of the present invention.
Accompanying drawing explanation
Above-mentioned and/or additional aspect of the present invention and advantage will become obvious and easy understand from accompanying drawing below combining to the description of embodiment, wherein:
Fig. 1 shows a kind of schematic flow sheet building transgenic animal according to the embodiment of the present invention;
Fig. 2 shows the schematic diagram according to the sub-carrier of the attachment of the embodiment of the present invention;
Fig. 3 shows the schematic diagram of the expression vector according to the embodiment of the present invention;
Fig. 4 shows according to the invention process 3, and cell starts the picture screening latter 2nd day, 5 days, 8 days.
Fig. 5 shows according to the embodiment of the present invention 3, PK15 cell monoclonal picture (positive cell is with green fluorescence).
Fig. 6 shows according to the embodiment of the present invention 3, inoblast mono-clonal picture (positive cell is with green fluorescence).
Fig. 7 shows according to the embodiment of the present invention 3, and positive cell adheres to sub-plasmid identification picture (attachment is not lost).
Fig. 8 shows and adheres to sub-plasmid identification picture (attachment is lost) according to the positive cell of the embodiment of the present invention 3.
Fig. 9 shows the blastaea developmental state according to the embodiment of the present invention 7.
Embodiment
Be described below in detail embodiments of the invention, the example of described embodiment is shown in the drawings, and wherein same or similar label represents same or similar element or has element that is identical or similar functions from start to finish.Being exemplary below by the embodiment be described with reference to the drawings, only for explaining the present invention, and can not limitation of the present invention being interpreted as.
If not otherwise specified, used in this article term is all usual the understood implications of those skilled in the art.Term " first " used in the present invention, " second " are only used to the different composition of convenient differentiation, and can not be interpreted as importance or otherwise difference by any way.
One group of carrier being suitable for transformant
According to a first aspect of the invention, the present invention proposes the carrier that a group is suitable for transformant.According to embodiments of the invention, the carrier that this group is suitable for transformant comprises: the first carrier and Second support.According to embodiments of the invention, the first carrier comprises attachment subsequence, and the first carrier also can be called as the sub-carrier of attachment sometimes.Second support comprises object nucleotide sequence, and Second support also can be called expression vector sometimes.Term " attachment subsequence " used in this article refers to and can promote that object nucleotide sequence is located in the nucleus of host cell, thus promotes that object nucleotide sequence and host cell chromosome are integrated.Subsequence itself is not integrated with host cell chromosome in attachment, and can lose gradually along with the propagation of cell.Thus, owing to comprising attachment subsequence and object nucleotide sequence in the first carrier and Second support respectively, thus adhere to subsequence and can promote that object nucleotide sequence is incorporated in the karyomit(e) of host cell, and simultaneously because attachment subsequence self can not be integrated with karyomit(e), can not containing attachment subsequence in the karyomit(e) of the host cell thus finally obtained, external object nucleotide sequence is only included in the genome of the transgenic cell thus finally obtained, and there is not attachment subsequence, can effectively build unmarked transgenic cell thus.Here used term " object nucleotide sequence " should make broad understanding, both can be the nucleic acid fragment with gene function, also can be nucleic acid fragment such as promotor, enhanser, silencer etc. for regulating required for other functions of host cell.Here used term " carrier " should make broad understanding, and it can be any medium nucleotide sequence can introduced in host cell, includes but not limited to plasmid, clay, virus, artificial chromosome etc.
According to some embodiments of the present invention, adhere to the type of subsequence and be not particularly limited.According to one embodiment of present invention, the attachment sub-series of packets adopted contains the nucleotide sequence of Encoded Chromosomes skeleton land and/or matrix attachment region.Thus, utilize this attachment subsequence, can be combined with chromosome compositions by attachment, or be combined with nuclear matrix, thus be effectively positioned in nucleus by object nucleotide sequence, and then effectively promote that the karyomit(e) of object nucleotide sequence and host cell is integrated.More preferably comprise the nucleotide sequence of coding EBNA1 and/or matrix attachment region, described chromosome compositions land is EBNA1 alternatively.Present inventor is surprised to find, and when employing EBNA1 is as the attachment period of the day from 11 p.m. to 1 a.m, greatly can improve the efficiency building marker-free transgenic cell/animal.
For the ease of utilizing these vector host cells, the first carrier and Second support can also have other element respectively, to give its additional function and effect.
According to one embodiment of present invention, the first carrier may further include the nucleotide sequence of coding replication origin.According to concrete example of the present invention, preferred described replication origin is oriP.Thus, utilize replication origin, attachment subsequence can in host cell self-replicating, thus there is the probability integrated in the karyomit(e) improving object nucleotide sequence and host cell.Present inventor finds, when adhering to subsequence and being connected with oriP, constructed carrier can self-replicating very effectively in host cell, and the probability integrated occurs the karyomit(e) that can significantly improve object nucleotide sequence and host cell.
According to one embodiment of present invention, the first carrier may further include the nucleotide sequence of coding selection markers.Thus, can effectively screen the host cell proceeding to the first carrier, improve the efficiency preparing transgenic cell.According to example of the present invention, the type of selection markers is also not particularly limited.According to examples more of the present invention, selection markers can for being selected from the gene of encoding light generating proteins, at least one of drug resistance gene.Thus, the host cell introducing the first carrier can be screened easily, such as, by detecting luminous intensity and adding corresponding medicine in the medium.According to concrete example of the present invention, luminescent protein can for being selected from least one of GFP and EGFP.Thus, by detecting the green fluorescence sent, can screen and verifying that the first carrier has successfully been introduced in host cell.According to concrete example of the present invention, described drug resistance gene is at least one being selected from neomycin phosphotransferase and hygromycin B resistant gene.Thus, can by adding corresponding microbiotic in the medium, the cell that gets off of surviving after incubation is the host cell containing the first carrier.Thus, the screening of transgenic cell can be carried out easily, improve the efficiency preparing transgenic cell further.
According to one embodiment of present invention, Second support can comprise promotor further, and promotor can be operably connected with described object nucleotide sequence.Here used term " connection " should make broad understanding, can be directly to be connected, also can for be indirectly connected by medium.The meaning of " exercisable connection " refers to, promotor can play its natural biological function, thus affects the expression of object nucleotide sequence.According to embodiments of the invention, the type of the promotor that can adopt is not particularly limited.According to examples more of the present invention, described promotor can be eukaryotic cell promotor.Thus, the first carrier and Second support can be applied to transforming eukaryotic cells.According to concrete example of the present invention, more preferably described eukaryotic cell promotor is at least one being selected from CAG promotor and PGK promotor.According to a concrete example of the present invention, most preferably described eukaryotic cell promotor is CAG promotor.Thus, the expression efficiency of object nucleotide sequence in host cell can be improved.Contriver is surprised to find, and when adopting CAG promotor, can improve the expression of object nucleotide sequence in host cell significantly.According to other embodiments of the invention, described eukaryotic cell promotor is tissue-specific promoter.Thus, according to the type of host cell, suitable promotor can be selected, thus obtain the tissue specific expression that can realize object nucleotide sequence.
According to one embodiment of present invention, Second support can comprise enhancer sequence further, and wherein, enhancer sequence is operably connected with object nucleotide sequence.Thus, the expression efficiency of object nucleotide sequence in host cell can be improved further.According to embodiments of the invention, the type of enhanser is not particularly limited.According to examples more of the present invention, enhanser is CHS4 enhanser.Contriver is surprised to find, and when adopting CHS4 enhanser, can improve the expression of object nucleotide sequence in host cell significantly.
According to one embodiment of present invention, the two ends of object nucleotide sequence have the nucleotide sequence being suitable for homologous recombination respectively.Thus, the probability that object nucleotide sequence and host cell chromosome occur to integrate can be improved.According to embodiments of the invention, the type being suitable for the nucleotide sequence of homologous recombination is not particularly limited.According to examples more of the present invention, the nucleotide sequence being suitable for homologous recombination is preferably the NOT-function fragment in cellular genome.Thus, while the probability integrated occurs for raising object nucleotide sequence and host cell chromosome, the introducing of object nucleotide sequence does not affect expression and the function of host cell normal gene.
Adhere to sub-carrier
According to a second aspect of the present invention, the present invention proposes a kind of carrier being suitable for transformant.According to embodiments of the invention, this carrier comprises attachment subsequence.Thus, in the present invention, this carrier also can be called the sub-carrier of attachment.Utilize the sub-carrier of attachment, can promote that object nucleotide sequence is incorporated in the karyomit(e) of host cell, and simultaneously because attachment subsequence self can not be integrated with karyomit(e), external object nucleotide sequence is only included in the genome of the transgenic cell thus finally obtained, and there is not attachment subsequence, can effectively build unmarked transgenic cell thus.
Here used term " carrier " should make broad understanding, and it can be any medium nucleotide sequence can introduced in host cell, includes but not limited to plasmid, clay, virus, artificial chromosome etc.
According to some embodiments of the present invention, adhere to the type of subsequence and be not particularly limited.According to one embodiment of present invention, the attachment sub-series of packets adopted contains the nucleotide sequence of Encoded Chromosomes skeleton land and/or matrix attachment region.Thus, utilize this attachment subsequence, can be combined with chromosome compositions by attachment, or be combined with nuclear matrix, thus be effectively positioned in nucleus by object nucleotide sequence, and then effectively promote that the karyomit(e) of object nucleotide sequence and host cell is integrated.More preferably comprise the nucleotide sequence of coding EBNA1 and/or matrix attachment region, described chromosome compositions land is EBNA1 alternatively.Present inventor is surprised to find, and when employing EBNA1 is as the attachment period of the day from 11 p.m. to 1 a.m, greatly can improve the efficiency building marker-free transgenic cell/animal.
For the ease of utilizing these vector host cells, adhere to the element that sub-carrier can also have other, to give its additional function and effect.
According to one embodiment of present invention, the nucleotide sequence that sub-carrier may further include coding replication origin is adhered to.According to concrete example of the present invention, preferred described replication origin is oriP.Thus, utilize replication origin, attachment subsequence can in host cell self-replicating, thus there is the probability integrated in the karyomit(e) improving object nucleotide sequence and host cell.Present inventor finds, when adhering to subsequence and being connected with oriP, constructed carrier can self-replicating very effectively in host cell, and the probability integrated occurs the karyomit(e) that can significantly improve object nucleotide sequence and host cell.
According to one embodiment of present invention, the nucleotide sequence that sub-carrier body may further include coding selection markers is adhered to.Thus, effectively can screen the host cell proceeding to and adhere to sub-carrier, improve the efficiency preparing transgenic cell.According to example of the present invention, the type of selection markers is also not particularly limited.According to examples more of the present invention, selection markers can for being selected from the gene of encoding light generating proteins, at least one of drug resistance gene.Thus, the host cell introduced and adhere to sub-carrier can be screened easily, such as, by detecting luminous intensity and adding corresponding medicine in the medium.According to concrete example of the present invention, luminescent protein can for being selected from least one of GFP and EGFP.Thus, by detecting the green fluorescence sent, can screen and verifying that the sub-carrier of attachment has successfully been introduced in host cell.According to concrete example of the present invention, described drug resistance gene is at least one being selected from neomycin phosphotransferase and hygromycin B resistant gene.Thus, can by adding corresponding microbiotic in the medium, the cell got off of surviving after incubation is the host cell containing the sub-carrier of attachment.Thus, the screening of transgenic cell can be carried out easily, improve the efficiency preparing transgenic cell further.Transgenic cell/animal and preparation method thereof
According to a third aspect of the invention we, the present invention proposes a kind of method utilizing carrier recited above to prepare transgenic cell.This method preparing transgenic cell comprises the following steps:
First, foregoing one group of vector host cell being suitable for transformant is used, to obtain transgenic cell.Namely can adopt the first carrier (adhering to sub-carrier) and Second support (expression vector) transformed host cell, the sub-carrier of attachment and expression vector can be incorporated in cell thus.According to embodiments of the invention, adhere to the order that sub-carrier and expression vector be introduced in cell to be not particularly limited, can be introduced in cell, also can be incorporated into successively in cell simultaneously, both first can introduce expression vector, also first can introduce the sub-carrier of attachment.According to embodiments of the invention, the type of host cell is not particularly limited.According to one embodiment of present invention, the host cell adopted is eukaryotic cell.According to examples more of the present invention, preferred eukaryotic cell is zooblast.More preferably the somatocyte of at least one being selected from people, ox, sheep, pig and rabbit is come from.Present inventor is surprised to find, and prepares the method for transgenic cell according to an embodiment of the invention, is particularly suitable for preparing eucaryon transgenic cell, especially zooblast.When be applied to be selected from people, ox, sheep, pig and rabbit the somatocyte of at least one time, the transgenic cell obtained, can be applied to preparation transgenic animal by the method for handmade cloning.According to concrete examples more of the present invention, utilize host cell described in described first carrier and described Second support cotransformation, namely the sub-carrier of attachment and expression vector can be incorporated in host cell simultaneously.The method realizing cotransformation is also not particularly limited, and according to examples more of the present invention, can carry out described cotransformation by liposome method.Thus, the efficiency the first carrier and Second support simultaneously introduced in host cell can be improved.Thus, successfully there is the transgenic cell integrated in the karyomit(e) that can screen object nucleotide sequence and host cell easily, thus, improves the efficiency preparing transgenic cell further.It should be noted that, term " conversion " used in this article and " transfection " can exchange use, all refer to the operation introduced by exogenous nucleic acid sequences in host cell.
Next, be separated transgenic cell, the transgenic cell namely containing described object nucleotide sequence in karyomit(e).As previously mentioned, owing to comprising attachment subsequence and object nucleotide sequence in the first carrier and Second support respectively, thus adhere to subsequence and can promote that object nucleotide sequence is incorporated in the karyomit(e) of host cell, and simultaneously because attachment subsequence self can not be integrated with karyomit(e), can not containing attachment subsequence in the karyomit(e) of the host cell thus finally obtained, external object nucleotide sequence is only included in the genome of the transgenic cell thus finally obtained, and there is not attachment subsequence, can effectively build unmarked transgenic cell thus.
After separation transgenic cell, can be verified in the genome of described transgenic cell containing object nucleotide sequence by PCR method.Can certainly be verified by the enzymic activity of analysis purposes nucleotide sequence expressing protein.But consider from standpoint of efficiency, preferably by PCR method checking, thus, according to embodiments of the invention, also further comprise and verify by PCR method the step containing described object nucleotide sequence in the genome of described transgenic cell.
The method not only in time, in efficiency, in workload, all comparatively additive method is significantly improved, and can be used for the preparation of all types of marker-free transgenic cell strain, prepares marker-free transgenic cloned animal etc.
According to a forth aspect of the invention, the present invention proposes a kind of transgenetic animal cell or its culture.According to embodiments of the invention, transgenetic animal cell obtains according to the method preparing transgenic cell recited above.Preferably, described animal is non-human animal.As described above, in the genome of this transgenetic animal cell or its culture, do not comprise marker gene, thus, disadvantageous effect can not be caused to the normal operation of transgenic cell, also there is not the extra consideration about biological safety.
According to a fifth aspect of the invention, the present invention proposes a kind of method preparing non-human transgenic animal.According to embodiments of the invention, this method preparing non-human transgenic animal comprises the following steps:
First, the nucleus of non-human transgenic animal's cell or its culture is extracted.It will be understood by those skilled in the art that and any known method can be adopted to extract single celled nucleus, such as, manually extracted by micrurgy.According to embodiments of the invention, the cell adopted is the unmarked cell (in the present invention, selection markers is also called mark sometimes simply) obtained based on preceding method.
Then, extracted nucleus is introduced in the seedless ovocyte of described animal, merge ovocyte to obtain.According to embodiments of the invention, the source of seedless ovocyte is also not particularly limited.According to one embodiment of present invention, the genetic material that described seedless ovocyte is removed in ovum by handmade cloning method obtains.Thus, the efficiency obtaining seedless ovocyte can be improved, and the efficiency accepting foreign cell core can be improved.
Finally, fusion ovocyte is cultivated under appropriate conditions, to obtain described non-human transgenic animal.It will be understood by those skilled in the art that and can adopt conventional method, obtain animal individual from ovocyte, such as, first ovocyte is cultivated and obtain blastaea, blastaea is implanted in parent grow further, obtain animal individual.Thus, term " cultivation " used here should make broad understanding, and it covers and obtains from ovocyte experience animal individual process various and provide the operation of energy for cell/cell aggregate.
Thus, effectively can obtain non-human transgenic animal, meanwhile, not containing marker gene in the karyomit(e) of the non-human transgenic animal obtained, thus the normal operation of animal individual self can not be affected, also there is not the extra consideration about biological safety.
According to a fifth aspect of the invention, the present invention proposes a kind of non-human transgenic animal or its offspring.According to embodiments of the invention, described non-human transgenic animal obtains according to the foregoing method preparing non-human transgenic animal.Thus, do not contain marker gene according in the karyomit(e) of the non-human transgenic animal of the embodiment of the present invention, thus the normal operation of animal individual self can not be affected, also there is not the extra consideration about biological safety.
To sum up, according to embodiments of the invention, the invention provides one and by selection markers being structured on the sub-plasmid of attachment, thus screening cell clone method can be carried out, foreign gene such as protokaryon sequence can be avoided to be incorporated in host cell such as eukaryotic cell karyomit(e).And, after the sub-carrier of attachment is along with the division loss of host cell, the element that selection markers etc. have auxiliary function also all can be lost, thus avoid riddled basins and be integrated into eukaryotic gene group and the potential danger brought, make the integration of external source object nucleotide sequence (in the present invention sometimes also referred to as " goal gene ") safer.This will provide new screening approach and experiment new approaches for transgenic technology.
Below with reference to specific embodiment, the present invention will be described, it should be noted that, these embodiments are only illustrative, and can not be interpreted as limitation of the present invention.
If do not specialize, the conventional means that the technique means adopted in embodiment is well known to those skilled in the art, can carry out with reference to " Molecular Cloning: A Laboratory guide " third edition or related products, the reagent adopted and product be also can business obtain.
General method:
Fig. 1 shows the general method of embodiment.That is:
1, build the sub-carrier of attachment, contain the sub-carrier of attachment of attachment subsequence and screening-gene from different plasmid constructions.
2, construction of expression vector, contains the expression vector of promotor, enhanser, goal gene fragment from different plasmid constructions.
3, carrier corotation, will adhere to sub-carrier and expression vector cotransfection cell.
4, obtain positive cell clone, utilize the selection markers above the sub-carrier of attachment to screen resistant cell colonies.Utilize round pcr to identify in positive cell clone and adhere to sub-loss situation.
5, handmade cloning method produces transgene clone
Utilize handmade cloning method, prepare transgenic cloned embryos, and transplant, scale operation transgenic and cloned animal.
6, cloned animal qualification
Utilize DNA and RNA of cloned animal to detect and identify that whether cloned animal is the transgenic pig with goal gene.Embodiment 1 builds the sub-carrier of attachment
Synthetic primer, primer is respectively:
Neo-F(SEQ ID NO：1)：ATGAGGATCGTTTCGCATG
Neo-R(SEQ ID NO：2)：TCAGAAGAACTCGTCAAGAAG。
Utilize above-mentioned primer, amplify NEO (i.e. neomycin phosphotransferase, it can resist the lethal effect of G418) expression cassette from commercialization carrier pEGFP-N1.
Wherein, PCR condition is:
95℃5min，
(95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min) × 30 circulations,
72℃5min。
Pcr amplification product size is 811bp.The two ends of pcr amplification product have KpnI and HindIII restriction enzyme site respectively.Utilize after corresponding restriction enzyme digests PCR primer, use identical digestion with restriction enzyme to carry the commercialization carrier pCEP4 carrier of EBNA1, the PCR primer through digestion be connected according to condition of contact below by ligase enzyme with the pCEP4 carrier through digesting:
Linked system is as follows:
10 × T4 ligase enzyme damping fluid 1 μ l,
Enzyme cuts pCEP4 carrier 2 μ l,
Enzyme cuts PCR primer 5 μ l,
H
2O 2μl。
Ligation is carried out 4 hours at 16 DEG C.Finally, build and obtain the sub-carrier pEBNA-NEO of the attachment of carrying EBNA1, the structural representation of the sub-carrier of constructed attachment as shown in Figure 2.
Embodiment 2 expression vector establishment
Synthetic primer, primer sequence is:
EGFP-F1(SEQ ID NO：3)：ATGGTGAGCAAGGGCGAG
EGFP-R1(SEQ ID NO：4)：CAACTAGAATGCAGTGAAAAAAAT。
Utilize above-mentioned primer, amplify pEGFP-N1 carrier from commercialization carrier pEGFP-N1 and to increase EGFP gene (enhanced green fluorescence protein).
The two ends of PCR primer have EcoRI and XhoI restriction enzyme site respectively.Utilize after corresponding restriction enzyme digests PCR primer, use identical digestion with restriction enzyme commercialization carrier pcDNA3.1 carrier.PEGFP carrier is obtained by carrying out being connected structure by ligase enzyme according to condition of contact below with the pcDNA3.1 carrier through digesting through postdigestive PCR primer:
Linked system is as follows:
10 × T4 ligase enzyme damping fluid 1 μ l,
Enzyme cuts pcDNA3.1 carrier 2 μ l,
Enzyme cuts PCR primer 5 μ l,
H
2O 2μl。
Ligation is carried out 4 hours at 16 DEG C.
Synthetic primer, primer sequence is:
CHS-F1(SEQ ID NO：5)：GGAGCTCACGGGGACAGC
CHS-R1(SEQ ID NO：6)：′TCTCACTGACTCCGTCCTGG。
Utilize above-mentioned primer, increase CHS4 fragment from chicken DNA.
The two ends of PCR primer have MfeI and MluI restriction enzyme site respectively.Utilize after corresponding restriction enzyme digests PCR primer, the construct pEGFP carrier using identical digestion with restriction enzyme to prepare above.Expression vector CHS-EGFP-CHS is obtained by carrying out being connected structure by ligase enzyme according to condition of contact below with the pEGFP carrier through digesting through postdigestive PCR primer:
Connect as follows:
10 × T4 ligase enzyme damping fluid 1 μ l,
Enzyme cuts pEGFP carrier 2 μ l,
Enzyme cuts PCR primer 7 μ l.
Ligation is carried out 4 hours at 16 DEG C.
Design primer increases CHS4 fragment again, and restriction enzyme site is added at primer two ends, by utilizing corresponding digestion with restriction enzyme and T4 ligase enzyme, by CHS4 fragment-connect in pCHS-EGFP carrier, building and obtaining pCHS-EGFP-CHS carrier.Enzyme cuts pCHS-EGFP-CHS carrier, obtains CHS-EGFP-CHS expression cassette.
The expression of embodiment 3 recombinant expression vector in cell
Attachment sub-carrier pEBNA-NEO constructed above and expression vector element CHS-EGFP-CHS liposome method are each separately transfected in PK15 porcine kidney cell and pig inoblast according to following condition:
2 μ g are adhered to sub-carrier pEBNA-NEO and expression vector element CHS-EGFP-CHS, add in 100 μ lopti-MEM substratum, then add liposome mixing, room temperature leaves standstill 20min, is added dropwise in the 6cm culture dish of culturing cell.
In transfection after 48 hours, the G418 adding final concentration 500 μ g/ml in the DMEM substratum containing 15%FBS screens, and observes EGFP expression.Can express continually and steadily until EGFP can be observed under fluorescent microscope.
Embodiment 4 verifies the loss of the sub-carrier of attachment in positive cell clone
Utilize G418 screen after about 6 days, start to occur cell clone (as shown in Figure 4).Picking fluorescent colonies changes and does not continue to cultivate (as shown in Figure 5 and Figure 6) containing the fresh culture of G418 with being replaced by.Cultivate after 2 days, the DNA extracting cell clone carries out PCR qualification, afterwards, goes down to posterity at every turn and all extracts cell DNA, identifies EBNA1 and Hygro fragment respectively.
In addition, lack in positive cell clone according to following experiments checking attachment:
According to EBNA1 and the Hygro sequence that carrier provides, design qualification PCR primer, does pcr analysis to the cell DNA gone down to posterity at every turn.
Pcr amplification condition is:
95℃5min，
(95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min) × 30 circulations,
72℃5min。
Result is shown in Fig. 7 and 8.As shown in Figure 7, adhere to sub-carrier to be still present in positive cell.But shown in Fig. 8, determine that adhere to sub-carrier loses after experience cell proliferation for some time.
The expression of embodiment 5 recombinant expression vector in pig inoblast
According to the method identical with embodiment 3, utilize the sub-carrier pEBNA-NEO of attachment and expression vector CHS-EGFP-CHS By Transfecting Porcine inoblast, and verify the stably express of EGFP.
The selection systems of embodiment 6 transgene positive cells
According to the method identical with embodiment 4, extract DNA and RNA to the institute pig inoblast that obtains in embodiment 5, whether qualification has goal gene to exist and expresses.Meanwhile, EBNA1 and Hygro fragment loss situation is identified.
Result shows, and EGFP has remarkable expression pig inoblast, and EBNA1 and Hygro fragment is lost.Thus, prove that method of the present invention goes for many animals somatocyte.
Embodiment 7 somatic cell clone prepares marker-free transgenic animal
According to the method for the handmade cloning of routine, the transgenic fibroblasts built in preceding embodiment is utilized to prepare clone pig, in brief, the step of handmade cloning comprises: the collection of ovocyte and maturation in vitro, removes cumulus cell, zona pellucida digests, stoning, kytoplasm and Somatic Fusion, electro activation, vitro culture to blastaea, transplanting embryo.
There is provided the attachment cell clone that sub-carrier is lost to do handmade cloning, prepare blastaea, after embryo maturation, migrate in foster mothers, treat that handmade cloning pig is born.
Next, according to following condition, by directly observing the method with PCR, identify that clone pig is the transgenic pig with goal gene and EGFP: first under ultraviolet lamp, observe whether have fluorescence; Secondly, get the tissue sample of clone pig, extract DNA and RNA and do PCR qualification.
In the description of this specification sheets, specific features, structure, material or feature that the description of reference term " embodiment ", " some embodiments ", " example ", " concrete example " or " some examples " etc. means to describe in conjunction with this embodiment or example are contained at least one embodiment of the present invention or example.In this manual, identical embodiment or example are not necessarily referred to the schematic representation of above-mentioned term.And the specific features of description, structure, material or feature can combine in an appropriate manner in any one or more embodiment or example.
Although illustrate and describe embodiments of the invention, those having ordinary skill in the art will appreciate that: can carry out multiple change, amendment, replacement and modification to these embodiments when not departing from principle of the present invention and aim, scope of the present invention is by claim and equivalents thereof.
Claims (9)
1. one group is suitable for the carrier of transformant, it is characterized in that, comprising:
First carrier, described first carrier comprises attachment subsequence; And
Second support, described Second support comprises object nucleotide sequence,
Wherein,
Described attachment sub-series of packets contains Encoded Chromosomes skeleton land,
Described chromosome compositions land is EBNA1,
Described first carrier comprises the nucleotide sequence of coding replication origin further,
Described replication origin is oriP,
Described first carrier comprises the nucleotide sequence of coding selection markers further,
Described selection markers is at least one being selected from the coding gene of EGFP, neomycin phosphotransferase gene and hygromycin B resistant gene,
Described Second support comprises promotor further, and described promotor is operably connected with described object nucleotide sequence,
Described promotor is CAG promotor,
Described Second support comprises enhancer sequence further, described enhancer sequence is operably connected with described object nucleotide sequence, described enhancer sequence is CHS4, and described CHS4 utilizes the primer sequence shown in SEQ ID NO:5-6 to increase from chicken DNA to obtain.
2. one group of carrier being suitable for transformant according to claim 1, it is characterized in that, the two ends of described object nucleotide sequence have the nucleotide sequence being suitable for homologous recombination respectively.
3. one group of carrier being suitable for transformant according to claim 2, is characterized in that, described in be suitable for homologous recombination nucleotide sequence be NOT-function fragment in cellular genome.
4. prepare a method for transgenic cell, it is characterized in that, comprise the following steps:
Use one group described in any one of the claim 1-3 vector host cell being suitable for transformant, to obtain transgenic cell; And
Be separated transgenic cell, wherein, containing described object nucleotide sequence in the karyomit(e) of described transgenic cell,
Wherein, host cell described in described first carrier and described Second support cotransformation is utilized.
5. the method preparing transgenic cell according to claim 4, is characterized in that, carries out described cotransformation by liposome method.
6. the method preparing transgenic cell according to claim 4, is characterized in that, comprise further:
The step containing described object nucleotide sequence in the genome of described transgenic cell is verified by PCR method.
7. non-human transgenic animal's cell or its culture, wherein said non-human transgenic animal's cell or its culture are that the method according to any one of claim 4-6 obtains,
Wherein, described cell is the somatocyte of at least one being selected from ox, sheep, pig and rabbit.
8. prepare a non-human transgenic animal's method, it is characterized in that, comprise the following steps:
Extract the nucleus of non-human transgenic animal's cell or its culture described in claim 7;
Described nucleus is introduced in the seedless ovocyte of described animal, merges ovocyte to obtain;
Described fusion ovocyte is cultivated under appropriate conditions, to obtain described non-human transgenic animal.
9. the method preparing non-human transgenic animal according to claim 8, is characterized in that,
The genetic material that described seedless ovocyte is removed in ovum by handmade cloning method obtains.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110306701.4A CN102367454B (en) | 2011-10-11 | 2011-10-11 | Transgenic animal and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110306701.4A CN102367454B (en) | 2011-10-11 | 2011-10-11 | Transgenic animal and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102367454A CN102367454A (en) | 2012-03-07 |
| CN102367454B true CN102367454B (en) | 2015-04-01 |
Family
ID=45760045
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110306701.4A Active CN102367454B (en) | 2011-10-11 | 2011-10-11 | Transgenic animal and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102367454B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101580828A (en) * | 2009-05-06 | 2009-11-18 | 深圳华大基因科技有限公司 | Nuclear transfer method |
-
2011
- 2011-10-11 CN CN201110306701.4A patent/CN102367454B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101580828A (en) * | 2009-05-06 | 2009-11-18 | 深圳华大基因科技有限公司 | Nuclear transfer method |
Non-Patent Citations (4)
| Title |
|---|
| 利用改进的手工克隆技术生产转GFP基因猪克隆胚胎;张鹏等;《遗传》;20110531;第33卷(第5期);527-532 * |
| 单一质粒四环素系统调控IL-24表达对胃癌细胞系的作用;林宁晶等;《世界华人消化杂志》;20060718;第14卷(第20期);1956-1962 * |
| 基于EBNA1和oriP的载体在基因治疗中的应用研究进展;何 婕等;《生 物 工 程 学 报》;20050531;第21卷(第3期);507-510 * |
| 猪诱导性多能干细胞技术的研究进展及应用前景;闫益波等;《遗传》;20110430;第33卷(第4期);307-313 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102367454A (en) | 2012-03-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yao et al. | Tild-CRISPR allows for efficient and precise gene knockin in mouse and human cells | |
| CN106191116B (en) | Foreign gene based on CRISPR/Cas9 knocks in integration system and its method for building up and application | |
| Chojnacka-Puchta et al. | Primordial germ cells (PGCs) as a tool for creating transgenic chickens | |
| CN102321655B (en) | Pseudo-attP site based integrated general-purpose expression vector and construction method and application thereof | |
| CN102226201A (en) | Expression vector, and its construction and application | |
| Kraus et al. | A more cost effective and rapid high percentage germ‐line transmitting chimeric mouse generation procedure via microinjection of 2‐cell, 4‐cell, and 8‐cell embryos with ES and iPS cells | |
| CN101760473B (en) | Method for deleting exogenous gene in transgenic cell at fixed point | |
| CN103160534B (en) | Universal type bovine beta-casein site gene targeting vector and preparation method thereof | |
| CN105018523B (en) | A kind of ZB Transposon System and its gene transfer method of mediation | |
| CN102453716A (en) | Clone and application of pig skeletal muscle specificity expression gene alpha-actin promoters | |
| Min et al. | Generation of antiviral transgenic chicken using spermatogonial stem cell transfected in vivo | |
| CN106978416B (en) | Gene positioning integration expression system and application thereof | |
| CN106399370B (en) | It is a kind of to establish the flounder embryo cell strain method for stablizing transgenosis | |
| CN103361342B (en) | A kind of method and its application of transgenosis positioning integration | |
| CN102367454B (en) | Transgenic animal and preparation method thereof | |
| CN107988257B (en) | Carrier, cell and the method for goat cloning efficiency are improved based on the horizontal modification of donorcells DNA methylation | |
| WO2021174742A1 (en) | Animal preparation method | |
| CN101519664B (en) | Method for breeding genetically modified animal by using recombinant adenovirus vector | |
| KR101552595B1 (en) | Method of transgenic bovine cloned embryos using Piggybac transposition | |
| CN103421782B (en) | Isolation, cloning and expression pattern identification of sheep hair follicle specific expression promoter fragment | |
| CN105400819A (en) | Multicistron vector achieving reversible immortalization of cells and construction method thereof | |
| CN101864420A (en) | Expression vector for efficiently expressing exogenous gene of HEK293 cell | |
| KR20080007832A (en) | Adenoviral recombinant expression vector comprising cag promoter | |
| KR101791576B1 (en) | Binary vector composition comprising Hac1 gene and Unfolded protein response element sequence or cells transformed with the same | |
| KR100801873B1 (en) | Complex |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 518083 Complex Building of Beishan Industrial Zone, Yantian Street, Yantian District, Shenzhen City, Guangdong Province Co-patentee after: BGI SHENZHEN Co.,Ltd. Patentee after: BGI SHENZHEN Address before: Beishan Industrial Zone Building in Yantian District of Shenzhen city of Guangdong Province in 518083 Co-patentee before: BGI SHENZHEN Co.,Ltd. Patentee before: BGI SHENZHEN |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20191216 Address after: 518120 A205, Peng Fei Road, Dapeng street, Dapeng New District, Shenzhen, Guangdong, China, 7 Patentee after: Shenzhen Huada Gene Agriculture Holding Co.,Ltd. Address before: 518083 Complex Building of Beishan Industrial Zone, Yantian Street, Yantian District, Shenzhen City, Guangdong Province Co-patentee before: BGI SHENZHEN Co.,Ltd. Patentee before: BGI SHENZHEN |