CN102344952A - Primer, method and kit for detecting apple-derived materials in sample - Google Patents
Primer, method and kit for detecting apple-derived materials in sample Download PDFInfo
- Publication number
- CN102344952A CN102344952A CN2010102405076A CN201010240507A CN102344952A CN 102344952 A CN102344952 A CN 102344952A CN 2010102405076 A CN2010102405076 A CN 2010102405076A CN 201010240507 A CN201010240507 A CN 201010240507A CN 102344952 A CN102344952 A CN 102344952A
- Authority
- CN
- China
- Prior art keywords
- seq
- apple
- primer
- sample
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an oligonucleotides primer for detecting apple-derived materials in a sample, and also relates to a realtime fluorescence PCR (Polymerase Chain Reaction) detection method for detecting the apple-derived materials in the sample, wherein the method comprises the step of using the specific oligonucleotides primer aiming at the apple-derived materials in the sample. The invention also relates to a PCR detection kit for quickly detecting the apple-derived materials in the sample, wherein the kit comprises the specific oligonucleotides primer for detecting the apple-derived materials in the sample by using the realtime fluorescence PCR detection method. In addition, the invention relates to application of the specific oligonucleotides primer aiming at the apple-derived materials in the sample in detecting the apple-derived materials in the sample. Due to the use of the PCR detection method and the PCR detection kit, whether the apple-derived materials are contained in the samples such as fruit juice, food, drug, nourishment and the like can be simply, quickly, specifically and sensitively detected.
Description
Technical field
The invention belongs to biological technical field; Particularly; The present invention relates to be used for the Oligonucleolide primers that sample apple derived component detects; The real-time fluorescence PCR detection method that is used for working sample apple derived component; The PCR detection kit that is used for rapid detection sample apple derived component, and specific oligonucleotide primer and probe application in the apple derived component in test sample of apple derived component in the sample.
Background technology
China is apple cultivation state the biggest in the world, also is Sucus Mali pumilae production and big export country.Sucus Mali pumilae is one of fastest-rising fruit juice of present global consumption as the second-biggest-in-the-world nectar that is only second to orange juice.In recent years, along with the raising of living standards of the people, the sales volume of China's Sucus Mali pumilae constantly increases, and kind and type are on the increase, and brand is multifarious.But, being subjected to ordering about of economic interests, some illegal manufacturers are marked with at fruit juice constituents and content and practise fraud, and counterfeit and shoddy goods flood market.As in nineteen ninety-five, because the shortage of Sucus Mali pumilae on the world market, the Sucus Mali pumilae price is increaseing, and prices such as pear juice even syrup are lower, and the Sucus Mali pumilae that therefore mixes pear juice even syrup etc. floods market.This has not only directly damaged human consumer's economic interests; And very likely endanger the consumer health; The legitimate rights and interests that trade mark is held enterprise have simultaneously also been invaded; Finally not only destroy the China market economic order; Upset social sincere system; And influence Chinese commodity image in the international market, damage China's foreign trade interests.
In addition, along with the change of people life style, the sickness rate of China's food allergy day by day increases, food allergy be subjected to attention degree more and more higher, the detection of all kinds of foods source property allergen is also seemed more and more important.Class monellin Thaumatin-Like Protein (TLP) conduct is a kind of important allergen wherein, receives increasing concern gradually.TLP extracts from multiple food at present; Like pears, apple, peach, wheat, tomato and potato etc.; One of important member of pathogenesis-related proteins (PRs) family of its to be plant induce in the body when receiving pathogenic micro-organism infringement generation; Participate in multiple fungus resistant reaction process, or part crowd's important anaphylactogen.Class monellin composition in the apple juice maybe be because sign be unclear or mix pseudo-the fraud in the market, causes the part crowd irritated and invade consumer rights to it.Therefore, the allergen constituent class monellin in the nectar detects and has theory and realistic meaning.
Present Sucus Mali pumilae is mingled mode and mainly contained two kinds: first kind is in Sucus Mali pumilae, to mix the more honest and cleaner fruit juice of some prices, such as Fructus Vins juice or pear juice; Second kind is in Sucus Mali pumilae, to add compositions such as entry and syrup, increases its volume.And existing Sucus Mali pumilae distinguishing method between true and false has: instrumental method such as special component discriminance such as carbohydrate discriminance, organic acid discriminance, pectin substance identification method, aldehydes matter identification method, letones identification method, amino acid differential method, inorganic elements discriminance and high-efficient liquid phase chromatogram technology, gas-chromatography, stable isotope mass spectroscopy, MALDI-TOMS method, thermo-cracking mass spectroscopy, near-infrared spectrum technique, ultraviolet spectral technique, artificial neural network etc.The application of above-mentioned these methods has been played certain function to the supervision and the management in fruit juice market.But above-mentioned technology can receive the influence of several factors such as kind, the place of production, harvest season, raw material environment, processing conditions, storing packaging means to a great extent, has certain limitation.In addition, the factor that influences physics and chemistry or instrument authentication detection technology sample representation is very many, guarantee the reliability of its method, just needs a large amount of detection samples and the mathematical model analytical technology of science, makes aforesaid method in practical application, receive very big restriction.
More and more, the new technology of deep processed product emerges in an endless stream in the international Sucus Mali pumilae processing industry; And China's apple processing industry also exists insufficient raw material, the residual problem that exceeds standard etc. and to still need and to solve of farming, and it also is one of restraining factors that influence China's Sucus Mali pumilae industry healthy development that Sucus Mali pumilae is mixed pseudo-discrimination method.Current, be badly in need of a kind ofly not influenced by adding means the authentication detection technology that detects in essence from fruit juice raw material.Along with the development of modern biotechnology, molecular biology method carries out the food discriminating and is just becoming the research direction that receives much attention in the world.Protocols in Molecular Biology is with its convenient, accurate, rapid, succinct characteristics; Analyze food raw material and characteristics of product and source from gene level; Sensitivity is higher, specificity is stronger; Its result has been for the true and false of proof food provides truly, reliable foundation, is used for the false distinguishing that food variety discriminating, product are traced to the source etc. in recent years gradually.
At present, domestic and international not appearing in the newspapers as yet can be detected the method and the test kit of apple derived component in the samples such as fruit juice, food, medicine and nutritious prod quick, simple, special and delicately.
Therefore; The detection method of apple derived component and the test kit that is used for rapid detection sample apple derived component carry out the detection of apple derived component in the samples such as fruit juice, food, medicine and nutritious prod in the sample that this area needs are a kind of fast, specificity is good, highly sensitive.
Summary of the invention
One object of the present invention is, the specific oligonucleotide primer of apple derived component in the rapid detection sample is provided.
Another object of the present invention is, the PCR detection method of apple derived component in the rapid determination sample is provided.
A further object of the present invention is, is provided for the PCR detection kit of apple derived component in the rapid detection sample.
Also purpose of the present invention is the specific oligonucleotide primer of apple derived component and the probe application in the apple derived component in test sample in the sampling.
To the foregoing invention purpose, the present invention provides following technical scheme:
According to one embodiment of the invention; It is right that the present invention is provided for the specific oligonucleotide primer of apple derived component in the real time fluorescent PCR method test sample, and said primer is to being that ITS region sequence according to class monellin gene intron and rDNA has an otherness in different plant species characteristics design.In one embodiment, wherein said primer is to being selected from No2-F:TTCAATGTCGATGATGAAGAG (SEQ ID NO:1) and No2-R:AGACTTCCTACTTTCACGTTTAAC (SEQ ID NO:2); No3-F:GGAATATGAACGAAAGAGCG (SEQ ID NO:3) and No3-R:AACGACTCTCGGCAACGGAT (SEQ ID NO:4); And Rp116-F 5 ' AATCTATGGAATCGTGGGATTC 3 ' (SEQ ID NO:5) and Rpl 16-R 5 ' CATTATAGCGTTCTACCAAAACG 3 ' (SEQ ID NO:6).
In a preferred embodiment, the said specific oligonucleotide primer that is used for real time fluorescent PCR method test sample apple derived component is to being SEQ ID NO:1 and SEQ ID NO:2.In another preferred embodiment, the said specific oligonucleotide primer that is used for real time fluorescent PCR method test sample apple derived component is to being SEQ ID NO:3 and SEQ ID NO:4.In another preferred embodiment, the said specific oligonucleotide primer that is used for real time fluorescent PCR method test sample apple derived component is to being SEQ ID NO:5 and SEQ ID NO:6.
According to another embodiment of the invention; The real-time fluorescence PCR detection method of apple derived component in the sampling of the present invention; Said method comprises that the specific oligonucleotide primer that uses to apple derived component in the sample is right, and said primer is to being that ITS region sequence according to class monellin gene intron and rDNA has an otherness in different plant species characteristics design.In one embodiment, in sample of the present invention in the real-time fluorescence PCR detection method of apple derived component employed Auele Specific Primer to being selected from SEQ ID NO:1 and SEQ ID NO:2; SEQ IDNO:3 and SEQ ID NO:4; And SEQ ID NO:5 and SEQ ID NO:6.
In an embodiment preferred of the inventive method, said real time fluorescent PCR method is a SYBR fluorescence dye method.In another embodiment preferred of the inventive method, said real time fluorescent PCR method is a Taqman fluorescent probe method.In one embodiment, in test sample of the present invention, in the Taqman fluorescent probe method of apple derived component, also use specific probe.In a preferred embodiment, employed probe sequence is No3-P:FAM-TGCGTCGTCGTCTTCGATAA-TAMAR (SEQ ID NO:7).In one embodiment, apple derived component PCR detection method also further comprises the step of extracting sample total DNA in the sample of the present invention.In one embodiment, said DNA extraction step is through detecting the endogenous reference gene chloroplast(id) trn gene that plant itself is had, the extraction quality of coming the total DNA of specimen.In a preferred embodiment, the universal primer sequence of said internal control gene plant chloroplast trn gene is No1-F:CTTGATTTTACCAAAGATGATGA (SEQ IDNO:8) and No 1-R:TTCTTCGCATGTACCCGCAG (SEQ ID NO:9).In the apple derived component PCR detection method, employed control sample comprises pear juice, peach juice, orange, Kiwifruit, tomato etc. in sample of the present invention.In one embodiment, the specific oligonucleotide primer that uses the apple derived component is to carrying out the double PCR amplification with plant universal amplification primer.In a preferred embodiment, the specific oligonucleotide primer of employed apple derived component is to being SEQ ID NO:1 and SEQ ID NO:2, and employed plant universal amplification primer is SEQ ID NO:8 and SEQ ID NO:9.In another preferred embodiment, the specific oligonucleotide primer of employed apple derived component is to being SEQ ID NO:3 and SEQ ID NO:4, and employed plant universal amplification primer is SEQ ID NO:8 and SEQ ID NO:9.In another preferred embodiment, the specific oligonucleotide primer of employed apple derived component is to being SEQ ID NO:5 and SEQ ID NO:6, and employed plant universal amplification primer is SEQ ID NO:8 and SEQ IDNO:9.
According to another embodiment of the invention, the real-time fluorescence PCR detection method of apple derived component in the sampling of the present invention, said method comprises uses the right combination of specific oligonucleotide primer to apple derived component in the sample of the present invention.In a real-time scheme; According to real-time fluorescence PCR detection method of the present invention; Also comprise and use internal control gene plant chloroplast trn gene universal primer sequence SEQ ID NO:8 and SEQ ID NO:9; Through detecting the endogenous reference gene chloroplast(id) trn gene that plant itself is had, the extraction quality of coming the total DNA of specimen.In sample of the present invention, in the PCR detection method of apple derived component, also further comprise the step that the pcr amplification condition is further optimized.In a preferred embodiment, in the step of pcr amplification condition optimizing, use different annealing temperatures to increase.In a preferred embodiment, said pcr amplification condition is 95 ℃, 10min; 95 ℃ of 15s; 60 ℃, 1min.
According to another embodiment of the invention; The present invention provides the test kit of apple derived component in the rapid detection sample, said test kit comprise the specific oligonucleotide primer that is used for real time fluorescent PCR method test sample apple derived component of the present invention to and working instructions.In a preferred embodiment, said test kit also comprises reagent that is used for the sample DNA extraction and the reagent that is used for the PCR reaction.In a preferred embodiment, comprise description in the working instructions of said test kit to the condition that is used for sample apple derived component pcr amplification.In a preferred embodiment, the pcr amplification condition that provides in the specification sheets of said test kit is 95 ℃, 10min; 95 ℃ of 15s; 60 ℃, 1min.
According to another embodiment of the present invention, the present invention provides the specific oligonucleotide primer that is used for real time fluorescent PCR method test sample apple derived component of the present invention to the application in the apple derived component in test sample.In a preferred embodiment, in the sampling of the present invention the specific oligonucleotide primer of apple derived component to SEQ ID NO:1 and SEQ ID NO:2; SEQ ID NO:3 and SEQ ID NO:4; Or SEQ ID NO:5 and SEQ ID NO:6 application in the apple derived component in test sample.
The present invention detects the basis with the DNA of apple; In different plant species, have the characteristics of otherness according to class monellin gene intron and district's (ITS) sequence between rDNA is transcribed, cloned the class monellin gene intron of apple and the ITS 1-5.8S-ITS2 region sequence of rDNA thereof.According to these sequences Design primers, utilize the apple derived component in the real-time fluorescence PCR method test sample.
Real-time fluorescence quantitative PCR is promptly on the basis of conventional PCR method; Add fluorescently-labeled probe or fluorescence dye; Accumulation along with the PCR product; The fluorescent signal that probe or dyestuff send strengthens; And the fluorescence monitoring system can receive fluorescent signal; Be DNA chain of every generation, just have a fluorescence molecule to form, realized that the accumulation of fluorescent signal and PCR product form fully synchronously.Therefore can monitor whole PCR reaction process in real time, and finally detect the initial copy number of testing sample, thereby can detect contained apple derived component in the testing sample.
Real-time fluorescence PCR detection method of the present invention adopts complete stopped pipe to detect, and need not the PCR aftertreatment, has avoided crossed contamination and false positive.Method of the present invention has used dexterously that the DNA of round pcr efficiently increases, the specificity of nucleic acid hybridization and detection technique of fluorescence fast and susceptibility, have simple to operate, time saving and energy saving, reliable results and accurate advantage such as sensitivity.The test kit of processing according to primer sequence of the present invention is used for the qualitative and quantitative analysis of this series products, has highly sensitive, high specificity, the result is reliable and stable and avoid crossed contamination to cause false-positive advantage.Use PCR detection method of the present invention and PCR detection kit; Both can be used for qualitative detection; Can be used for detection by quantitative again, its simple, quick, special and sensitive characteristics is suitable for Sucus Mali pumilae and the real and fake discrimination of concerned drink and the detection of allergen composition etc. on the domestic and international market.
Description of drawings
Fig. 1 is the gel electrophoresis figure that shows testing sample DNA extraction effect, wherein uses the plant universal primer to detect, and the sample of each swimming lane is following: M:DNA molecular weight marker (2000bp); 1: Chinese pear; 2: Huiyuan Pear Juice; 3: eat dream board pear juice; 4: the sea is pear juice too; 5: Huiyuan's pear flesh beverage; 6: juice drinks mixes in Huiyuan; 7: Guoguang apple; 8: bright fruit lures 100%; 9: Huiyuan's Sucus Mali pumilae; 10: happy living grows 100%; 11: Huiyuan's apple pulp beverage; 12: honey peach; 13: Huiyuan Peach Juice; 14: eat dream board peach juice; 15: the sea is peach juice too; 16: Huiyuan's peach fruit squash; 17: orange; 18: Kiwifruit; 19: tomato; 20: blank (sterilized water).
Fig. 2 shows the result who detects the class monellin gene of apple in the Sucus Mali pumilae through real-time fluorescence PCR, and wherein fluorescence curve 1-11 is followed successively by that positive control (Guoguang apple), bright fruit lure 100%, Huiyuan's Sucus Mali pumilae, happy living grow 100%, Huiyuan's apple pulp beverage, Huiyuan Pear Juice, eat dream board pear juice, peach juice, orange juice, Fructus actinidiae chinensis juice, tomato juice and blank.
Fig. 3 shows that real-time fluorescence PCR detects the result of the ITS region sequence of apple in the Sucus Mali pumilae, wherein fluorescence curve 1-11 be followed successively by that positive control (Guoguang apple), bright fruit lure 100%, Huiyuan's Sucus Mali pumilae, happy live grow 100%, Huiyuan's apple pulp beverage, pear juice, peach juice, orange juice, Fructus actinidiae chinensis juice, tomato juice and blank.
Embodiment
The present invention is further illustrated for mode through embodiment, but the present invention is not limited only to following examples.
Present embodiment is the extraction quality through the total DNA of use plant universal primer specimen.
Through detecting the endogenous reference gene chloroplast(id) trn gene that plant itself is had, extraction quality that can the total DNA of specimen.
The employed plant chloroplast trn gene universal primer sequence that is used for the plant-derived composition of test sample is SEQ ID NO:8 and SEQ ID NO:9 in the present embodiment.
In the present embodiment; Detected Chinese pear; Huiyuan Pear Juice (Beijing Huiyuan Food & Beverage Co., Ltd.; China); The sea too pear juice (sea too; Korea S); Pear flesh beverage (Beijing Huiyuan Food & Beverage Co., Ltd. of Huiyuan; China); Eat dream board pear juice (big lake (Tianjin) fresh provisions fruit juice company limited; China); Carefree pear juice is (carefree; Korea S); Guoguang apple; Bright Sucus Mali pumilae (Shanghai Bright Dairy & Food Co., Ltd.'s dairy factory; China); Sucus Mali pumilae (Beijing Huiyuan Food & Beverage Co., Ltd. of Huiyuan; China); Big lake Sucus Mali pumilae (big lake (Tianjin) fresh provisions fruit juice company limited; China); Happy living grown 100% Sucus Mali pumilae (the happy development in science and technology company limited of growing alive in Beijing; China); Honey peach; Huiyuan Peach Juice (Beijing Huiyuan Food & Beverage Co., Ltd.; China); Peach fruit squash (Beijing Huiyuan Food & Beverage Co., Ltd. of Huiyuan; China); Eat dream board peach juice (big lake (Tianjin) fresh provisions fruit juice company limited; China); The sea too peach juice (sea too; Korea S); Orange; Kiwifruit; The extraction quality of total DNA of tomato, and use duck as negative control.As shown in Figure 1, all can band occur during with the DNA of plant universal primer amplification testing sample, show that all testing sample DNA extraction successfully at about 159bp place.
The present inventor is the class monellin Gene Partial sequence through the PCR clone and the apple that checked order first.
Present embodiment is for obtaining the class monellin Gene Partial sequence of apple through the PCR cloning and sequencing.
In different plant varieties, have the characteristics of otherness according to class monellin gene intron, adopt apple class monellin gene order (Genbank No.AY792604) design upstream and downstream primer amplification apple.Operation instructions according to Wizard Gel Extraction Kit (Promega, the U.S.) is carried out purifying, recovery to apple PCR product.The specification sheets of pressing TaKaRa pMD 19-T Vector test kit (TaKaRa, Japan) is connected purified product with pMD19-T Vector, linked system 10 μ L, and its reactive component is: pMD19-T Vector 1 μ L, PCR product 2 μ L, ddH
2O 2 μ L, Solution I 5 μ L are provided with the positive and negative control simultaneously.Linked system is placed room temperature (22-37 ℃) reaction 30min, and reaction places on ice after finishing immediately.Add and connect product in 50 μ LTOP competent cells, flick mixing, ice bath 30min, 42 ℃ of accurate heat shock 90s place 2min on ice immediately, add gone out the brain heart infusion of bacterium of 800 μ L then, 37 ℃, 200r/min shaking culture 1h.5000r/min low-speed centrifugal 1min abandons 600 μ L supernatants, will precipitate mixing, gets 100 μ L mixed solutions and is applied on the nutrient agar plate that Amp+, X-Gal and IPTG handle, and 37 ℃ of incubated overnight are placed on 4h in 4 ℃ of refrigerators.Picking list bacterium colony hickie is cultivated at 37 ℃, 200r/min shaken overnight in the brain heart infusion of the Amp that contains final concentration 200 μ g/mL.
(1) positive colony is identified: the single white clone of picking; Carry out bacterium colony PCR reaction, system is 25 μ L, and its component is: reaction 10 * Buffer 2.5 μ L, dNTPs 1 μ L, each 0.5 μ L of upstream and downstream primer, Taq enzyme 0.2 μ L; Picking list bacterium colony adds water and mends to 25 μ L as template.Response procedures is: 94 ℃ of 5min, 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min, 40 circulations.The PCR product is identified through agarose gel electrophoresis.
(2) order-checking: after confirming positive colony, this bacterium colony of picking is cultivated at 37 ℃, 200r/min shaken overnight in the 5 μ L brain heart infusions that contain final concentration 200 μ g/mL Amp.Get 1mL bacterium liquid and send biotech firm's evaluation of checking order.
The apple class monellin Gene Partial sequence that the PCR cloning and sequencing obtains is following:
GCAAACAGGCAATTAAGACATATTCAATGTCGATGATGAAGAGCCAAGTAGCTTCCCTCCTCGGCCTCACCTTGGCCATCCTCTTCTTCTCAGGTAATATTATACAAACTTCTCATTATATTTTTTGTTCTTTTTGTTTCCTATTAGTCTCTAGTATATTGTATGCATGCCTGCCTGATGCAAATATGAGAGGGGTTAGTCCGCACTATATTGTAATACTGTTAAACGTGAAAGTAGGAAGTCTAAGAGAGAATAACGATGATGGATAATTCTGTGACGTCCACTAATAATTTTATTAAAACAAGGAGTACTAGTACTTTTTAAAAGGATACCGTAAAAGTTCTCAATCCGGCCACATATAAGTGAACTAACCAATGCGGCTAACATGAGATTAGATATATTTATAATTGTATGTAGATTTTTCAGTATCAATATTCTTAGTATCTAGTTCTATGTTGAACATAAATGCAGGTGCACATGCAGCGAAAATCACTTTCACAAACAACTGCCCCAACACTGTCTGGCCAGGAACCTTAACC(SEQ?ID?NO：10)。
Present embodiment is the class monellin gene order through primer sequence apple derived component in real-time fluorescence PCR specific detection sample of the class monellin gene that uses apple.SYBR fluorescence dye method: SYBR Green is high-sensitive DNA fluorescence dye, in various analyses, can detect 20pg DNA at least.The avidity of SYBR Green dyestuff and double-stranded DNA is very high, in PCR reaction, combines with product dsDNA the back fluorescent signal can strengthen 800-1000 doubly and the enzyme of using always in to molecular biology do not have restraining effect.SYBR Green PCR reaction system is: Faststart UniversalSYBR Green Master (Roche) 12.5 μ L; Each 0.5 μ L of upstream and downstream primer (10 μ mol/L); Dna profiling 5 μ L (about 50ng), using sterilized water to mend extremely total system is 25 μ L.Adopt Bio-RadiQTM5 multicolor real time PCR appearance to carry out pcr amplification and interpretation of result, amplification condition is following: 95 ℃ of preparatory sex change 10min; 95 ℃ of 10s, 58 ℃ of 30s, 40 circulations are carried out the melting curve analysis after the PCR reaction.
Primer sequence is: SEQ ID NO:1 and SEQ ID NO:2.
Employed detection key instrument:
Micropipet (10 μ L, 100 μ L, 1000 μ L Eppendorf), quantitative real time PCR Instrument (Mastercycler ep realplex4 Eppendorf), high speed tabletop centrifuge (Pico17 Thermo), high speed disintegrator (IKA-WEARKE GERMANY), gel imaging system (Gene Genius), electrophoresis apparatus (DYY22C type; Liuyi Instruments Plant, Beijing), nucleic acid-protein analyser (DYY-6C, Liuyi Instruments Plant, Beijing), freeze drier (Modulyod Freeze Dryer Thermo), ice-making machine (XB70GRANT) etc.
Detect main agents:
Taq enzyme, dNTPs, 10 * PCR Buffer, ethidium bromide, DNA Ladder Marker (2000) (Takara) give birth to worker company available from Shanghai; TaqMan Universal SYBR Green Master is available from Roche company; Primer (SEQ ID NO:1 and SEQ ID NO:2) is synthetic etc. by Shanghai AudioCodes bio tech ltd.
Detect key step:
1DNA extracts
Samples of juice to be measured is: bright fruit lures 100%, Huiyuan's Sucus Mali pumilae, happy living are grown 100%, Huiyuan's apple pulp beverage, Huiyuan Pear Juice, eaten dream board pear juice, peach juice, orange juice, Fructus actinidiae chinensis juice and tomato juice.
Get in the clean culture dish of 30mL sample to, vacuumize freeze-drying; Take by weighing in the clean 50mL centrifuge tube of the freezing dry-matter to of 0.2g, add the 5mLCTAB lysate (2%CTAB (W/V), 0.1mol/LTris-HCl, 20mmol/L EDTA, 1.4mol/LNaCl), 65 ℃ of 2h, interval continuous mixing several times; 8000rpm 15min; Get in 1mL supernatant liquor to the 1 clean 2.0mL centrifuge tube; Add 700 μ L chloroforms; Violent mixing 30s, 14500rpm 10min gets respectively in 650 μ L supernatant liquors to the clean 2.0mL centrifuge tube; Add 1300 μ L CTAB precipitated liquid (0.5%CTAB (W/V); 0.04mol/LNaCl), violent mixing 30s, room temperature leaves standstill 1h; 14500rpm 20min abandons supernatant liquor, adds 350 μ L 1.2M NaCl, and thermal agitation 30s adds 350 μ L chloroforms again, violent mixing 30s, 14500rpm 10min; Get supernatant liquor 320 μ L respectively, add 0.8 times of volume Virahol, behind the mixing ,-20 ℃ of 1h, 14500rpm 20min abandons supernatant liquor, adds 500 μ L, 70% ethanol, and behind the mixing, 14500rpm 20min abandons supernatant liquor, dries in the air to air-dry, adds 30 μ L ddH
2The O dissolving, 4 ℃ store for future use.
2 real-time fluorescence PCRs detect the primer
SEQ ID NO:1 and SEQ ID NO:2.
3 real-time fluorescence PCR reaction systems:
F?aststart?Universal?SYBR?Green?Master?12.5μL
Upstream primer (10 μ mol/L) 0.5 μ L
Downstream primer (10 μ mol/L) 0.5 μ L
Add ddH
2O to cumulative volume be 25 μ L
Annotate: each PCR detects and all sets up corresponding blank (ultrapure water with the preparation reaction system replaces dna profiling, and whether detection reagent is polluted);
4 real-time fluorescence PCR reaction parameters:
95℃ 10min
95℃ 10s
58℃ 30s
40 circulating reactions.
Annotate: different instruments should be done suitable adjustment with each reagent of PCR and reaction parameter.
As shown in Figure 2; When utilizing the class monellin gene order of apple in the real-time fluorescence PCR test sample; Guoguang apple, bright fruit lure 100%, Huiyuan's Sucus Mali pumilae, happy live grow 100%, the melting curve peak value of Huiyuan's apple pulp beverage pcr amplified fragment is all at 74.82 ± 1.0 ℃; And pear juice, peach juice, orange juice, Fructus actinidiae chinensis juice, tomato juice and blank all do not have this melting curve peak value, show that this primer can effectively detect the apple derived component in the sample.
With identical according to embodiment 3 described methods; Be template just with testing sample DNA; Adopt type primer sequence SEQ ID NO:1 of monellin gene and SEQ ID NO:2 and plant universal amplification primer to SEQ ID NO:8 and SEQ ID NO:9, carry out the double PCR amplification.
Present embodiment is the sequence through primer sequence apple derived component in real-time fluorescence PCR specific detection sample of the ITS gene that uses apple.Taqman fluorescent probe method: the TaqMan technology is a kind of technology of single tube PCR product being carried out the real time fluorescent quantitative detection; In the regular-PCR amplification system; Add one and the two fluorescence labeling probes of the special complementary of target-gene sequence; Utilize the fluorescent signal accumulation whole PCR process of monitoring in real time, through typical curve unknown template is carried out quantitative analysis at last.Quantitative step: confirm that 1. (C representes cycle number (Cycle) to the CT value, and T representes fluorescence thresholding (Threshold), the cycle number that is experienced when promptly the fluorescent signal in each reaction tubes arrives the thresholding of setting; 2. utilize typical curve that unknown sample is carried out quantitative assay.After obtaining the CT value of unknown sample, calculate the initial copy number of this sample from typical curve.There is linear relationship in the logarithm of the CT value of each template and the initial copy number of this template, and promptly initial copy number is many more, and the CT value is more little.Reaction system is: TaqMan Universal probe Master 12.5 μ L; Probe (10 μ mol/L) 0.5 μ L; Each 0.5 μ L of upstream and downstream primer (10 μ mol/L); Template DNA 5 μ L; Add ddH
2O to cumulative volume be 25 μ L.Response procedures is 95 ℃ of 10min; 95 ℃ of 15s; 60 ℃ of 1min.
The ITS gene primer sequence of apple derived component is in the employed test sample: upstream primer SEQ ID NO:3; Downstream primer SEQ ID NO:4; Probe SEQ ID NO:7.The TaqMan probe is a kind of oligonucleotide probe, and its fluorescence is relevant with the amplification of aim sequence.It is designed to and target sequence upstream primer and downstream primer between sequence pairing.Fluorophor FAM (6-Fluoresceincarboxylic acid (6-carboxy fluo-rescein)) and TAMRA are connected 5 ' end of probe, and quencher TAMAR (6-carboxyl rhodamine (6-carboxy tetramethyl rhodamine)) is then at 3 ' end.When the pairing of complete probe and target sequence, the fluorophor emitted fluorescence because of with the quencher of 3 ' end near cancellation.But when carrying out extension, 5 ' 5 prime excision enzyme activity of polysaccharase carries out enzyme with probe to be cut, and makes fluorophor separate with quencher.
Employed detection key instrument:
Micropipet (10 μ L, 100 μ L, 1000 μ L Eppendorf), quantitative real time PCR Instrument (ABI7700 Applied Biosystems, USA)), high speed tabletop centrifuge (Pico17 Thermo), high speed disintegrator (IKA-WEARKE GERMANY), gel imaging system (Gene Genius), electrophoresis apparatus (DYY22C type Liuyi Instruments Plant, Beijing), nucleic acid-protein analyser (DYY-6C Liuyi Instruments Plant, Beijing), freeze drier (Modulyod Freeze Dryer Thermo), ice-making machine (XB70GRANT) etc.
Detect main agents:
Taq enzyme, dNTPs, 10 * PCR Buffer, ethidium bromide, DNA LadderMarker (2000) (Takara) give birth to worker company available from Shanghai; TaqMan Universal probe Master is available from ABI company; Primer (upstream primer SEQ ID NO:3; Downstream primer SEQ ID NO:4; Probe SEQ ID NO:7.) synthetic etc. by Shanghai AudioCodes bio tech ltd.
Detect key step:
1DNA extracts
Samples of juice to be measured is: bright fruit lures 100%, Huiyuan's Sucus Mali pumilae, happy live grow 100%, Huiyuan's apple pulp beverage, pear juice, peach juice, orange juice, Fructus actinidiae chinensis juice and tomato juice.
Get in the clean culture dish of 30mL sample to, vacuumize freeze-drying; Take by weighing in the clean 50mL centrifuge tube of the freezing dry-matter to of 0.2g, add the 5mLCTAB lysate, 65 ℃ of 2h, interval continuous mixing several times; 8000rpm 15min gets in 1mL supernatant liquor to the 1 clean 2.0mL centrifuge tube, adds 700 μ L chloroforms; Violent mixing 30s, 14500rpm 10min gets respectively in 650 μ L supernatant liquors to the clean 2.0mL centrifuge tube; Add 1300 μ L CTAB precipitated liquid, violent mixing 30s, room temperature leaves standstill 1h; 14500rpm 20min abandons supernatant liquor, adds 350 μ L 1.2M NaCl, and thermal agitation 30s adds 350 μ L chloroforms again, violent mixing 30s, 14500rpm 10min; Get supernatant liquor 320 μ L respectively, add 0.8 times of volume Virahol, behind the mixing ,-20 ℃ of 1h, 14500rpm 20min abandons supernatant liquor, adds 500 μ L, 70% ethanol, and behind the mixing, 14500rpm 20min abandons supernatant liquor, dries in the air to air-dry, adds 30 μ L ddH
2The O dissolving, 4 ℃ store for future use.
2 real-time fluorescence PCRs detect the primer and probe
Primer sequence is: upstream primer SEQ ID NO:3; Downstream primer SEQ ID NO:4; Probe SEQ ID NO:7:
3 real-time fluorescence PCR reaction systems:
TaqMan?Universal?probe?Master?12.5μL
Probe (10 μ mol/L) 0.5 μ L
Upstream primer (10 μ mol/L) 0.5 μ L
Downstream primer (10 μ mol/L) 0.5 μ L
Add ddH
2O to cumulative volume be 25 μ L
Annotate: each PCR detects and all sets up corresponding blank (ultrapure water with the preparation reaction system replaces dna profiling, and whether detection reagent is polluted);
4 real-time fluorescence PCR reaction parameters:
95℃ 10min
95℃ 15s
60℃ 1min
Annotate: different instruments should be done suitable adjustment with each reagent of PCR and reaction parameter.
As shown in Figure 3; When utilizing the ITS gene order of apple in the real-time fluorescence PCR test sample; Guoguang apple, bright fruit lure 100%, Huiyuan's Sucus Mali pumilae, happy live grow 100%, pcr amplification all appears in Huiyuan's apple pulp beverage; And pear juice, peach juice, orange juice, Fructus actinidiae chinensis juice, tomato juice and blank all do not occur, and show that this primer probe can effectively detect the apple derived component in the sample.
With identical according to embodiment 5 described methods; Be template just with testing sample DNA; Primer sequence SEQ ID NO:3, SEQ ID NO:4 and the probe SEQ ID NO:7 of employing ITS gene and plant universal amplification primer carry out the double PCR amplification to SEQ ID NO:8, SEQ ID NO:9.
Embodiment 7
The present inventor clones and the partial sequence of chloroplast(id) rpl 16 genes of checked order apple and pears first.
DNA according to plant chloroplast rpl16 gene order design upstream and downstream primer amplification apple and pears.According to the operation instructions of Wizard Gel Extraction Kit the PCR product of apple and pears is carried out purifying, recovery.The specification sheets of pressing TaKaRa pMD19-T Vector test kit is connected purified product with pMD19-T Vector, linked system 10 μ L, and its reactive component is: pMD19-T Vector1 μ L, PCR product 2 μ L, ddH
2O 2 μ L, Solution I 5 μ L are provided with the positive and negative control simultaneously.Linked system is placed room temperature (22-37 ℃) reaction 30min, and reaction places on ice after finishing immediately.Add and connect product in 50 μ LTOP competent cells, flick mixing, ice bath 30min, 42 ℃ of accurate heat shock 90s place 2min on ice immediately, add gone out the brain heart infusion of bacterium of 800 μ L then, 37 ℃, 200r/min shaking culture 1h.5000r/min low-speed centrifugal 1min abandons 600 μ L supernatants, will precipitate mixing, gets 100 μ L mixed solutions and is applied on the nutrient agar plate that Amp+, X-Gal and IPTG handle, and 37 ℃ of incubated overnight are placed on 4h in 4 ℃ of refrigerators.Picking list bacterium colony hickie is cultivated in 37 ℃ of brain heart infusions, the 200r/min shaken overnight of the Amp that contains final concentration 200 μ g/mL.
(1) positive colony is identified: the single white clone of picking; Carry out bacterium colony PCR reaction, system is 25 μ L, and its component is: reaction 10 * Buffer 2.5 μ L, dNTPs 1 μ L, each 0.5 μ L of upstream and downstream primer, Taq enzyme 0.2 μ L; Picking list bacterium colony adds water and mends to 25 μ L as template.Response procedures is: 94 ℃ of 5min, 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min, 40 circulations.The PCR product is identified through agarose gel electrophoresis.
(2) order-checking: after confirming positive colony, this bacterium colony of picking, 37 ℃, the cultivation of 200r/min shaken overnight in the 5 μ L brain heart infusions that contain final concentration 200 μ g/mLAmp.Get 1mL bacterium liquid and send biotech firm's evaluation of checking order.
The partial sequence of chloroplast(id) rpl16 gene that the PCR cloning and sequencing obtains apple and pears is following:
Pears 159
TTAA
TAATCTATGGAATCGTGGGATTCTTTGAAATTTGATCTAATCGATTATAAATTAGAAATTTTTTGTGTTTTAATATATAATTTAACACGTATTTATATAATTTAACACGTATTCTATTTATAGATAATGTCGTTTT
GGTAGAACGCTATAATGAATCTTTATTT(SEQ?ID?NO：11)。
Apple 139
TTAA
TAATATATGGAATCGTGGGATTCTTTGAAATTCGATCTAATCGATTATAAATTAGAAATTTTTTGTGTTTTAATATAGAATTTAACACGTATTCTATTTATAGATAATGTCGTTTT
GGTAGAACGCTATAATGA ATCTTTATTT(SEQ?ID?NO：12)。
Sucus Mali pumilae relative content in PCR primer detection by quantitative apple through chloroplast(id) rpl16 gene and the pears fruit juice blends, the PCR primer that is used for the chloroplast(id) rpl16 gene of detection by quantitative fruit juice blends Sucus Mali pumilae relative content is:
SEQ?ID?NO：5
SEQ?ID?NO：6。
With this DNA to the primer amplification fruit juice blends, it is 159bp that apple becomes branch amplification PCR products length, and it is 139bp that pear juice becomes branch amplification PCR products length.Through on 2.5% agarose or 5% polyacrylamide gel, carrying out electrophoretic separation, can distinguish two kinds of PCR fragments, and quantitatively confirm apple and the shared ratio of pears in the mixing juice according to two kinds of segmental relative abundances of PCR.
Present embodiment provides the test kit of apple derived component in the rapid detection sample.
Said test kit comprise primer to SEQ ID NO:5, SEQ ID NO:6 and primer to SEQ IDNO:8, SEQ ID NO:9; And working instructions; Wherein primer is that to be used for the specific oligonucleotide primer of real-time fluorescence PCR test sample apple derived component right to SEQ ID NO:5, SEQID NO:6; SEQ ID NO:8, SEQ ID NO:9 are plant universal amplification primers; Provided the pcr amplification condition in the said working instructions; This condition is 95 ℃, 10min; 95 ℃, 15s; 58 ℃, 30s.For different instruments, reaction parameter is done suitable adjustment.
Present embodiment provides the test kit of apple derived component in the rapid detection sample.
Said test kit comprise primer to SEQ ID NO:1, SEQ ID NO:2 and primer to SEQ IDNO:8, SEQ ID NO:9; And working instructions; Wherein primer is that to be used for the specific oligonucleotide primer of real-time fluorescence PCR test sample apple derived component right to SEQ ID NO:1 and SEQID NO:2; SEQ ID NO:8, SEQ ID NO:9 are plant universal amplification primers; Provided the pcr amplification condition in the said working instructions; This condition is 95 ℃, 10min; 95 ℃, 15s; 60 ℃, 1min.For different instruments, reaction parameter is done suitable adjustment.
Present embodiment provides the test kit of apple derived component in the rapid detection sample.
Said test kit comprises that primer SEQ ID NO:3 and SEQ ID NO:4 and probe SEQ IDNO:7 and primer are to SEQ ID NO:8, SEQ ID NO:9; And working instructions; Wherein primer is that to be used for the specific oligonucleotide primer of real-time fluorescence PCR test sample apple derived component right to SEQ ID NO:3 and SEQ ID NO:4 and probe SEQ ID NO:7; SEQ ID NO:8, SEQ ID NO:9 are plant universal amplification primers; Provided the pcr amplification condition in the said working instructions; This condition is 95 ℃, 10min; 95 ℃, 15s; 60 ℃, 1min.For different instruments, reaction parameter is done suitable adjustment.
Though specific embodiments of the present invention is described, those skilled in the art will appreciate that under the prerequisite that does not depart from scope of the present invention or spirit and can carry out multiple change and modification to the present invention.Thereby, this invention is intended to contain all these changes and modification of dropping in Rights attached thereto claim and the coordinator scope thereof.
Claims (9)
1. the specific oligonucleotide primer that is used for real time fluorescent PCR method test sample apple derived component is right, and wherein said primer is to being selected from one or more of following primer centering: SEQ ID NO:1 and SEQ ID NO:2; SEQ ID NO:3 and SEQ ID NO:4; And SEQ ID NO:5 and SEQ ID NO:6.
2. Oligonucleolide primers according to claim 1 is right, and wherein said primer is to being SEQ ID NO:5 and SEQ ID NO:6.
3. Oligonucleolide primers according to claim 1 is right, and wherein said real time fluorescent PCR method is a SYBR fluorescence dye method, and said primer is to being SEQ ID NO:1 and SEQ ID NO:2.
4. Oligonucleolide primers according to claim 1 is right, and wherein said real time fluorescent PCR method is a Taqman fluorescent probe method, and said primer is to being SEQ ID NO:3 and SEQ ID NO:4, and employed probe is SEQ ID NO:7.
5. the real-time fluorescence PCR detection method of apple derived component in the sample, said method comprise that to use among the claim 1-4 each described specific oligonucleotide primer right.
6. real-time fluorescence PCR detection method according to claim 5 also comprises and uses plant chloroplast trn gene universal primer sequence SEQ ID NO:8 and SEQ ID NO:9.
7. the test kit of apple derived component in the rapid detection sample, said test kit comprise among the claim 1-4 each described specific oligonucleotide primer to and working instructions.
8. test kit according to claim 7, wherein said test kit also comprise plant chloroplast trn gene universal primer sequence SEQ ID NO:8 and SEQ ID NO:9.
Among the claim 1-4 each described specific oligonucleotide primer to the application in the apple derived component in test sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010240507 CN102344952B (en) | 2010-07-30 | 2010-07-30 | Primer, method and kit for detecting apple-derived materials in sample |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010240507 CN102344952B (en) | 2010-07-30 | 2010-07-30 | Primer, method and kit for detecting apple-derived materials in sample |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102344952A true CN102344952A (en) | 2012-02-08 |
| CN102344952B CN102344952B (en) | 2013-06-19 |
Family
ID=45544025
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010240507 Expired - Fee Related CN102344952B (en) | 2010-07-30 | 2010-07-30 | Primer, method and kit for detecting apple-derived materials in sample |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102344952B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107475391A (en) * | 2017-08-23 | 2017-12-15 | 黄埔出入境检验检疫局综合技术服务中心 | Arctic apple specificity real-time fluorescent PCR testing primer, probe, method and kit |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701908A (en) * | 2015-11-18 | 2017-05-24 | 中国检验检疫科学研究院 | Primers, probe and method for detecting lotus root-sourced component and kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101643786A (en) * | 2009-05-15 | 2010-02-10 | 天津出入境检验检疫局动植物与食品检测中心 | Method for detecting allergen almond component in foods by fluorescent PCR technology |
| CN101736024A (en) * | 2010-01-22 | 2010-06-16 | 昆明理工大学 | Thaumatin-like protein gene PpTLP from pyrus pyrifolia nakai with antifungal activity and application |
-
2010
- 2010-07-30 CN CN 201010240507 patent/CN102344952B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101643786A (en) * | 2009-05-15 | 2010-02-10 | 天津出入境检验检疫局动植物与食品检测中心 | Method for detecting allergen almond component in foods by fluorescent PCR technology |
| CN101736024A (en) * | 2010-01-22 | 2010-06-16 | 昆明理工大学 | Thaumatin-like protein gene PpTLP from pyrus pyrifolia nakai with antifungal activity and application |
Non-Patent Citations (4)
| Title |
|---|
| GAO,Z.S.ET AL.: "Malus x domestica clone M2-FS1 thaumatin-like protein precursor (Mal d 2.01A) gene, complete cds", 《GENBANK: AY792601.1》 * |
| 沈夏艳等: "苹果汁中DNA 提取方法的比较及RAPD扩增研究", 《中国食品学报》 * |
| 韩建勋等: "果汁中梨成分分子生物学鉴伪-实时荧光PCR方法研究", 《中国食品学报》 * |
| 韩建勋等: "苹果汁鉴伪技术研究进展", 《食品科技》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107475391A (en) * | 2017-08-23 | 2017-12-15 | 黄埔出入境检验检疫局综合技术服务中心 | Arctic apple specificity real-time fluorescent PCR testing primer, probe, method and kit |
| CN107475391B (en) * | 2017-08-23 | 2020-11-13 | 黄埔出入境检验检疫局综合技术服务中心 | Primer, probe, method and kit for specific real-time fluorescent PCR (polymerase chain reaction) detection of apples at arctic |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102344952B (en) | 2013-06-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103194444B (en) | SNP (single nucleotide polymorphism) site and CAPS (cleaved amplified polymorphic sequence) mark interlocked with citrullus lanatus fruit bitter taste gene Bt (bitterness) | |
| CN102344953B (en) | Primer for detecting peach-derived component in sample, method and kit | |
| CN102965438B (en) | Duplex polymerase chain reaction (PCR) detection primer group, kit and method for pathogenic channa source aeromonas schubertii | |
| CN105648071A (en) | SNP (single nucleotide polymorphism) marker and method for identifying MC1R (melanocortin receptor 1) genes of pig breeds and colors of pig breeds as well as application | |
| CN101974524B (en) | Primer, probe, kit and method used for authenticating truth of spotted deer antler | |
| CN102816778B (en) | Mutant gene of rice starch branching enzyme SBE3 gene and application of mutant gene | |
| CN102344951B (en) | Primer, method and kit for detecting pear-derived components in sample | |
| CN110567951A (en) | Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof | |
| CN110093450A (en) | A kind of LAMP detection primer and its application of sweet potato black rot pathogen | |
| CN101967516B (en) | Vibrio cholerae typing and virulence gene detection kit and detection method | |
| CN108285927A (en) | Molecular labeling Caps7 and its application in a kind of gene of rice Cd accumulation related gene OsHMA3 | |
| CN110066880A (en) | A kind of method of four large Chinese carp fish product of fast qualitative detection | |
| CN104313128A (en) | Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum | |
| CN102344952B (en) | Primer, method and kit for detecting apple-derived materials in sample | |
| CN101701258B (en) | Primer for PCR identification of kidney bean and PCR identification method | |
| CN104293957B (en) | A kind of early stage rapid molecular detection method of Botrytis cinerea | |
| CN102433323B (en) | Extraction method of high-quality genome DNA from endosperm of single rice grains | |
| CN102703604A (en) | Kit for rapidly detecting banana bunchy top virus by isothermal gene amplification and use method of kit | |
| CN1837364B (en) | Real-time fluorescence PCR immobilization kit of wheat dwarf bunt germ (Tilletia controversa kuhn) and its detection method | |
| CN110184376A (en) | The PCR-RFLP discrimination method of Armillaria gallica | |
| CN104498593A (en) | Primer pair and kit for identification or assisted identification of stored bean weevils | |
| CN100395346C (en) | Primer for detecting Listern nucleotide segment of monocellular hyperplasia and probe sequence | |
| CN106868185A (en) | A kind of specific primer group and its application for detecting rat derived component | |
| CN100395348C (en) | Primer for detecting E. coli 0157:H7 nucleotide segment and probe sequence | |
| CN112280890A (en) | Primer and probe combination for detecting peronophythora litchi based on RPA-lateral flow chromatography technology and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Chen Ying Inventor after: Huang Wensheng Inventor after: Han Jianxun Inventor after: Wu Yajun Inventor after: Ge Yiqiang Inventor after: Deng Tingting Inventor before: Chen Ying Inventor before: Huang Wensheng Inventor before: Han Jianxun Inventor before: Wu Yajun Inventor before: Deng Tingting |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: CHEN YING HUANG WENSHENG HAN JIANXUN WU YAJUN DENG TINGTING TO: CHEN YING HUANG WENSHENG HAN JIANXUN WU YAJUN GE YIQIANG DENG TINGTING |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130619 Termination date: 20200730 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |