CN100395346C - Primer for detecting Listern nucleotide segment of monocellular hyperplasia and probe sequence - Google Patents

Abstract

The present invention relates to a PCR amplification primer and a probe sequence for mononuclear cell hyperplasia Listeria nucleotide segments. A primer sequence comprises a primer sequence obtained in a region range of a primer pair (composed of an upstream primer LMF1420 with a sequence of CTGAATCTCAAGCAAAACCTGGT and a downstream primer LMR1593 with a sequence of CGCGACCGAAGCCAACTA), 10 basic groups (extended in the 5' end direction from the upstream primer LMF1420 of the primer pair), 10 basic groups (extended in the 3' end direction from the upstream primer LMF1420), 9 basic groups (extended in the 3' end direction from the downstream primer LMR1593) and 5 basic groups (extended in the 5' end direction from the downstream primer LMR1593). The probe sequence comprises a probe sequence obtained in a region range of 9 basic groups (extended in the 3' end direction from a probe LM-p1 with a sequence of ATACGATAACATCCACGGCTCTGGCTGG) and 10 basic groups (extended in the 5' end direction from the probe LM-p1).

Description

A kind of primer and probe sequence that is used to detect monocyte hyperplasia listeria spp nucleotide fragments

Technical field

The present invention relates to a kind of primer and probe sequence that is used to detect monocyte hyperplasia listeria spp nucleotide fragments.

Background technology

Monocyte hyperplasia listeria spp (hereinafter to be referred as Listeria monocytogenes) is pathogenic bacterium common in the import and export food, also be to cause poisoning by food and the The main pathogenic fungi of food origin disease, humans and animals trouble meningitis, encephalitis, septicemia, endocarditis, miscarriage, abscess and the infringement of partial purulence can be caused, and diseases such as the pregnant woman miscarries, stillborn foetus can be caused.Send out patient's mortality ratio and can reach 30～70%.The foodborne illness that the World Health Organization (WTO) causes about Listeria monocytogenes is pointed out in reporting: 4～8% fishery products, and 5～10% milk and milk preparation, the meat product more than 30%, the birds meat products more than 15% are all by this fungi pollution.But because this bacterium also growth and breeding in the food that 4 ℃ of refrigerators are preserved, so will impel its hazardness further to increase.In 2002 the 25th of State Administration for Quality Supervision and Inspection and Quarantine and 26 commands clearly the regulation Listeria monocytogenes be essential items for inspection.Present detection to this bacterium, GB and the rower traditional flat board cultivation or the methods of integrated enzyme reaction (ELISA) of adopting more, these method stepss are loaded down with trivial details, waste time and energy, generally take 4-6 consuming time days at least, and because the influence of multiple interfering factors, the accuracy of detected result reduces easily, has brought very adverse influence for the import and export of food.Therefore, it is imperative to set up a kind of pathogenic bacterium detection method quicker, accurate, easy and simple to handle.

Domestic and international application mainly is divided three classes: regular-PCR technology, fluorescent PCR technology and biochip technology in the Protocols in Molecular Biology that foodborne bacterial pathogens detects at present.Method for gene chip detection efficiency height, but technology that is that all right is ripe, false positive rate and false negative rate all are difficult to control, and cost is higher, also is in conceptual phase at present.Regular-PCR method and technology maturation also is used for the detection of foodborne bacterial pathogens the earliest, but need carry out aftertreatment to the PCR product, very easily causes the PCR product pollution, and certain non-specific amplification is arranged.Fluorescent PCR is on the basis of regular-PCR, adds a specific fluorescent probe again in a pair of Auele Specific Primer of adding in amplification reaction system, uses the fluorescent PCR detector of monitoring in real time to detect the technology of target nucleotide sequences.Except the advantage with regular-PCR, it also has the following advantages: (1) specificity is stronger, and sensitivity is higher.Since used more one can with the fluorescent probe of template complementary pairing, improved specificity, and collected fluorescent signal by self-reacting device, avoided the subjectivity of artificial judgment, can further improve sensitivity again.(2) totally-enclosed reaction, online real-time monitoring fluorescence, aftertreatment that need not the PCR product is avoided polluting, and has guaranteed result's reliability.(3) data analysis is selected in the logarithmic phase of nucleic acid amplification, abandons the multifactor interferential end point analysis method that is subjected to of regular-PCR method, makes quantitatively more accurately and reliably.(4) can realize the two inspections of single tube or many inspections, also can design mark in the specific aim, monitoring extraction efficiency and get rid of inhibitor and disturb.(5) do not contact toxic reagent, operational safety.(6) help mass-producing, automatization and network management.(7) scope of application is wider, can detect the nucleic acid of any bacterium in theory.

Summary of the invention

The purpose of this invention is to provide a kind of primer and probe sequence that is used to detect the Listeria monocytogenes nucleotide fragments.

Based on above-mentioned purpose, the present invention by the following technical solutions:

The primer and the probe sequence that are used to detect the Listeria monocytogenes nucleotide fragments comprise:

1. a primer that is used to detect monocyte hyperplasia listeria spp (hereinafter to be referred as Listeria monocytogenes) nucleotide fragments is right, it is characterized in that described primer is to being: by sequence is that the primer formed of the upstream primer LMF1420 of CTGAATCTCAAGCAAAACCTGGT and downstream primer LMR1593 that sequence is CGCGACCGAAGCCAACTA is right.

2. a probe that is used to detect the Listeria monocytogenes nucleotide fragments is characterized in that described probe LM-p1 sequence is ATACGATAACATCCACGGCTCTGGCTGG.

Concrete principle of the present invention is to utilize Auele Specific Primer and a specificity fluorescent probe of a pair of target nucleotide sequences, adopt hot resistant DNA polymerase (Taq enzyme), four kinds of nucleotide monomer compositions such as (dNTP), and use the nucleic acid fragment amplification that round pcr is realized target nucleotide sequences.Employed probe is the oligonucleotide of two ends difference mark fluorescent reporter group (R) and fluorescent quenching group (Q).When probe is complete, the reporter group fluorescent signal emitted is absorbed by quenching group, and in the pcr amplification process, 5 ' end 5 prime excision enzyme activity of Taq enzyme is cut degraded with the fluorescent probe enzyme of specific combination on the target nucleotide fragment, the fluorescence report group is free in the reaction system, the shielding effect that has broken away from the fluorescent quenching group, the fluorescent signal of fluorescence report group just can by instrument detecting to, the variation of fluorescent signal amount is directly proportional with the amplified production amount, thereby judges the existence of target nucleotide sequences in the sample to be tested.

Description of drawings

Fig. 1 utilizes primer LMF1420/LMR1593 and probe LM-p1 to be detected the fluorescent PCR amplification figure of Listeria monocytogenes positive.

Embodiment

1. primer and probe design: by respectively all known Listeria monocytogenes genome sequences being compared analysis, select the section (Listeria monocytogenes iap gene) of no secondary structure and high conservative, design many to primer and probe, primer length is generally about 20 bases, between primer and primer in no complementary sequence.Optimum primer, probe sequence make up as follows:

Upstream primer LMF1420:CTGAATCTCAAGCAAAACCTGGT

Downstream primer LMR1593:CGCGACCGAAGCCAACTA

Probe LM-p1:ATACGATAACATCCACGGCTCTGGCTGG

2. the foundation of reaction system and optimization: the target region template that is adopted in the foundation of reaction system and the optimization obtains with following method: get Listeria monocytogenes reference culture recovery back and cultivated 48 hours, get nutrient solution 1ml and carry out 10 times of gradient dilutions, choose 10 ^-1, 10 ^-2, 10 ^-3, 10 ^-4, 10 ^-5, 10 ^-6Totally 6 extent of dilution are as serial positive template, extract genomic nucleic acids respectively, carry out pcr amplification with the primer and the probe of the longest amplified fragments in the above-mentioned detection sequence area respectively again, and the template when getting wherein person between the Ct value 24-27 as reaction system optimization later on.

2.1 the optimization of primer concentration is in reaction system, the primer concentration of Listeria monocytogenes is done to detect after the multiple proportions serial dilution from 0.1 μ mol/L to 0.8 μ mol/L respectively, analysis by test-results is compared, and determines that best primer final concentration is 0.2 μ mol/L.

2.2 under the constant prerequisite of the optimization of magnesium ion concentration other condition in reaction system, with MgCl ₂Concentration increase progressively with 0.5mmol/L from 1mmol/L to 2.5mmol/L, be magnesium ion concentration in the test kit reaction system through the selected 2.5mmol/L of repeated experiments repeatedly.

2.3Taq the optimization of archaeal dna polymerase (Taq enzyme) consumption is by comparing the optimization experiment result of Taq enzyme dosage (in the Unit of unit), selected 2U is as the consumption of Taq enzyme in the test kit reaction system.

2.4dNTPs the optimization of concentration detects by the dNTPs that uses different concns, selects the usage quantity of 0.2mmol/L as dNTPs in the test kit reaction system after the comprehensive assessment.

2.5 the optimization of concentration and probe concentration is in reaction system, the concentration and probe concentration of Listeria monocytogenes is done to detect after the multiple proportions serial dilution from 0.05 μ mol/L to 0.2 μ mol/L respectively, analysis by test-results is compared, and determines that best probe final concentration is 0.1 μ mol/L.

Utilize above-mentioned primer and probe to carry out the foundation of reaction system, determine that at last the fluorescent PCR reaction system that adopts is 40 μ l systems, required each component and respective concentration see Table 1.

PCR reaction system after table 1 is optimized

Component	Final concentration
		10 * PCR reaction buffer	1×
Mg 2+Concentration	2.5mmol/L
		DNTPs (containing dUTP)	0.2mmol/L
The Taq enzyme	2U
		Primer (upstream)	0.2μmol/L
Primer (downstream)	0.2μmol/L
		Probe	0.1μmol/L
Template	2μl
		Moisturizing extremely	40μl

Annotate: a. at the fluorescent PCR reaction volume not simultaneously, each reagent should be adjusted in proportion.

B. the instrument difference of Shi Yonging should be done reaction parameter suitably to adjust.

3. the selection of instrument detecting passage: when carrying out the fluorescent PCR reaction, the collection of tackling reaction tubes fluorescent signal in the used instrument is provided with, and the fluorescence detection channel of selection is consistent with the fluorescence report group of probe institute mark.Concrete method to set up is different because of instrument, should be with reference to the instrument working instructions.

4.PCR it is as follows that condition is selected:

95 ℃ of 2min, 1 circulation;

95 ℃ of 5sec, 60 ℃ of 40sec, 40 circulations.

5. detection step:

(1) chooses primer and probe;

(2) prepare template to be measured, can adopt phenol-chloroform method to extract the genomic dna of Listeria monocytogenes in the sample of various sources;

(3) foundation of reaction system: a, determine best primer concentration; B, determine magnesium ion concentration; C, determine Taq archaeal dna polymerase (Taq enzyme) consumption; D, determine dNTPs concentration; E, determine concentration and probe concentration;

(4) sense channel of selection instrument;

(5) go up machine testing.

6. embodiment

Choose primer to LMF1420/LMR1593 and probe LM-p1, with Listeria monocytogenes nutrient solution to be checked phenol-chloroform method extracting genomic dna.Concrete steps are as follows:

(1) Listeria monocytogenes enrichment liquid to be checked (about 1ml) is added in the centrifuge tube of 1.5ml, centrifugal 5 minutes of 12000rpm removes supernatant.

(2) add dna cleavage liquid 700ul, fully mixing is resuspended, and water-bath was boiled 5 minutes.

(3) add isopyknic phenol-chloroform (V/V=1: 1) solution, fully centrifugal behind the mixing, centrifugal 5 minutes of 13000rpm.

(4) supernatant liquor is moved in the centrifuge tube of another 1.5ml, add isopyknic chloroform, mixing, centrifugal 5 minutes of 13000rpm.

(5) supernatant liquor is moved in the centrifuge tube of another 1.5ml, add the Virahol of 0.6 times of volume, the mixing that turns upside down, centrifugal 5 minutes of 13000rpm.

(6) use 70% alcohol flushing after abandoning supernatant, centrifugal 5 minutes of 13000rpm, the careful suction abandoned supernatant, and inversion is dried.

(7) in dried centrifuge tube, add the abundant mixing of 50ul DNA lysate, stand-by as dna profiling.

In 40ul fluorescent PCR reaction system, add the above Listeria monocytogenes genomic dna 2ul that extracts, carry out fluorescent PCR according to aforementioned PCR reaction conditions and detect.After testing, then show positive amplification curve if contain Listeria monocytogenes in the nutrient solution to be checked, its detection sensitivity can reach 1000 copy/ml; Then do not have amplified signal if do not contain Listeria monocytogenes in the nutrient solution to be checked, point out above-mentioned primer having good sensitivity and specificity with probe.

7. advantage of the present invention:

(1) detection sensitivity of primer provided by the invention and probe can reach 1000 copy/ml, illustrates that it has good sensitivity.

(2) primer provided by the invention and probe without amplified signal, illustrate that it has good specificity for the detection sample standard deviation that does not contain Listeria monocytogenes.

(3) because the present invention adopts the endogenous gene iap gene of Listeria monocytogenes as the genes of interest of amplification, avoided the generation of false negative result.

(4) because the present invention adopts Fluorescence PCR assay as detection method, whole reaction is all carried out in the reaction tube of sealing, has avoided other nucleic acid detection methods such as PCR-electrophoresis etc. to be easy to form Aerosol Pollution and causes false positive results; Because the PCR product is carried out Real-Time Monitoring, greatly saved monitoring time, saved manpower and materials.

＜110〉Shenzhen Taitai Genetic Engineering Co., Ltd.

＜120〉a kind of primer and probe sequence that is used to detect monocyte hyperplasia listeria spp nucleotide fragments

<140>CN200410051208.2

<141>2004-08-20

<160>6

<170>PatentIn version 3.3

<210>1

<211>23

<212>DNA

＜213〉artificial sequence

<400>1

ctgaatctca agcaaaacct ggt 23

<210>2

<211>18

<212>DNA

＜213〉artificial sequence

<400>2

cgcgaccgaa gccaacta 18

<210>3

<211>28

<212>DNA

＜213〉artificial sequence

<400>3

atacgataac atccacggct ctggctgg 28

Claims (2)

1. a primer that is used to detect monocyte hyperplasia listeria spp (hereinafter to be referred as Listeria monocytogenes) nucleotide fragments is right, it is characterized in that described primer is to being: by sequence is that the primer formed of the upstream primer LMF1420 of CTGAATCTCAAGCAAAACCTGGT and downstream primer LMR1593 that sequence is CGCGACCGAAGCCAACTA is right.

2. a probe that is used to detect the Listeria monocytogenes nucleotide fragments is characterized in that described probe LM-p1 sequence is ATACGATAACATCCACGGCTCTGGCTGG.