CN102321624A - Primer sequence for internal reference gene amplification in quantitative PCR (polymerase chain reaction) analysis of gene expression of growth hormone of Clarias leather - Google Patents
Primer sequence for internal reference gene amplification in quantitative PCR (polymerase chain reaction) analysis of gene expression of growth hormone of Clarias leather Download PDFInfo
- Publication number
- CN102321624A CN102321624A CN201110252308A CN201110252308A CN102321624A CN 102321624 A CN102321624 A CN 102321624A CN 201110252308 A CN201110252308 A CN 201110252308A CN 201110252308 A CN201110252308 A CN 201110252308A CN 102321624 A CN102321624 A CN 102321624A
- Authority
- CN
- China
- Prior art keywords
- primer
- amplification
- qpcr
- rrna
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to a nucleotide sequence of two pairs of primers for internal reference gene (18S rRNA) amplification in qPCR (quantitative polymerase chain reaction) analysis of gene expression of GH (growth hormone) of Clarias leather, which is characterized in that: the two pairs of primers not only can be used as amplification primers of the internal reference gene (18S rRNA) in the qPCR analysis of gene expression of GH of Clarias leather, but also can be used as the amplification primers of the internal reference gene (18S rRNA) in the qPCR analysis of target gene-to-be-tested expression of the Clarias leather. The two pairs of primers not only can be applied to the research of the Clarias leather, but also can be applied to the research that 18S rRNA is taken as the internal reference gene in the qPCR analysis of target gene-to-be-tested expression of other Siluriformes fishes.
Description
Technical field
The invention belongs to the technical field of molecular biology of mechanism research.Be particularly related to a kind of leather beard Nian (Clarias gariepinus) in breeding process with the relevant important endocrine factor of growth---leather beard Nian growth hormone gene is expressed and is used for the primer sequence that internal control gene increases in the quantitative PCR analysis.
Background technology
Leather beard Nian has characteristics such as hypoxia-resistant capacity is strong, growth is fast, disease is few, is the good aquaculture kind of a kind of development prospect, cultures very general at home and abroad.This fishing gear has that protein contnt is high, nutritious, meat flavour is delicious on edibleness, the many characteristics of the few meat of thorn, and have nourishing effects, for operation wound heal significant assisting therapy effect is arranged.The research of leather beard Nian is mainly concentrated on the research of artificial propagation and seed rearing, aquaculture model and cultural technique thereof both at home and abroad; And few to the research report of the fundamental biological knowledge aspect of leather beard Nian, mainly contain its sexual hormoue, tissue to the accumulation of ammonia, to the histopathological response of some chemical substance in the water and to the researchs such as accumulation of heavy metal ion in the water.And beard Nian growth is rapid, the fundamental research of the mechanism of strong stress resistance does not appear in the newspapers to removing from office.
The growth of fish is identical with other vertebratess, is the bio-metabolic process of a complicacy, receives many-sided influences such as genotype, hormone, nutrition, environment.Its first-selection of research to growth of animal mechanism is to start with from growth axis, growth axis be in the animal body from hypothalamus a series of hormones of---hypophysis---target organ and the neuroendocrine system that acceptor is formed thereof.Wherein, tethelin (GH) is the important endocrine factor of regulation and control vertebrates growth, also is to zoologize the most important factor of growth.GH is except the growth to fish has very strong promoter action, simultaneously to immunity system, reproductive physiology and the seawater flexibility of fish also important influence.Also have research to show that the GH gene pleiomorphism is relevant with the production performance of animal in addition.
Key factor GH from the fish growth axle starts with, and analyzes through the real time fluorescent quantitative poly Kettenreaktion (qPCR) of GH genetic expression, inquires into the high-density breeding leather beard Nian mechanism of growth fast.QPCR for genetic expression analyzes, and should have and intend the target gene of analyzing, and suitable internal control gene is arranged again.Internal control gene commonly used has beta-actin, 18S rRNA and GAPDH gene.In qPCR, primer sequence is most important concerning the specificity of product and effective amplification.Have only suitable oligonucleotide sequence, in qPCR, satisfy following 3 conditions simultaneously: the first, utilize higher concentration cDNA (as diluting 5～10 times cDNA after the reverse transcription) C when carrying out qPCR
TValue should be less than 18～20; The second, the melting curve of each reaction should be 1 peak; The 3rd, should be through setting up the amplification efficiency that typical curve draws at 90～105% (R of typical curve
2Value should be greater than 0.98, repeated sample C
TThe standard deviation of value answers≤0.5).The oligonucleotide sequence of this moment could be as the primer of qPCR.
Although the qPCR technology is ripe, has become at present and carried out the quantitative diversity ratio of gene expression dose authoritative method between different samples.In the past 10 in the period of, this method is popular rapidly, a piece of writing surplus the article of publication surpasses 20,000 relates to medical science, environment and farming research.But in using this technological experimentation, need researchist oneself design and detect primer whether can be used for qPCR.
Do not remove from office at present beard Nian related objective genetic expression qPCR and analyze suitable primer nucleotide sequence, especially for the primer nucleotide sequence of internal control gene amplification.
Summary of the invention
The object of the invention provides a kind of leather beard Nian growth hormone gene and expresses the primer nucleotide sequence that quantitative PCR (qPCR) is used for the internal control gene amplification in analyzing, and provides the instrument of the fundamental research of mechanism rapidly of growing to leather beard Nian that is beneficial to.
The present invention's design has also detected 2 pairs of target genes (GH) and 4 pairs of internal control genes (each 2 couples of beta-actin and 18S rRNA) primer sequence, and wherein the primer of 1 pair of target gene and 2 pairs of internal control genes meets the requirement of qPCR.The primer that the invention has the advantages that the internal control gene amplification is used extensively, the GH gene expression analysis that not only can be used to remove from office beard Nian, and the qPCR that can be used for arbitrary gene of this kind fish in theory analyzes; In addition, the GenBank retrieval is thought, the amplimer of 2 pairs of internal control genes of application, and the qPCR that also can be used for the genetic expression of some other Silurformes fish analyzes.This invention is laid a good foundation for the fundamental research of leather beard Nian and several kinds of Silurformes fish.
Particular content of the present invention
A kind of leather beard Nian GH genetic expression qPCR is used for the nucleotide sequence of 2 pairs of primers of internal control gene (18S rRNA) amplification when analyzing, its characteristic is seen table 1
The primer nucleotide sequence information that table 1 is applied for a patent
The amplimer of internal control gene (18S rRNA) when two pairs of primers in the table not only can be used as leather beard Nian GH genetic expression qPCR analysis; And can be used as all target genes to be checked of leather beard Nian and express qPCR when analyzing, be the amplimer of internal control gene with 18S rRNA.
Two pairs of researchs that primer not only can be applicable to remove from office beard Nian in the table, the target gene to be checked that also can be applicable to some other Silurformes fish express qPCR when analyzing with the research of 18S rRNA as internal control gene.
Leather beard Nian GH genetic expression qPCR is used for the making method of 2 pairs of primer nucleotide sequences of internal control gene (18S rRNA) amplification when analyzing:
One, the extraction of general RNA
Use total RNA that Trizol reagent extracts single hypophysis, detect, analyze its integrity and purity through agarose gel electrophoresis and spectrophotometer.Fig. 1 agarose gel electrophoresis result shows: the ratio of the band brightness of the 28S/18S rRNA of RNA sample is between 1～2, and the integrity of prompting RNA sample is better; And the OD of RNA sample in the table 2
260/OD280And OD
260/OD230Ratio all between 1.8～2.0, show that these two RNA samples do not have the pollution of albumen and phenol, all can be used for the qPCR experiment.
The spectrophotometer detected result of the total RNA of table 2
Two, the reverse transcription of RNA
The reverse transcription of above-mentioned No. 1 RNA sample is become cDNA article one chain (RevertAid
TMCDNA article one chain synthetic agent box), be used for the assessment of the primer that designs.
Three, primer design and conventional PCR assessment
1) .GH, 18S rRNA and beta-actin gene fragment amplification primer design
Target gene to be checked is GH in this test, intends with 18S rRNA or beta-actin as internal control gene.GH gene amplification primer is according to this laboratory clone's leather beard Nian GH full-length cDNA (GenBank searching number: FJ823972), (the GenBank searching number: AJ876383) (the GenBank searching number: HM768299) sequence, Using P rimer 5.0 designs with beta-actin according to the 18SrRNA of GenBank retrieval respectively for the amplimer of 18S rRNA and beta-actin gene.According to the fundamental principle of qPCR and design of primers, from the tens of of design preliminary election the primer is gone out each 2 pairs of the primers of GH, 18S rRNA and beta-actin amplification, and it is synthetic to give birth to worker's biotechnology ltd by Shanghai, its primer information such as table 3.
Table 3 design synthetic primer information
2). the conventional PCR assessment of primer
At first, be template to dilute 10 times cDNA, according to the Tm value of 6 pairs of primers of synthetic, carry out conventional pcr amplification, so that primer is carried out entry evaluation.The agarose gel electrophoresis result of Fig. 2 .1 and Fig. 2 .2 shows: 6 pairs of primers all can amplify good fragment, and the clip size that clip size produces during with design of primers conforms to, so further 6 pairs of primers are carried out the qPCR analysis and assessment.
Four, the qPCR of primer assessment
Use the IQ of U.S. BioRad company
TMThe SsoFast EvaGreen qPCR premixed liquid of 5 qPCR appearance and the said firm according to the specification sheets of this premixed liquid, carries out the qPCR assessment to 6 pairs of primers that design.
1). the qPCR entry evaluation of primer
Be template at first, use identical annealing temperature, GH, 18S rRNA and beta-actin gene fragment are carried out qPCR (each reaction do 2 parallel), according to the C that draws with conventional PCR to dilute 10 times cDNA
TValue (table 4) is carried out entry evaluation to 6 pairs of primers.
The related data of table 4 primer in the qPCR test
In this part test, the melting curve that the every pair of primer obtains when qPCR increase all shows as a peak, and primer high specificity in qPCR increases is described, satisfies one of basic demand of qPCR.But primer is to q-GH F1 and q-GH R1, q-actin-F1 and q-actin-R1 and q-actin-F2 and q-actin-R2, the C in qPCR in the data of table 4
TBigger; MV is respectively 22.93,26.03 and 26.21; All greater than 20; Even the cDNA stoste minimum concentration sample during the preparation standard curve the most of cDNA or the reverse transcription of this concentration is described, promptly can't the application standard curve be assessed by the amplification efficiency of these 3 pairs of primers, so can not being used for follow-up qPCR, they analyze.According to this result, only q-GH F and q-GH R, q-18S F1 and q-18S R1 and q-18S F4 and these 3 pairs of primers of q-18SR4 are carried out further qPCR and analyze.
2). the annealing temperature of primer and melting curve analysis
To dilute 10 times cDNA is template, 3 annealing temperatures are set, use q-GH F and q-GH R, q-18SF1 and q-18S R1 and q-18S F4 and q-18S R4 and respectively the gene fragment of GH and 18S rRNA is carried out the qPCR amplification, each reaction do 2 parallel.(Fig. 3～Fig. 5) shows: the melting curve of each reaction was a peak to the result of melting curve when the 3 pairs of primers were 58 ℃, 60 ℃ and 62 ℃ of amplifications in annealing temperature; Further illustrate the high specificity of primer, promptly corresponding D NA fragment is specific amplification in qPCR.The data presentation of table 5: the C of 3 couples of primer qPCR under 3 annealing temperatures
TChange not quite, therefore can select arbitrary annealing temperature,, further assess the amplification efficiency of these 3 pairs of primers through setting up typical curve.
The annealing temperature amplification GH that table 5 is different and the related data of 18S rRNA gene fragment
3). the assessment of primer amplification efficient (foundation of typical curve)
(1) the segmental amplification efficiency assessment of primer q-GH F and q-GH R amplification GH
To dilute 10 times cDNA as starting point concentration, adopt 10 times of dilution methods, 5 concentration (table 6) are set altogether, with 60 ℃ as annealing temperature, use primer q-GH F and the q-GH R GH fragment that increases, each reaction do 3 parallel, preparation standard curve (Fig. 6).
In the test of this part, the result of table 6 shows: the amplification efficiency of primer is 103.8%, the R of typical curve
2Be 0.999, repeated sample C
TThe standard deviation of value is 0.068～0.260; In addition, in the adjacent amplification curve spacing of index amplification region similar (Fig. 7); The melting curve of each reaction is 1 peak (Fig. 8).
QPCR ideal primer amplification efficient should be between 90～105%, the R of typical curve
2Value should be greater than 0.98, repeated sample C
TThe standard deviation of value answers≤0.50, should be similar in the amplification curve spacing that the index amplification region is adjacent.
Therefore, according to the amplification efficiency of this amplification curve, melting curve, primer and the R of typical curve to primer
2Value proves that this can be used for the qPCR research to GH genetic expression to primer.
Related data when table 6 primer q-GH F and q-GH R amplification GH fragment
Annotate: digital identical person represents parallel test in the reaction tubes number.
(2) the segmental amplification efficiency assessment of primer q-18S F4 and q-18S R4 amplification 18S rRNA
Identical with the segmental amplification efficiency assessment of GH; To dilute 10 times cDNA as starting point concentration, adopt 10 times of dilution methods, 5 concentration (table 7) are set altogether; With 60 ℃ as annealing temperature; Use primer q-18S F4 and the q-18SR4 18S rRNA fragment that increases, each reaction do 3 parallel, preparation standard curve (Fig. 9).
In the test of this part, the result of table 7 shows: the amplification efficiency of primer is 92.4%, the R of typical curve
2Be 0.999, repeated sample C
TThe standard deviation of value is 0.056～0.300; In addition, in the adjacent amplification curve spacing of index amplification region similar (Figure 10); The melting curve of each reaction is 1 peak (Figure 11).In like manner, prove when this primer can be used for GH expression qPCR analysis, the amplification of internal control gene 18S rRNA.
Related data when table 7 primer q-18S F4 and q-18S R4 amplification 18S rRNA fragment
Annotate: digital identical person represents parallel test in the reaction tubes number.
(3) the segmental amplification efficiency assessment of primer q-18S F1 and q-18S R1 amplification 18S rRNA
Identical with the assessment of preceding 2 pairs of primer amplification efficient; To dilute 10 times cDNA as starting point concentration, adopt 10 times of dilution methods, 5 concentration (table 8) are set altogether; With 60 ℃ as annealing temperature; Use primer q-18S F1 and the q-18S R1 18S rRNA fragment that increases, each reaction do 2 parallel, preparation standard curve (Figure 12).
In the test of this part, the result of table 8 shows: the amplification efficiency of primer is 104.2%, the R of typical curve
2Be 0.998, repeated sample C
TThe standard deviation of value is 0.010～0.280; In addition, in the adjacent amplification curve spacing of index amplification region similar (Figure 13); The melting curve of each reaction is 1 peak (Figure 14).In like manner prove when this primer also can be used for GH expression qPCR analysis, the amplification of internal control gene 18S rRNA.
Related data when table 8 primer q-18S F1 and q-18S R1 amplification 18S rRNA fragment
Annotate: digital identical person represents parallel test in the reaction tubes number.
Five, the sequence verification of the q-GH F of primer and q-GH R and q-18S F4 and 1q-18S R4 amplified fragments
1) the segmental sequence verification of .q-GH F and q-GH R amplification GH
This conventional PCR product to primer is directly used two-way order-checking of amplimer and splicing (Beijing Liuhe Huada Genomics Technology Co., Ltd), and the result (wherein adds the reverse complementary sequence that boldface type is respectively primer q-GH F sequence and q-GH R) as follows.The amplicon sequence 100% that this sequence produces during with design of primers is identical.
2) the segmental sequence verification of .q-18S F4 and q-18S R4 amplification 18S rRNA
This conventional PCR product to primer is directly used two-way order-checking of amplimer and splicing (Beijing Liuhe Huada Genomics Technology Co., Ltd), and the result (wherein adds the reverse complementary sequence that boldface type is respectively primer q-18S F4 sequence and q-18SR4) as follows.The amplicon sequence 100% that this sequence produces during with design of primers is identical.
3) the segmental sequencing analysis of .q-18S F1 and q-18S R1 amplification 18S rRNA
Because this 18S rRNA fragment to primer amplification is merely 83bp; The PCR product can't directly check order; During according to design of primers, this is to the position of primer in 18S rRNA, and its sequence (wherein adds the reverse complementary sequence that boldface type is respectively primer q-18S F1 sequence and q-18S R1) as follows:
Six, the GenBank of amplicon nucleotide sequence comparison
With 3 pairs of primers, that is: 3 amplicon sequences of q-GHF and q-GHR, q-18S F4 and q-18S R4, q-18S F1 and q-18SR1 and their generations are imported the GenBank comparison respectively.Infer: primer q-GH F and q-GH R not only can be used to remove from office the qPCR of beard Nian GH gene fragment, also can be used for toad Nian (Clarias batrachus) recklessly.Q-18S F1 and q-18S R1 not only can be used to remove from office the qPCR amplification of the 18S rRNA of beard Nian; Kind of Silurformes fish surplus also can be used for 20 are comprising the important Silurformes cultured fishes of China: Nian (Silurus asotus), Yellow catfish (Pelteobagrus fulvidraco) and channel catfish (Ictalurus Punctatus).And q-18S F4 and q-18S R4 not only can be used to remove from office the qPCR amplification of the 18S rRNA of beard Nian; The Hu grouper class that also can be used for multiple Silurformes, as: Du Shi is Nian (Clarias dussumieri), cognate Hu Nian (Clarias ngamensis) and big Nian (Clarias buthupogon) recklessly etc. recklessly.
Description of drawings
Fig. 1 removes from office the total RNA electrophoresis result of 2 hypophysis of beard Nian.
The electrophoresis result of the conventional pcr amplification of Fig. 2 .1 and 2.2 primers.Annotate: swimming lane M is the DNA standard molecular weight.
Amplification melting curve when Fig. 3 primer q-GH F and q-GH R amplification GH fragment annealing temperature are 58 ℃ (curve marked ▲), 60 ℃ (line smoothing) and 62 ℃ (curve marked *).Annotate: the negative contrast of curve marked ■.
Amplification melting curve when Fig. 4 primer q-18S F4 and q-18S R4 amplification 18S rRNA fragment annealing temperature are 58 ℃ (curve marked ▲), 60 ℃ (line smoothing) and 62 ℃ (curve marked *).Annotate: the negative contrast of curve marked ■.
Amplification melting curve when Fig. 5 primer q-18S F1 and q-18S R1 amplification 18S rRNA fragment annealing temperature are 58 ℃ (curve marked ▲), 60 ℃ (line smoothing) and 62 ℃ (curve marked *).
The typical curve for preparing when Fig. 6 primer q-GH F and q-GH R amplification GH fragment.Annotate: C, D and E are three parallel tests.
The amplification curve of each reaction when Fig. 7 primer q-GH F and q-GH R amplification GH produced in fragments typical curve.Annotate: smooth curve, curve marked have ■ and curve marked to have * be respectively C, D and three parallel tests of E.
The melting curve of each reaction when Fig. 8 primer q-GH F and q-GH R amplification GH produced in fragments typical curve.
The typical curve for preparing when Fig. 9 primer q-18S F4 and q-18S R4 amplification 18S rRNA fragment.Annotate: D, E and F are three parallel tests.
The amplification curve of each reaction when Figure 10 primer q-18S F4 and q-18S R4 amplification 18S rRNA produced in fragments typical curve.Annotate: smooth curve, curve marked have ■ and curve marked to have * be respectively D, E and three parallel tests of F.
The melting curve of each reaction when Figure 11 primer q-18S F4 and q-18S R4 amplification 18S rRNA produced in fragments typical curve.
The typical curve for preparing when Figure 12 primer q-18S F1 and q-18S R1 amplification 18S rRNA fragment.Annotate: C and D are two parallel tests.
The amplification curve of each reaction when Figure 13 primer q-18S F1 and q-18S R1 amplification 18S rRNA produced in fragments typical curve.Smooth curve and curve marked have ■ to be respectively C and two parallel tests of D.
The melting curve of each reaction when Figure 14 primer q-18S F1 and q-18S R1 amplification 18S rRNA produced in fragments typical curve.
The GH fragment of Figure 15 primer q-GH F and q-GH R amplification is with the sequencer map of primer q-GH F (a) and q-GH R (b).
The 18S rRNA fragment of Figure 16 primer q-18S F4 and q-18S R4 amplification is with the sequencer map of primer q-18S F4 (a) and q-18S R4 (b).
The segmental GenBank retrieval of the GH of Figure 17 primer q-GH F and q-GH R amplification sectional drawing.
The segmental GenBank retrieval of the 18S rRNA of Figure 18 primer q-18S F1 and q-18S R1 amplification sectional drawing.
The segmental GenBank retrieval of the 18S rRNA of Figure 19 primer q-18S F4 and q-18S R4 amplification sectional drawing.
Embodiment
Leather beard Nian GH genetic expression qPCR is used for the nucleotide sequence of 2 pairs of primers of internal control gene (18S rRNA) amplification and sees table 1 when analyzing.
The primer nucleotide sequence information that table 1 is applied for a patent
Characteristics according to internal control gene; 2 pairs of primers of amplification internal control gene 18S rRNA among the application; Amplification internal control gene when not only can be used for the GH gene expression analysis; And can be used as all target genes to be checked of leather beard Nian and express qPCR when analyzing, be the amplimer of internal control gene with 18S rRNA, and through GenBank inquiry back supposition; These 2 pairs of primers not only can be used to remove from office the research of beard Nian, the target gene to be checked that also can be used for some other Silurformes fish express qPCR when analyzing with the research of 18SrRNA as internal control gene.Be the process of the test and the result of these 2 pairs of primers below.
One, the extraction of general RNA
Use total RNA that Trizol reagent (giving birth to worker's biotechnology ltd available from Shanghai) extracts single hypophysis.Detect (table 2) through agarose gel electrophoresis (Fig. 1) and spectrophotometer, analyzed its whole property and purity.
Fig. 1 removes from office the total RNA electrophoresis result of 2 hypophysis of beard Nian
The spectrophotometer detected result of the total RNA of table 2
Fig. 1 shows the ratio of band brightness of 28S/18S rRNA of RNA sample between 1～2, and the integrity of prompting RNA sample is better; And the OD of RNA sample in the table 2
260/OD280And OD
260/OD230Ratio all between 1.8～2.0, show that the RNA sample does not have the pollution of albumen and phenol.These 2 RNA sample standard deviations of the data declaration of Fig. 1 and table 2 can be used for the qPCR experiment.
Two, the reverse transcription of RNA
The reverse transcription of above-mentioned No. 1 RNA sample is become cDNA article one chain (RevertAid
TMCDNA article one chain synthetic agent box is given birth to worker's biotechnology ltd available from Shanghai), be used for the assessment of the primer that designs.
Three, primer design and conventional PCR assessment
1.GH, 18S rRNA and beta-actin gene fragment amplification primer design
Target gene to be checked is GH in this test, intends with 18S rRNA or beta-actin as internal control gene.GH gene amplification primer is according to this laboratory clone's leather beard Nian GH full-length cDNA (GenBank searching number: FJ823972), (the GenBank searching number: AJ876383) (the GenBank searching number: HM768299) sequence, Using P rimer 5.0 designs with beta-actin according to the 18SrRNA of GenBank retrieval respectively for the amplimer of 18S rRNA and beta-actin gene.According to the fundamental principle of qPCR and design of primers, from the tens of of design preliminary election the primer is gone out each 2 pairs of the primers of GH, 18S rRNA and beta-actin amplification, and it is synthetic to give birth to worker's biotechnology ltd by Shanghai.Its primer information such as table 3.
Table 3 design synthetic primer information
2. the conventional PCR assessment of primer
At first, be template to dilute 10 times cDNA, according to the Tm value of 6 pairs of primers of synthetic, carry out conventional pcr amplification, so that primer is carried out entry evaluation, its conventional pcr amplification result sees Fig. 2 .1 and Fig. 2 .2.The electrophoresis result of the conventional pcr amplification of Fig. 2 .1 and Fig. 2 .2 primer.Annotate: swimming lane M is the DNA standard molecular weight.
The result of Fig. 2 shows that 6 pairs of primers all can amplify good fragment, and the clip size that clip size produces during with design of primers conforms to.Therefore further 6 pairs of primers are carried out the qPCR analysis and assessment.
Four, the qPCR of primer assessment
Use the IQ of U.S. BioRad company
TMThe SsoFast EvaGreen qPCR premixed liquid of 5 qPCR appearance and the said firm according to the specification sheets of this premixed liquid, carries out the qPCR assessment to 6 pairs of primers that design.
1. the qPCR entry evaluation of primer
Be template at first, use identical annealing temperature, GH, 18S rRNA and beta-actin gene fragment are carried out qPCR (each reaction do 2 parallel), according to the C that draws with conventional PCR to dilute 10 times cDNA
TValue (table 4) is carried out entry evaluation to 6 pairs of primers.
The related data of table 4 primer in the qPCR test
In this part test, the melting curve that the every pair of primer obtains when qPCR increase all shows as a peak value (picture does not provide), and primer high specificity in qPCR increases is described, satisfies one of basic demand of qPCR.But primer is to q-GH F1 and q-GH R1, q-actin-F1 and q-actin-R1 and q-actin-F2 and q-actin-R2, the C in qPCR in the data of table 4
TBigger; MV is respectively 22.93,26.03 and 26.21; All greater than 20; Even the minimum concentration sample when the cDNA stoste of cDNA or the reverse transcription of this concentration can not be as the preparation standard curve is described, promptly can't the application standard curve be assessed by the amplification efficiency of these 3 pairs of primers, so can not being used for follow-up qPCR, they analyze.According to this result, only q-GH F and q-GH R, q-18S F1 and q-18SR1 and q-18S F4 and these 3 pairs of primers of q-18S R4 are carried out further qPCR analysis and assessment.
2. the annealing temperature of primer and melting curve analysis
To dilute 10 times cDNA is template, 3 annealing temperatures is set, uses q-GH F and q-GH R, q-18SF1 and q-18S R1 and q-18S F4 and q-18S R4 and respectively the gene fragment of GH and 18S rRNA is carried out the qPCR amplification.Each reaction do 2 parallel.Melting curve is seen Fig. 3～5.This result shows that the melting curve of 3 pairs of primers each reaction when annealing temperature is 58 ℃, 60 ℃ and 62 ℃ amplification is a peak, further illustrates the high specificity of primer, and promptly corresponding D NA fragment is specific amplification in qPCR.The data presentation of table 5: 3 couples of primer C under 3 annealing temperatures
TChange not quite, therefore can select arbitrary annealing temperature,, further assess the amplification efficiency of these 3 pairs of primers through setting up typical curve.
The annealing temperature amplification GH that table 5 is different and the related data of 18S rRNA gene fragment
Amplification melting curve when Fig. 3 primer q-GH F and q-GH R amplification GH fragment annealing temperature are 58 ℃ (curve marked ▲), 60 ℃ (line smoothing) and 62 ℃ (curve marked *).Annotate: the negative contrast of curve marked ■.
Amplification melting curve when Fig. 4 primer q-18S F4 and q-18S R4 amplification 18S rRNA fragment annealing temperature are 58 ℃ (curve marked ▲), 60 ℃ (line smoothing) and 62 ℃ (curve marked *).Annotate: annotate: the negative contrast of curve marked ■.
Amplification melting curve when Fig. 5 primer q-18S F1 and q-18S R1 amplification 18S rRNA fragment annealing temperature are 58 ℃ (curve marked ▲), 60 ℃ (line smoothing) and 62 ℃ (curve marked *).
3. the assessment of primer amplification efficient (foundation of typical curve)
(1) the segmental amplification efficiency assessment of primer q-GH F and q-GH R amplification GH
To dilute 10 times cDNA as starting point concentration, adopt 10 times of dilution methods, 5 concentration (table 6) are set altogether, with 60 ℃ as annealing temperature, use primer q-GH F and the q-GH R GH fragment that increases, each reaction do 3 parallel.Fig. 6 is the typical curve of preparation, and Fig. 7 is an amplification curve diagram, the related data that table 6 obtains when being amplification; Fig. 8 then is the melting curve figure of each reaction.
The typical curve for preparing when Fig. 6 primer q-GH F and q-GH R amplification GH fragment.Annotate: C, D and E are three parallel tests.
The amplification curve of each reaction when Fig. 7 primer q-GH F and q-GH R amplification GH produced in fragments typical curve.Annotate: smooth curve, curve marked have ■ and curve marked to have * be respectively C, D and three parallel tests of E.
Related data when table 6 primer q-GH F and q-GH R amplification GH fragment
Annotate: digital identical person represents parallel test in the reaction tubes number.
The melting curve of each reaction when Fig. 8 primer q-GH F and q-GH R amplification GH fragment amplification preparation standard curve.
Because qPCR ideal amplification efficiency should be between 90～105%, the R of typical curve
2Should be greater than 0.98, repeated sample C
TThe standard deviation of value answers≤0.50, should be similar in the amplification curve spacing that the index amplification region is adjacent.
Can find out that from table 6 this amplification efficiency to primer is 103.8%, the R of typical curve
2Value is 0.999, repeated sample C
TThe standard deviation of value is 0.068～0.260; In addition, at the spacing of the adjacent amplification curve of index amplification region similar (Fig. 7), the melting curve of each reaction is a peak (Fig. 8).Therefore prove that this primer can be used for the qPCR research to GH genetic expression.
(2) the segmental amplification efficiency assessment of primer q-18S F4 and q-18S R4 amplification 18S rRNA
Identical with the assessment of the segmental amplification efficiency of GH, to dilute 10 times cDNA, adopt 10 times of dilution methods as starting point concentration; 5 concentration (table 7) are set altogether; With 60 ℃ as annealing temperature, use primer q-18S F4 and the q-18SR4 18S rRNA fragment that increases, each reaction do 3 parallel.Fig. 9 is the typical curve of preparation, and Figure 10 is an amplification curve diagram, the related data that table 7 obtains when being amplification, and Figure 11 then is the melting curve figure of each reaction.Can find out that from table 7 this amplification efficiency to primer is 92.4%, the R of typical curve
2Value is 0.999, repeated sample C
TThe standard deviation of value is 0.056～0.300, and at the spacing of the adjacent amplification curve of index amplification region similar (Figure 10), the melting curve of each reaction is a peak (Figure 11).In like manner, prove when this primer can be used for GH expression qPCR analysis, the amplification of internal control gene 18S rRNA.
The typical curve for preparing when Fig. 9 primer q-18S F4 and q-18S R4 amplification 18S rRNA fragment.Annotate: D, E and F are three parallel tests.
The amplification curve of each reaction when Figure 10 primer q-18S F4 and q-18S R4 amplification 18S rRNA produced in fragments typical curve.Annotate: smooth curve, curve marked have ■ and curve marked to have * be respectively D, E and three parallel tests of F
Related data data when table 7 primer q-18S F4 and q-18S R4 amplification 18S rRNA fragment
Annotate: digital identical person represents parallel test in the reaction tubes number.
The melting curve of each reaction when Figure 11 primer q-18S F4 and q-18S R4 amplification 18S rRNA produced in fragments typical curve.
(3) the segmental amplification efficiency assessment of primer q-18S F1 and q-18S R1 amplification 18S rRNA
Identical with the assessment of preceding 2 pairs of primer amplification efficient, to dilute 10 times cDNA, adopt 10 times of dilution methods as starting point concentration; 5 concentration (table 8) are set altogether; Also with 60 ℃ as annealing temperature, use primer q-18S F1 and the q-18S R1 18S rRNA fragment that increases, each reaction do 2 parallel.Figure 12 is the typical curve of preparation, and Figure 13 is an amplification curve diagram, the related data that table 8 obtains when being amplification, and Figure 14 then is the melting curve figure of each reaction.
Can find out that from table 8 this amplification efficiency to primer is 104.2%, the R of typical curve
2Value is 0.998, repeated sample C
TThe standard deviation of value is 0.010～0.280, and in the spacing close (Figure 13) of the adjacent amplification curve of index amplification region, the melting curve of each reaction is a peak (Figure 14).In like manner prove when this primer also can be used for GH expression qPCR analysis, the amplification of internal control gene 18S rRNA.
The typical curve for preparing when Figure 12 primer q-18S F1 and q-18S R1 amplification 18S rRNA fragment.Annotate: C and D are two parallel tests.
The amplification curve of each reaction when Figure 13 primer q-18S F1 and q-18S R1 amplification 18S rRNA produced in fragments typical curve.Smooth curve and curve marked have ■ to be respectively C and two parallel tests of D.
Related data data when table 8 primer q-18S F1 and q-18S R1 amplification 18S rRNA fragment
Annotate: digital identical person represents parallel test in the reaction tubes number.
The melting curve of each reaction when Figure 14 primer q-18S F1 and q-18S R1 amplification 18S rRNA produced in fragments typical curve.
Five, the sequence verification of the q-GH F of primer and q-GH R and q-18S F4 and q-18S R4 amplified fragments
1.q-GH F and the segmental sequence verification of q-GH R amplification GH
This conventional PCR product to primer is directly used two-way order-checking of amplimer and splicing (Beijing Liuhe Huada Genomics Technology Co., Ltd), Figure 15 (a) and (b) be respectively the sequencer map of using primer q-GH F and q-GH R.The splicing result of its sequence (wherein adds the reverse complementary sequence that boldface type is respectively primer q-GH F sequence and q-GH R) as follows.The amplicon sequence 100% that this sequence produces during with design of primers is identical.
The GH fragment of Figure 15 primer q-GH F and q-GH R amplification is with the sequencer map of primer q-GH F (a) and q-GH R (b).
2.q-18S F4 and the segmental sequence verification of q-18S R4 amplification 18S rRNA
This conventional PCR product to primer is directly used two-way order-checking of amplimer and splicing (Beijing Liuhe Huada Genomics Technology Co., Ltd); Figure 16 (a) and (b) be respectively the sequencer map of using primer q-18S F4 and q-18S R4, the splicing result of its sequence (wherein adds the reverse complementary sequence that boldface type is respectively primer q-18S F4 sequence and q-18S R4) as follows.The amplicon sequence 100% that this sequence produces during with design of primers is identical.
The 18S rRNA fragment of Figure 16 primer q-18S F4 and q-18S R4 amplification is with the sequencer map of primer q-18S F4 (a) and q-18S R4 (b).
3.q-18S F1 and the segmental sequencing analysis of q-18S R1 amplification 18S rRNA
Because this 18S rRNA fragment to primer amplification is merely 83bp; The PCR product can't directly check order; During according to design of primers, this is to the position of primer in 18S rRNA, and its sequence (wherein adds the reverse complementary sequence that boldface type is respectively primer q-18S F1 sequence and q-18S R1) as follows:
GGGGAGGTAGTGACGAAAAATAACGATACAGGTCTCTTTCGAGGCCC
Six, the GenBank of amplicon nucleotide sequence comparison
With 3 pairs of primers, that is: 3 amplicon sequences producing of q-GHF and q-GHR, q-18S F4 and q-18S R4, q-18S F1 and q-18SR1 and their import respectively GenBank (
Http:// blast.ncbi.nlm.nih.gov/Blast.cgi) comparison, Figure 17～Figure 19 is 3 part sectional drawings after the amplicon GenBank comparison.
The segmental GenBank retrieval of the GH of Figure 17 primer q-GH F and q-GH R amplification sectional drawing.
The segmental GenBank retrieval of the 18S rRNA of Figure 18 primer q-18S F1 and q-18S R1 amplification sectional drawing.
The segmental GenBank retrieval of the 18S rRNA of Figure 19 primer q-18S F4 and q-18S R4 amplification sectional drawing.
Can infer that from Figure 17 the qPCR that primer q-GH F and q-GH R not only can be used to remove from office beard Nian GH also can be used for toad Nian (Clarias batrachus) recklessly.Can infer from Figure 18; Q-18S F1 and q-18S R1 not only can be used to remove from office the qPCR amplification of the 18S rRNA of beard Nian; Kind of Silurformes fish surplus also can be used for 20 are comprising the important Silurformes cultured fishes of China: Nian (Silurus asotus), Yellow catfish (Pelteobagrus fulvidraco) and channel catfish (Lctalurus Punctatus).And can infer that from Figure 19 q-18S F4 and q-18S R4 not only can be used to remove from office the qPCR amplification of the 18S rRNA of beard Nian; The Hu grouper class that also can be used for multiple Silurformes, as: Du Shi is Nian (Clarias dussumieri), cognate Hu Nian (Clarias ngamensis) and big Nian (Clarias buthupogon) recklessly etc. recklessly.
Application example
Accomplished at present 4 cultivation density (35kg/m
3, 65kg/m
3, 95kg/m
3And 125kg/m
3) when culturing 1 month and culture 2 months, 96 (each Treatment Analysis 12 individuals) being equivalent to 8 processing are altogether removed from office the qPCR test work of the individual GH genetic expression of beard Nian.Resulting data are carried out statistical analysis at present, with of the influence of discussion cultivation density to leather beard Nian GH genetic expression, and GH expression of gene amount and the relation of removing from office beard Nian individual growth.
Claims (4)
1. remove from office the primer sequence that is used for the internal control gene amplification in the beard Nian growth hormone gene expression quantitative PCR analysis for one kind, it is characterized in that:
2. leather beard Nian growth hormone gene according to claim 1 is expressed the primer sequence that is used for the internal control gene amplification in the quantitative PCR analysis; The amplimer of internal control gene (18S rRNA) when these two pairs of primers not only can be used as leather beard Nian GH genetic expression qPCR analysis; And can be used as all target genes to be checked of leather beard Nian and express qPCR when analyzing, be the amplimer of internal control gene with 18S rRNA.
3. leather beard Nian growth hormone gene according to claim 1 is expressed the primer sequence that is used for the internal control gene amplification in the quantitative PCR analysis; These two pairs of researchs that primer not only can be applicable to remove from office beard Nian, the target gene to be checked that also can be applicable to some other Silurformes fish express qPCR when analyzing with the research of 18S rRNA as internal control gene.
4. the making method that is used for two pairs of primer nucleotide sequences of internal control gene (18S rRNA) amplification when leather beard Nian GH genetic expression qPCR analyzes:
One, the extraction of general RNA
Use total RNA that Trizol reagent extracts single hypophysis, detect, analyze its integrity and purity through agarose gel electrophoresis and spectrophotometer.The agarose gel electrophoresis result shows the ratio of band brightness of 28S/18S rRNA of RNA sample between 1～2, and the integrity of prompting RNA sample is better; Spectrophotometer detects the OD of two RNA samples
260/OD280And OD
260/OD230Ratio be respectively 1.89 and 1.99 and 1.96 and 2.00, i.e. the OD of two RNA samples
260/OD280And OD
260/OD230Ratio all between 1.8～2.0.Show that these two RNA samples do not have the pollution of albumen and phenol, all can be used for the qPCR experiment.
Two, the reverse transcription of RNA
The reverse transcription of above-mentioned 1 RNA sample is become cDNA article one chain (RevertAid
TMCDNA article one chain synthetic agent box), be used for the assessment of the primer that designs.
Three, primer design and conventional PCR assessment
1) .GH, 18S rRNA and beta-actin gene fragment amplification primer design
Target gene to be checked is GH in this test, intends with 18S rRNA or beta-actin as internal control gene.GH gene amplification primer is according to this laboratory clone's leather beard Nian GH full-length cDNA (GenBank searching number: FJ823972), (the GenBank searching number: AJ876383) (the GenBank searching number: HM768299) sequence, application software Primer 5.0 designs with beta-actin according to the 18S rRNA of GenBank retrieval respectively for the amplimer of 18S rRNA and beta-actin gene.According to the fundamental principle of qPCR design of primers, from the tens of of design preliminary election the primer is gone out each 2 pairs of the primers of GH, 18S rRNA and beta-actin amplification, and it is synthetic to give birth to worker's biotechnology ltd by Shanghai; Its primer information such as following table.
2). the conventional PCR assessment of primer
At first, be template to dilute 10 times cDNA, according to the Tm value of 6 pairs of primers of synthetic, carry out conventional pcr amplification, so that primer is carried out entry evaluation.The conventional PCR product of 6 pairs of primers shows through the agarose gel electrophoresis detected result: the amplified production electrophoresis band line of 6 pairs of primers is clear, and the clip size that clip size produces during with design of primers conforms to, and therefore further 6 pairs of primers is carried out the qPCR analysis and assessment.
Four, the qPCR of primer assessment
Use the IQ of U.S. BioRad company
TMThe SsoFast EvaGreen qPCR premixed liquid of 5 qPCR appearance and the said firm according to the specification sheets of this premixed liquid, carries out the qPCR assessment to 6 pairs of primers that design.
1). the qPCR entry evaluation of primer
To dilute 10 times cDNA is template, uses the annealing temperature identical with conventional PCR, and GH, 18S rRNA and beta-actin gene fragment are carried out qPCR, each reaction do 2 parallel.The result shows: the melting curve that the every pair of primer obtains when qPCR increase all shows as a peak, and primer high specificity in qPCR increases is described, satisfies one of basic demand of qPCR.But, according to the C of every couple of primer qPCR
TValue (seeing the following form) has 3 pairs of primers, that is: q-GH F1 and q-GH R1, q-actin-F1 and q-actin-R1 and q-actin-F2 and q-actin-R2, the C in qPCR
TBigger; MV is respectively 22.93,26.03 and 26.21; All greater than 20; Even the minimum concentration sample when the cDNA stoste of cDNA or the reverse transcription of this concentration can not be as the preparation standard curve is described, promptly can't the application standard curve be assessed by the amplification efficiency of these 3 pairs of primers, so can not being used for follow-up qPCR, they analyze.According to The above results, only q-GH F and q-GH R, q-18S F1 and q-18S R1 and q-18S F4 and these 3 pairs of primers of q-18S R4 are carried out further qPCR assessment.
2). the annealing temperature of primer and melting curve analysis
To dilute 10 times cDNA is template, 3 annealing temperatures is set, uses q-GHF and q-GHR, q-18S F1 and q-18S R1 and q-18S F4 and q-18S R4 and respectively the gene fragment of GH and 18S rRNA is carried out the qPCR amplification; Each reaction do 2 parallel.The result shows that the melting curve of 3 pairs of primers each reaction when annealing temperature is 58 ℃, 60 ℃ and 62 ℃ amplification is a peak, further illustrates the high specificity of primer, and promptly corresponding D NA fragment is specific amplification in qPCR.The C of 3 couples of primer qPCR
TValue Data (following table) shows: 3 couples of primer C under 3 annealing temperatures
TChange not quite, show and to select arbitrary annealing temperature,, further assess the amplification efficiency of these 3 pairs of primers through setting up typical curve.
3). the assessment of primer amplification efficient (foundation of typical curve)
(1) the segmental amplification efficiency assessment of primer q-GH F and q-GH R amplification GH
To dilute 10 times cDNA as starting point concentration, adopt 10 times of dilution methods, 5 concentration are set altogether, with 60 ℃ as annealing temperature, use primer q-GH F and the q-GH R GH fragment that increases, each reaction do 3 parallel.
QPCR ideal primer amplification efficient should be between 90～105%, the R of typical curve
2Value should be greater than 0.98, repeated sample C
TThe standard deviation of value answers≤0.50, should be similar in the amplification curve spacing that the index amplification region is adjacent.
This part test-results shows: in the index amplification region, the spacing of adjacent amplification curve is similar, and the melting curve of each reaction is 1 peak, through the following table data presented (C of each reaction
TValue, repeated sample C
TStandard deviation, the amplification efficiency of primer and the R of typical curve of value
2Value) can find out: this amplification efficiency to primer is 103.8%, the R of typical curve
2Value is 0.999, repeated sample C
TThe standard deviation of value is 0.068～0.260.Therefore, according to amplification curve, melting curve, the amplification efficiency of primer and the R of typical curve of primer
2Value proves that this can be used for the qPCR research to GH genetic expression to primer.
Annotate: digital identical person represents parallel test in the reaction tubes number.
(2) the segmental amplification efficiency assessment of primer q-18S F4 and q-18S R4 amplification 18S rRNA
Identical with the assessment of the segmental amplification efficiency of GH, to dilute 10 times cDNA, adopt 10 times of dilution methods as starting point concentration; 5 concentration are set altogether; With 60 ℃ as annealing temperature, use primer q-18S F4 and the q-18S R4 18S rRNA fragment that increases, each reaction do 3 parallel.The result shows: in the index amplification region, the spacing of adjacent amplification curve is similar, and the melting curve of each reaction is 1 peak, through the following table data presented (C of each reaction
TValue, repeated sample C
TStandard deviation, the amplification efficiency of primer and the R of typical curve of value
2Value) can find out: this amplification efficiency to primer is 92.4%, the R of typical curve
2Value is 0.999, repeated sample C
TThe standard deviation of value is 0.056～0.300.In like manner, prove when this primer can be used for GH expression qPCR analysis, the amplification of internal control gene (18S rRNA).
Annotate: digital identical person represents parallel test in the reaction tubes number.
(3) the segmental amplification efficiency assessment of primer q-18S F1 and q-18S R1 amplification 18S rRNA
Identical with the assessment of preceding 2 pairs of primer amplification efficient, to dilute 10 times cDNA, adopt 10 times of dilution methods as starting point concentration; 5 concentration are set altogether; With 60 ℃ as annealing temperature, use primer q-18S F1 and the q-18S R1 18S rRNA fragment that increases, each reaction do 2 parallel.The result shows: in the index amplification region, the spacing of adjacent amplification curve is similar, and the melting curve of each reaction is 1 peak, through the following table data presented (C of each reaction
TValue, repeated sample C
TStandard deviation, the amplification efficiency of primer and the R of typical curve of value
2Value) can find out: this amplification efficiency to primer is 104.2%, the R of typical curve
2Value is 0.998, repeated sample C
TThe standard deviation of value is 0.010～0.280.Therefore, explain when this primer also can be used for GH expression qPCR analysis, the amplification of internal control gene (18S rRNA).
Annotate: digital identical person represents parallel test in the reaction tubes number.
Five, the sequence verification of the q-GH F of primer and q-GH R and q-18S F4 and q-18S R4 amplified fragments
1) the segmental sequence verification of .q-GH F and q-GH R amplification GH
This conventional PCR product to primer is directly used two-way order-checking of amplimer and splicing (Beijing Liuhe Huada Genomics Technology Co., Ltd), and the result (wherein adds the reverse complementary sequence that boldface type is respectively primer q-GH F sequence and q-GHR) as follows.The amplicon sequence 100% that this sequence produces during with design of primers is identical.
2) the segmental sequence verification of .q-18S F4 and q-18S R4 amplification 18S rRNA
This conventional PCR product to primer is directly used two-way order-checking of amplimer and splicing (Beijing Liuhe Huada Genomics Technology Co., Ltd), and the result (wherein adds the reverse complementary sequence that boldface type is respectively primer q-18S F4 sequence and q-18S R4) as follows.The amplicon sequence 100% that this sequence produces during with design of primers is identical.
3) the segmental sequencing analysis of .q-18S F1 and q-18S R1 amplification 18S rRNA
Because this 18S rRNA fragment to primer amplification is merely 83bp; The PCR product can't directly check order; During according to design of primers, this is to the position of primer in 18S rRNA, and its sequence (wherein adds the reverse complementary sequence that boldface type is respectively primer q-18S F1 sequence and q-18S R1) as follows:
Six, the GenBank of primer and amplicon nucleotide sequence comparison
With 3 pairs of primers, that is: 3 amplicon sequences of q-GH F and q-GH R, q-18S F4 and q-18S R4, q-18S F1 and q-18S R1 and their generations are imported the GenBank comparison respectively.Infer: primer q-GH F and q-GH R not only can be used to remove from office the qPCR of beard Nian GH gene fragment, also can be used for toad Nian (Clarias batrachus) recklessly.Q-18S F1 and q-18S R1 not only can be used to remove from office the qPCR amplification of the 18S rRNA of beard Nian; Kind of Silurformes fish surplus also can be used for 20 are comprising the important Silurformes cultured fishes of China: Nian (Silurus asotus), Yellow catfish (Pelteobagrus fulvidraco) and channel catfish (Ictalurus Punctatus).And q-18S F4 and q-18S R4 not only can be used to remove from office the qPCR amplification of the 18S rRNA of beard Nian; The Hu grouper class that also can be used for multiple Silurformes, as: Du Shi is Nian (Clarias dussumieri), cognate Hu Nian (Clarias ngamensis) and big Nian (Clarias buthupogon) recklessly etc. recklessly.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110252308A CN102321624A (en) | 2011-08-30 | 2011-08-30 | Primer sequence for internal reference gene amplification in quantitative PCR (polymerase chain reaction) analysis of gene expression of growth hormone of Clarias leather |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110252308A CN102321624A (en) | 2011-08-30 | 2011-08-30 | Primer sequence for internal reference gene amplification in quantitative PCR (polymerase chain reaction) analysis of gene expression of growth hormone of Clarias leather |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102321624A true CN102321624A (en) | 2012-01-18 |
Family
ID=45449460
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110252308A Pending CN102321624A (en) | 2011-08-30 | 2011-08-30 | Primer sequence for internal reference gene amplification in quantitative PCR (polymerase chain reaction) analysis of gene expression of growth hormone of Clarias leather |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102321624A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104937600A (en) * | 2012-09-14 | 2015-09-23 | 生命技术公司 | Methods and systems for a digital pcr experiment designer |
| CN113142105A (en) * | 2021-02-22 | 2021-07-23 | 眉山市人和渔业专业合作社 | Pelteobagrus fulvidraco hybridization method and cultivation method of hybridized Pelteobagrus fulvidraco mutant |
| CN116218861A (en) * | 2022-12-19 | 2023-06-06 | 广东海洋大学 | Clarias fuscus actb2 gene, and primers and application thereof |
-
2011
- 2011-08-30 CN CN201110252308A patent/CN102321624A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| 《中国农学通报》 20101130 唐永凯等 实时荧光定量PCR技术及其在水产上的应用 第422-426页 1-4 第26卷, 第21期 * |
| 《华北农学报》 20110228 王晓梅等 高密度养殖下革胡子鲶生长激素mRNA表达的半定量分析 第94-98页 1-4 第26卷, 第1期 * |
| 《西南农业学报》 20080430 杨学明等 革胡子鲶生长激素基因克隆与序列同源分析 第483-486页 1-4 第21卷, 第2期 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104937600A (en) * | 2012-09-14 | 2015-09-23 | 生命技术公司 | Methods and systems for a digital pcr experiment designer |
| CN104937600B (en) * | 2012-09-14 | 2018-01-16 | 生命技术公司 | For the method and system used in digital pcr experimental design person |
| CN113142105A (en) * | 2021-02-22 | 2021-07-23 | 眉山市人和渔业专业合作社 | Pelteobagrus fulvidraco hybridization method and cultivation method of hybridized Pelteobagrus fulvidraco mutant |
| CN116218861A (en) * | 2022-12-19 | 2023-06-06 | 广东海洋大学 | Clarias fuscus actb2 gene, and primers and application thereof |
| CN116218861B (en) * | 2022-12-19 | 2024-01-09 | 广东海洋大学 | Clarias fuscus actb2 gene, and primers and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6798056B2 (en) | Improvement of microbial strains by HTP genome manipulation platform | |
| Henkel et al. | First draft genome sequence of the Japanese eel, Anguilla japonica | |
| Dubey | A textbook of Biotechnology | |
| CN109971865B (en) | SNP marker significantly related to weight traits of litopenaeus vannamei and application | |
| CN113502333B (en) | Molecular marker C42257 for rapidly identifying genetic sex of penaeus japonicus and application thereof | |
| CN105950625B (en) | The sgRNA and its coding DNA of a pair of of specific recognition pig MSTN gene promoters and application | |
| CN105925579B (en) | The sgRNA and its coding DNA of a pair of of specific recognition pig IGF2 gene introns and application | |
| CN106754948A (en) | Brown paddy plant hopper NlMLP genes, encoding proteins and its application | |
| CN108610427A (en) | Migratory locusts diapause hormone gene and its application in regulating and controlling Insect Diapause | |
| CN103243167B (en) | Molecular marker related to diameter of sheep wool fiber and application thereof | |
| CN103667449B (en) | Real-time fluorescence PCR (polymerase chain reaction) method and primer pair for identifying gender of oreochromis niloticus | |
| CN108753987A (en) | A kind of method of the general microsatellite Multiplex fluorescent PCR of silver carp flathead | |
| CN102321624A (en) | Primer sequence for internal reference gene amplification in quantitative PCR (polymerase chain reaction) analysis of gene expression of growth hormone of Clarias leather | |
| CN104745584B (en) | One kind is for disturbing arrenotokous nucleic acid molecules of Macrobrachium rosenbergii and preparation method thereof | |
| CN103484459A (en) | Primer group, marking method and application of EST-SSR (Expressed Sequence Tag-Simple Sequence Repeats) molecular marker of macrobrachium nipponense | |
| CN106167825A (en) | Microsatellite marker that a kind of yellow catfish growing characteristic is relevant and detection thereof and application | |
| CN106978496B (en) | PCR detection primer and fluorescent quantitative PCR detection kit for Pelteobagrus fulvidraco | |
| Dos Remedios et al. | Molecular sex-typing in shorebirds: a review of an essential method for research in evolution, ecology and conservation | |
| CN111631174B (en) | Breeding method of Cyprinus carpiod | |
| CN110144410B (en) | Molecular detection method for identifying parasitism of Abelmoschus manihot to pink bollworm and application | |
| CN103194441A (en) | Method for obtaining miRNA (Ribose Nucleic Acid) candidate target gene and special reverse transcription primer for method | |
| Håland | Development of multiplex microsatellite panels for population genetic studies of Triturus cristatus | |
| TWI690263B (en) | Marker and method for molecular assisted breeding of grouper | |
| CN110616279A (en) | Kit for synchronously and quantitatively detecting 3 important shrimp pathogens | |
| CN112029772B (en) | Gustavus gene and application thereof, dsRNA synthesized by Gustavus gene and preparation method and application of dsRNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120118 |