CN102304546B - Method for inducing plants to bloom early by populus tomentosa sepallata (PtSEP) gene of poplar - Google Patents
Method for inducing plants to bloom early by populus tomentosa sepallata (PtSEP) gene of poplar Download PDFInfo
- Publication number
- CN102304546B CN102304546B CN2010101009128A CN201010100912A CN102304546B CN 102304546 B CN102304546 B CN 102304546B CN 2010101009128 A CN2010101009128 A CN 2010101009128A CN 201010100912 A CN201010100912 A CN 201010100912A CN 102304546 B CN102304546 B CN 102304546B
- Authority
- CN
- China
- Prior art keywords
- gene
- ptsep
- plant
- poplar
- willow
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a method for inducing plants to bloom early by a populus tomentosa sepallata (PtSEP) gene of poplar. In the method, the total length of complementary deoxyribonucleic acid (cDNA) of the PtSEP gene, which is the target gene, of the poplar to construct an ultra-expression vector of the PtSEP gene, and the ultra-expression vector is transferred into a plant to advance the blossom time of the plant such as tobacco and the like. The early flowering induction of the plants and particularly flowers is performed by utilizing the transgenic technology, the period is short and the effectiveness is quick.
Description
Technical field
The present invention relates to a kind of plant prematurity inductive method, relate in particular to a kind of willow PtSEP gene and be used for plant prematurity inductive method.
Background technology
The decision process of blooming is the 1st stage that plant reproductive growth starts, and directly the morning and evening of controlling plant breeding time is therefore closely related with the product of plant.Can let its prematurity for flower plant, to produce the required product of people.The early flowering of certain plants then helps the growth of fruit, changes growth cycle and breeding cycle, might make the peasant can a multiple season in 1 year.Delay crop such as vegetables bloom to be of value to and let them produce frondesce more, can consume too much nutrition and energy because bloom.
Generally the florescence of plant is regulated and control in the prior art, or adopted the method for hybridization to obtain the kind that needs through florescence control (like plant hormone) and greenhouse technology etc.
There is following shortcoming at least in above-mentioned prior art:
The ability of regulation and control of florescence control method is limited, hybridizing method need corresponding parent material, and the cycle is long, breeding process is complicated.
Summary of the invention
The purpose of this invention is to provide willow PtSEP gene short, instant effect of a kind of cycle and be used for plant prematurity inductive method.
The objective of the invention is to realize through following technical scheme:
Willow PtSEP gene of the present invention is used for plant prematurity inductive method, comprising:
As goal gene, clone its cDNA total length with the PtSEP gene of willow, make up the overexpression vector of said PtSEP gene and change plant over to, be used for the flowering time of plant in advance;
Said PtSEP gene comprises following cDNA sequence or has 90% above homology and the identical dna sequence dna of function with following cDNA sequence:
ATGGGGAGAGGTAGGGTTGAGTTGAAGAGAATTGAGAACAAGATCAACAGGCAAGTAACATTTGCAAAGAGAAGGAATGGACTTTTGAAGAAAGCCTATGAGCTTTCCGTTCTTTGTGATGCAGAGATTGCTCTCATCATCTTCTCCAATAGAGGAAAGCTGTACGAGTTTTGCAGTAGTTCAAGCATGCTCAAAACTCTTGAGAGGTACCAGAAGTGCAACTATGGAGCACCAGAGCCAAATGTGTCAGCAAGGGAGGCCTTGGAACTGAGTAGCCAGCAGGAATATCTGAAGCTTAAAGCACGCTACGAAGCTCTGCAAAGAACCCAGAGGAATCTTTTGGGAGAAGACCTTGGCCCTCTGAGCAGCAAAGAGCTTGAATCACTTGAAAGACAGCTTGATATGTCACTGAAGCAGATCAGATCAACAAGGACCCAGTACATGCTGGATCAGCTCAATGATCTACAGCATAAGGAACACATGTTGACTGCAGCTAATAAGTCTCTGAGAGAAAGGTTGATGGAAGGTTACGAAGTAAATTCACTCCAGTTGAATCTAAGTGCAGAAGATGTGGGTTTTTCTCGACAACAAGCTCAACCCCAAGGTTATGGATTCTTTCATCCTTTGGAGTGCGAACCTACTTTACAAATTGGGTATCAGCCTGACAGTGCTATAACAGTGGTCACTTCTGGCCCAAGTATGACTGCTTACATGCCAGGTTGGTTACCATGA。
Described plant comprises tobacco and the plant close with tobacco.
Described plant comprises flowers.
Adopt the overexpression mode of said PtSEP gene to realize.
Technical scheme by the invention described above provides can find out that willow PtSEP gene of the present invention is used for plant prematurity inductive method, with the PtSEP gene of willow as goal gene; Clone its cDNA total length; Make up the overexpression vector of said PtSEP gene and change plant over to, be used for the flowering time of plant in advance, utilize transgenic technology to be used for the plant prematurity and induce; Blooming in advance of special flowers, short, instant effect of cycle.
Embodiment
Willow PtSEP gene of the present invention is used for plant prematurity inductive method, and its preferable embodiment comprises:
As goal gene, clone its cDNA total length with the PtSEP gene of willow, make up the overexpression vector of said PtSEP gene and change plant over to, be used for the flowering time of plant in advance;
Said PtSEP gene comprises following cDNA sequence or has 90% above homology and the identical dna sequence dna of function with following cDNA sequence:
ATGGGGAGAGGTAGGGTTGAGTTGAAGAGAATTGAGAACAAGATCAACAGGCAAGTAACATTTGCAAAGAGAAGGAATGGACTTTTGAAGAAAGCCTATGAGCTTTCCGTTCTTTGTGATGCAGAGATTGCTCTCATCATCTTCTCCAATAGAGGAAAGCTGTACGAGTTTTGCAGTAGTTCAAGCATGCTCAAAACTCTTGAGAGGTACCAGAAGTGCAACTATGGAGCACCAGAGCCAAATGTGTCAGCAAGGGAGGCCTTGGAACTGAGTAGCCAGCAGGAATATCTGAAGCTTAAAGCACGCTACGAAGCTCTGCAAAGAACCCAGAGGAATCTTTTGGGAGAAGACCTTGGCCCTCTGAGCAGCAAAGAGCTTGAATCACTTGAAAGACAGCTTGATATGTCACTGAAGCAGATCAGATCAACAAGGACCCAGTACATGCTGGATCAGCTCAATGATCTACAGCATAAGGAACACATGTTGACTGCAGCTAATAAGTCTCTGAGAGAAAGGTTGATGGAAGGTTACGAAGTAAATTCACTCCAGTTGAATCTAAGTGCAGAAGATGTGGGTTTTTCTCGACAACAAGCTCAACCCCAAGGTTATGGATTCTTTCATCCTTTGGAGTGCGAACCTACTTTACAAATTGGGTATCAGCCTGACAGTGCTATAACAGTGGTCACTTCTGGCCCAAGTATGACTGCTTACATGCCAGGTTGGTTACCATGA。
Above-mentioned plant comprises flowers and common plant.
Like tobacco and the plant close, adopt the overexpression mode of said PtSEP gene to realize with tobacco.
The invention discloses Cortex Populi Tomentosae SEP encoding sox, this gene has significantly shifted to an earlier date the flowering time of transgene tobacco, and the inflorescence branch of transgene tobacco also obviously reduces, and this proterties can genetic stability.
In the specific embodiment of the present invention; Utilize the secondary dimension pipe of Cortex Populi Tomentosae regeneration system rapidly; Conjugated protein group method is studied the basic protein in the sample of regeneration different times; Obtain 105 basic proteins, selected can regulate and control the MADS-Box family that herbage blooms the PtSEP gene as goal gene, cloned its cDNA total length.Made up the overexpression vector of PtSEP gene and changed tobacco over to, made discovery from observation, the overexpression transgene tobacco occurred flowering time in advance and the inflorescence branch obviously reduce.
The MADS-box gene family has important regulating and controlling to use for each stage of development of floral organs; In order further to study the function of PtSEP protein gene through transgenic technology; The present invention has made up its overexpression carrier; Adopt agriculture bacillus mediated leaf dish method with its transformation of tobacco, obtained 19 strain overexpression transgene tobaccos, have 6 strains to find identical abnormal phenotype.The isometric growth condition is compared with wild-type tobacco with the transgenic under the time; Obviously elongation between the stem of transgene tobacco when expansion number of sheets order is 6; The existing petal in top occurs, and wild-type still also is in vegetative growth phase, launch just can bloom after the leaf at 25; Can find out that the transgene tobacco flowering time has shifted to an earlier date greatly, the inflorescence branch of transgene tobacco has also significantly reduced.The seed of gathering in the crops behind the above-mentioned prematurity tobacco three generations still keeps precocious characteristic.
The above; Be merely the preferable embodiment of the present invention, but protection scope of the present invention is not limited thereto, any technician who is familiar with the present technique field is in the technical scope that the present invention discloses; The variation that can expect easily or replacement all should be encompassed within protection scope of the present invention.
Nucleotide or aminoacid sequence
<110>
< 120>willow PtSEP gene is used for plant prematurity inductive method
<140>
<141>
<160>1
<210>1
<211>732
<212>cDNA
< 213>the PtSEP gene of willow
<220>
<223>
<400>1
atggggagag?gtagggttga?gttgaagaga?attgagaaca?agatcaacag?gcaagtaaca?60
tttgcaaaga?gaaggaatgg?acttttgaag?aaagcctatg?agctttccgt?tctttgtgat?120
gcagagattg?ctctcatcat?cttctccaat?agaggaaagc?tgtacgagtt?ttgcagtagt?180
tcaagcatgc?tcaaaactct?tgagaggtac?cagaagtgca?actatggagc?accagagcca?240
aatgtgtcag?caagggaggc?cttggaactg?agtagccagc?aggaatatct?gaagcttaaa?300
gcacgctacg?aagctctgca?aagaacccag?aggaatcttt?tgggagaaga?ccttggccct?360
ctgagcagca?aagagcttga?atcacttgaa?agacagcttg?atatgtcact?gaagcagatc?420
agatcaacaa?ggacccagta?catgctggat?cagctcaatg?atctacagca?taaggaacac?480
atgttgactg?cagctaataa?gtctctgaga?gaaaggttga?tggaaggtta?cgaagtaaat?540
tcactccagt?tgaatctaag?tgcagaagat?gtgggttttt?ctcgacaaca?agctcaaccc?600
caaggttatg?gattctttca?tcctttggag?tgcgaaccta?ctttacaaat?tgggtatcag?660
cctgacagtg?ctataacagt?ggtcacttct?ggcccaagta?tgactgctta?catgccaggt?720
tggttaccat?ga 732
Claims (2)
1. a willow PtSEP gene is used for plant prematurity inductive method, it is characterized in that, comprising:
As goal gene, clone its cDNA total length with the PtSEP gene of willow, make up the overexpression vector of said PtSEP gene and change plant over to, be used for the flowering time of plant in advance;
Said PtSEP gene is following cDNA sequence:
ATGGGGAGAGGTAGGGTTGAGTTGAAGAGAATTGAGAACAAGATCAACAGGCAAGTAACATTTGCAAAGAGAAGGAATGGACTTTTGAAGAAAGCCTATGAGCTTTCCGTTCTTTGTGATGCAGAGATTGCTCTCATCATCTTCTCCAATAGAGGAAAGCTGTACGAGTTTTGCAGTAGTTCAAGCATGCTCAAAACTCTTGAGAGGTACCAGAAGTGCAACTATGGAGCACCAGAGCCAAATGTGTCAGCAAGGGAGGCCTTGGAACTGAGTAGCCAGCAGGAATATCTGAAGCTTAAAGCACGCTACGAAGCTCTGCAAAGAACCCAGAGGAATCTTTTGGGAGAAGACCTTGGCCCTCTGAGCAGCAAAGAGCTTGAATCACTTGAAAGACAGCTTGATATGTCACTGAAGCAGATCAGATCAACAAGGACCCAGTACATGCTGGATCAGCTCAATGATCTACAGCATAAGGAACACATGTTGACTGCAGCTAATAAGTCTCTGAGAGAAAGGTTGATGGAAGGTTACGAAGTAAATTCACTCCAGTTGAATCTAAGTGCAGAAGATGTGGGTTTTTCTCGACAACAAGCTCAACCCCAAGGTTATGGATTCTTTCATCCTTTGGAGTGCGAACCTACTTTACAAATTGGGTATCAGCCTGACAGTGCTATAACAGTGGTCACTTCTGGCCCAAGTATGACTGCTTACATGCCAGGTTGGTTACCATGA；
Described plant comprises tobacco and/or flowers.
2. willow PtSEP gene according to claim 1 is used for plant prematurity inductive method, it is characterized in that, adopts the overexpression mode of said PtSEP gene to realize.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101009128A CN102304546B (en) | 2010-01-25 | 2010-01-25 | Method for inducing plants to bloom early by populus tomentosa sepallata (PtSEP) gene of poplar |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101009128A CN102304546B (en) | 2010-01-25 | 2010-01-25 | Method for inducing plants to bloom early by populus tomentosa sepallata (PtSEP) gene of poplar |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102304546A CN102304546A (en) | 2012-01-04 |
| CN102304546B true CN102304546B (en) | 2012-11-21 |
Family
ID=45378462
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101009128A Expired - Fee Related CN102304546B (en) | 2010-01-25 | 2010-01-25 | Method for inducing plants to bloom early by populus tomentosa sepallata (PtSEP) gene of poplar |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102304546B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103210773B (en) * | 2013-05-03 | 2014-06-25 | 李敏 | Method of promoting flowering and fructification of arbor willow in advance |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1171817A (en) * | 1994-11-02 | 1998-01-28 | 约翰·英尼斯创新中心有限公司 | Genetic control of flowering |
| CN1678748A (en) * | 2002-09-05 | 2005-10-05 | 作物培植股份有限公司 | Plants having changed development and a method for making the same |
| CN1772906A (en) * | 2005-09-27 | 2006-05-17 | 中国农业科学院油料作物研究所 | Rape pyruvic dehydrogenase kinase gene and its application in rape |
-
2010
- 2010-01-25 CN CN2010101009128A patent/CN102304546B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1171817A (en) * | 1994-11-02 | 1998-01-28 | 约翰·英尼斯创新中心有限公司 | Genetic control of flowering |
| CN1678748A (en) * | 2002-09-05 | 2005-10-05 | 作物培植股份有限公司 | Plants having changed development and a method for making the same |
| CN1772906A (en) * | 2005-09-27 | 2006-05-17 | 中国农业科学院油料作物研究所 | Rape pyruvic dehydrogenase kinase gene and its application in rape |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102304546A (en) | 2012-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ng et al. | Function and evolution of the plant MADS-box gene family | |
| Chen et al. | Inflorescence development and the role of LsFT in regulating bolting in lettuce (Lactuca sativa L.) | |
| Shulga et al. | Overexpression of AP1-like genes from Asteraceae induces early-flowering in transgenic Chrysanthemum plants | |
| JP6712285B2 (en) | FT Family Nucleic Acids and Peptides/Proteins Providing Tobacco Flowering Inhibitory Properties and Transgenic Plants Transformed Therewith | |
| KR102113500B1 (en) | Method for producing genome-edited Brassica rapa plant having late flowering trait by SOC1 gene editing and the plant thereof | |
| Lei et al. | Molecular cloning and functional characterization of CoFT1, a homolog of FLOWERING LOCUS T (FT) from Camellia oleifera | |
| CN107287208A (en) | Florescence control gene and relevant carriers and its application | |
| CN105017395B (en) | A kind of rubber tree blooms modulin HbTFL1-2 and its encoding gene and application | |
| CN109456979B (en) | Method for establishing controllable tomato nuclear male sterile line by using SlPIF3 gene and establishing method and application thereof | |
| US20130180001A1 (en) | Plants that reproduce via unreduced gametes | |
| Moreira et al. | SELF PRUNING 3C is a flowering repressor that modulates seed germination, root architecture, and drought responses | |
| US11034971B2 (en) | Inhibition of bolting and flowering of a beta vulgaris plant | |
| CN102304546B (en) | Method for inducing plants to bloom early by populus tomentosa sepallata (PtSEP) gene of poplar | |
| CN105037518B (en) | A kind of rubber tree blooms modulin HbTFL1 3 and its encoding gene and application | |
| CN102421793A (en) | Polypeptide having function for delaying anthesis or suppressing growth, polynucleotide encoding the same, and use thereof | |
| KR100860199B1 (en) | the production of fruit tree for transforming tree form by using MADS-Box gene | |
| CN108456683B (en) | Function and application of gene SID1 for regulating heading stage of rice | |
| Zheng et al. | Grafting induces flowering time and tuber formation changes in Brassica species involving FT signalling | |
| CN105017396B (en) | A kind of rubber tree blooms modulin HbTFL1 1 and its encoding gene and application | |
| CN102168086B (en) | Phalaenopsis miR172 coding sequence and application thereof | |
| CN103665129B (en) | One kind of plant associated protein TaMYB72 at heading stage and application thereof | |
| CN108165553B (en) | A kind of rubber tree floral organ characterization factor gene and its coded product and application | |
| KR101382402B1 (en) | A gene for promoting dwarfness and branches of plants and a transgenic plant comprising the same | |
| CN101921754A (en) | Soybean blossoming regulation gene GmCIB4, coding protein and application thereof | |
| CN102250947B (en) | Preparation method of plant male sterile line and restorer line and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121121 Termination date: 20140125 |