CN102296070A - Bombyx mori midgut specific high-level expression promoter P2 and use thereof - Google Patents
Bombyx mori midgut specific high-level expression promoter P2 and use thereof Download PDFInfo
- Publication number
- CN102296070A CN102296070A CN 201110273393 CN201110273393A CN102296070A CN 102296070 A CN102296070 A CN 102296070A CN 201110273393 CN201110273393 CN 201110273393 CN 201110273393 A CN201110273393 A CN 201110273393A CN 102296070 A CN102296070 A CN 102296070A
- Authority
- CN
- China
- Prior art keywords
- silkworm
- midgut
- egfp
- bombyx mori
- specific promoter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to gene engineering, in particular to a bombyx mori gene promoter, namely bombyx mori midgut specific high-level expression promoter P2 represented by SEQ ID No.1 or SEQ ID No.2, and the use thereof in specific expression of foreign proteins in bombyx mori midgut. The invention also relates to the recombinant vector of the bombyx mori midgut specific high-level expression promoter P2 and the preparation method thereof. The promoter is capable of specifically promote the high-level expression of a downstream gene in bombyx mori midgut, and provides a powerful tool for the study and utilization of a bombyx mori midgut specific gene, particularly midgut specific high-level expression immune resistance associated gene; and meanwhile, the promoter can realize the specific high-level expression of the foreign gene in the bombyx mori midgut, and thus, has a bright application prospect.
Description
Technical field
The present invention relates to genetically engineered, particularly the domestic silkworm gene promotor.。
Background technology
Silkworm is a kind of insect with important economic worth, and as lepidopterous model animals, silkworm all has vital role aspect theory research and the production application.Midgut is the important immuning tissue organ of silkworm, and a lot of cause of diseases can be eaten infected silkworm down by per os, and after these cause of diseases, midgut will be first histoorgan that is infected, and also be the first line of defence of silkworm simultaneously under the manager nibbles.At present fewer to the research of silkworm midgut, major cause is that utilizable research means is limited.Along with finishing in succession of domestic silkworm gene framing figure and meticulous collection of illustrative plates drawing, human research and understanding to silkworm enters the genome times afterwards comprehensively, along with the breakthrough of silkworm transgenic technology and perfect, transgenosis has become silkworm research gene and has utilized the strong instrument of gene, but transgenic technology also needs the cooperation of other research tools just can better bring into play effect.A lot of silkworm midgut specific expression genes are not only expressed and unusual expressing at midgut of a large amount at midgut, according to found that of information analysis, the gene that the special a large amount of these midgut is expressed may have important effect, wherein also comprise many and the relevant gene of the immune resistance of silkworm, to study and the gene that utilizes the special a large amount of these silkworm midgut to express just needs a special a large amount expression promoter of silkworm midgut by transgenosis, but not have the special a large amount of silkworm midgut to express the relevant report of promotor at present.
Summary of the invention
One of purpose of the present invention is to provide a kind of promotor, and it can special a large amount be expressed in the silkworm midgut.
For achieving the above object, technical scheme of the present invention is:
Silkworm midgut specific promoter P2, silkworm midgut specific promoter P2 contains just like the nucleotide sequence shown in the SEQ ID NO:1.
Further, the nucleotide sequence of silkworm midgut specific promoter P2 shown in SEQ ID NO:2.
Two of purpose of the present invention is to provide a kind of recombinant vectors, and it contains silkworm midgut specific promoter P2, and this recombinant vectors can guarantee at the silkworm midgut specific expressed.
For achieving the above object, technical scheme of the present invention is:
The recombinant vectors that contains described silkworm midgut specific promoter P2.
Further, described recombinant vectors is recombinant expression vector P2-EGFP-SV40-1180, wherein P2 represents promotor P2, described promotor P2 upstream and downstream contains Sal I and BamH I restriction enzyme site respectively, EGFP-SV40-1180 is specially the pSLfa1180fa carrier that contains EGFP T clone and SV40 terminator, described EGFP T clone upstream and downstream contains BamH I and Not I restriction enzyme site respectively, and described SV40 terminator upstream and downstream contains Not I and Hind III restriction enzyme site respectively.
Further, described recombinant vectors is recombinant expression vector pBac[P2-EGFP-SV40-3 * P3-DsRed af], described recombinant expression vector is by P2-EGFP-SV40 and pBac[3 * P3-DsRed af] be formed by connecting, described P2-EGFP-SV40 is for to cut the P2-EGFP-SV40-1180 gained with restriction enzyme A sc I enzyme, described pBac[3 * P3-DsRed af] for through Asc I enzyme is cut after, 5 ' holding the dephosphorylation linear fragment.
Three of purpose of the present invention is to provide the application of promotor P2, and this expression that is applied as silkworm midgut foreign protein provides new approaches.
Described silkworm midgut specific promoter P2 is in the application of the specific expressed foreign protein of silkworm midgut.
Technique scheme is undertaken by following technological line: filter out the gene BGIBMGA014298 gene that the special a large amount of silkworm midgut is expressed, getting the genome sequence of the preceding 1080bp of this gene A TG analyzes, nucleotide sequence that must be shown in SEQ ID NO:1 and SEQ ID NO:2 contains silkworm midgut specific promoter P2 in the above-mentioned sequence; Preparation expression vector pBac[P2-EGFP-SV40-3 * P3-DsRed af], and by microinjection in silkworm seed, and hatch, raise to changing moth, with fluorescence microscope only midgut the intensive green fluorescence is arranged, through RT-PCR and fluorescence quantitative PCR detection only midgut detect the EGFP of high expression level amount.
Beneficial effect of the present invention is: combine by laboratory facilities such as information analysis, RT-PCR, quantitative fluorescent PCR, silkworm seed embryo microinjection and microscope Fluirescence observations, utilize transgene clone to identify the special a large amount expression of a silkworm midgut promotor first.This promotor can specificly be expressed in silkworm midgut a large amount, for the immune resistance related gene of studying and utilize the special a large amount of silkworm midgut specific gene, particularly midgut to express provides strong instrument; Also can have a good application prospect simultaneously at the special a large amount expression alien gene of silkworm midgut.
Description of drawings
Fig. 1 is the microscopically photo through the transgenic bombyx mori of microinjection and negative control silkworm, wherein A is a photo under the transgenic bombyx mori light field, photo under the negative contrast of the B silkworm light field, C is a photo under the transgenic bombyx mori light field, D is transgenic bombyx mori photo under the GFP exciting light.
Fig. 2 is the microscopically photo through the dissection transgenic bombyx mori of microinjection and dissection negative control silkworm, wherein A is for dissecting photo under the transgenic bombyx mori light field, B is for dissecting photo under the negative control silkworm light field, C is for dissecting transgenic bombyx mori photo under the GFP exciting light, and D is for dissecting negative control silkworm photo under the GFP exciting light.
Fig. 3 is the midgut microscopically photo through the midgut of the transgenic bombyx mori of microinjection and negative control silkworm, wherein, photo under the negative contrast of the A silkworm microscope light field, photo under the negative contrast of the B silkworm microscope G FP exciting light, C is a photo under the midgut microscope light field of transgenic bombyx mori, and D is a photo under the midgut microscope G FP exciting light of transgenic bombyx mori.
Fig. 4 is RT-PCR figure, and figure A is a transgenic bombyx mori, the negative contrast of figure B silkworm, and wherein, 1 represents blood, and 2 represent fatty body, and 3 represent midgut.
In the above-mentioned accompanying drawing, transgenic bombyx mori is meant through microinjection pBac[P2-EGFP-SV40-3 * P3-DsRed af] successful silkworm, the negative control silkworm is meant the silkworm without any processing.
Embodiment
Embodiment 1: the EGFP expression vector P2-PR that makes up the P2 mediation
(1) utilizes silkworm chip data (http://silkworm.swu.edu.cn/silkdb/) in the domestic silkworm gene group database, filter out the gene of silkworm midgut specifically expressing, select the highest preceding 5 genes of expression amount then, in the silkworm genome database, download these 5 genes CDS sequence and ETS sequence separately, utilize software Primer Premier 5.0 to design special detection primer respectively.Carry out RT-PCR and detect with making 3 days 5 ages each tissue cDNA templates greatly, the pcr amplification condition is: 94 ℃ of pre-sex change 4 minutes, and 40 seconds, 55 ℃ annealing of 94 ℃ of sex change were extended 20 seconds for 40 seconds, 72 ℃, totally 30 circulations, last 72 ℃ were extended 10 minutes.The PCR product carries out agarose gel electrophoresis and detects, and finds that BGIBMGA014298 gene (this full length gene 672bp comprises 7 exons and 6 introns) is to express in the special a large amount of silkworm midgut really.Detect primer BGIBMGA014298 F:5'GATTTGAACCACCGCAGTAT 3', BGIBMGA014298(SEQ ID NO:3) R:5'CGTTGACGGCGACAGAAG3'(SEQ ID NO:4);
(2) in the silkworm genome database, the translation initiation site ATG of this gene is positioned at the 1081st bit base of scaffold1148, so choosing the genome sequence of the preceding 1080bp of this gene A TG analyzes, find (http://www.fruitfly.org/seq_tools/promoter.html) through the website prediction, typical promoter structure zone is arranged in this section sequence, so design special primer (P2 F:5'ACGCGTCGACGTCCCCCATCCAGCAGTC 3'(SEQ ID NO:5) P2 R:5'cgGGATCCTTTTTTGCTGAAAGAAACGTACA 3'(SEQ ID NO:6), clone the sequence P2 of this 1080bp, to make genome greatly is template, carry out pcr amplification with the P2 primer, obtained the purpose band, the PCR product reclaims the back and is connected with pMD19-T Simple carrier, transform DH5 α competent cell, obtain to be sent to Shanghai Sangon order-checking behind the positive colony, sequencing result shows that the sequence of amplification is consistent with expected result;
The sequence of the silkworm midgut specific expression promoter P2 that aforesaid method obtains is the nucleotide sequence shown in SEQ ID NO:2.
gtcccccatccagcagtcctggtcggtggggacgaagtacggctccgcagcgacagcgacgtcgattgaccactccgccatggtgtggacgaggagatcctgtgccctggcggagtggttcaaattactttgaaggaagcgatggacacaacccattacggggctacatccatcgctccctcgtctgttccgccctgcggctcgacaacagccgcggcgggaactgactcgccggctgcccttgttgcagccggcttctttttctttccgcccctcctcgtgtttgtagaggagggggcggacttgcacgccgggcccccggcccggtggtcagccttccttttagccgcgtcgcacaagacgcagtgcggcgcggctgcggtgcaggaggctgccttgtgccccggttggccgcagcggaagcacaggttgctgcggtccccgatagctgttgtcctatccaattccatttttttttcaagtaagccaaatttggagtatgacaacgtattaagactaaataatttcaggcatcttgaagtaatgccatacatgtattaaagaacagttcaaaaacatttcatgaatcttgacataataaatatatctttaatgtcttaaatgaactcatcacgaaaatgaacgaaaactctgcaataaggatgataatatttacttctttgtttcagtaatattttccaaatttatcaccaatctatcgatttcgtgattatcacgtctcaatttaattttgttttcactttgaaatgtaataatatacacatttcaatcagataatcttgatcaagattgttttaatgtacgtcagctaatagagaatacgttatcagcttaagcgtaggaaacag
TATAAAtaccgaatgaaaattcaataaatc
Gtacacatttatttggtgaggtaagagcatttgtgtttctcagggaaacactgaaaattacataaattttaacttctgttctctctatcaaaacaatttcaaatcataccagtttaaatcgcaggtgccaagtaacatttatacttcattattgtacgtttctttcagcaaaaaatcgaca
ATG
Wherein,
GThe expression transcription initiation site;
ATGThe expression translation initiation site, TATAAA represents the TATA box.Then silkworm midgut specific promoter P2 contains just like the nucleotide sequence shown in the SEQ ID No:1:
gtcccccatccagcagtcctggtcggtggggacgaagtacggctccgcagcgacagcgacgtcgattgaccactccgccatggtgtggacgaggagatcctgtgccctggcggagtggttcaaattactttgaaggaagcgatggacacaacccattacggggctacatccatcgctccctcgtctgttccgccctgcggctcgacaacagccgcggcgggaactgactcgccggctgcccttgttgcagccggcttctttttctttccgcccctcctcgtgtttgtagaggagggggcggacttgcacgccgggcccccggcccggtggtcagccttccttttagccgcgtcgcacaagacgcagtgcggcgcggctgcggtgcaggaggctgccttgtgccccggttggccgcagcggaagcacaggttgctgcggtccccgatagctgttgtcctatccaattccatttttttttcaagtaagccaaatttggagtatgacaacgtattaagactaaataatttcaggcatcttgaagtaatgccatacatgtattaaagaacagttcaaaaacatttcatgaatcttgacataataaatatatctttaatgtcttaaatgaactcatcacgaaaatgaacgaaaactctgcaataaggatgataatatttacttctttgtttcagtaatattttccaaatttatcaccaatctatcgatttcgtgattatcacgtctcaatttaattttgttttcactttgaaatgtaataatatacacatttcaatcagataatcttgatcaagattgttttaatgtacgtcagctaatagagaatacgttatcagcttaagcgtaggaaacag
tataaataccgaatgaaaattcaataaatc
Then with restriction enzyme A sc I respectively enzyme cut P2-EGFP-SV40-1180 and pBac[3 * P3-DsRed af], because the pSLfa1180fa carrier framework all contains an Asc I site at the multiple clone site two ends, the EGFP that downcuts express skeleton structure just can with cut back 5 ' through Asc I enzyme and hold dephosphorylized pBac[3 * P3-DsRed af] linear fragment is connected, and forms EGFP transgene expression vector pBac[P2-EGFP-SV40-3 * P3-DsRed af that final P2 mediates].
The checking of embodiment 3 promoter functions
With embodiment 2 gained recombinant expression vector pBac[P2-EGFP-SV40-3 * P3-DsRed af] as the microinjection carrier, carry out the functional verification of silkworm midgut specific expression promoter P2.
After silkworm made kind silkworm seed pickling termination of diapause greatly, be put in the dark surrounds of 15 ℃ and 80% humidity and hasten the hatching of silkworms until hatching, newly-hatched silkworm kept well place standard environment to raise (temperature: 25 ℃, humidity: 80%), change moth later on female male Bombycis mori mating 4 hours, the silkworm seed of giving birth to behind the separation of copulating moth is non-diapause silkworm seed, is used for next step microinjection;
With silkworm seed marshalling on clean slide glass of giving birth to, in 2 hours postpartum of silkworm seed with the Eppendorf microinjection instrument with P2-PR and helper plasmid A3H, being injected into 205 together makes in the silkworm seed greatly, with nontoxic glue sealing to be placed on 25 ℃, the hatching of hastening the hatching of silkworms in the environment of relative humidity 80%, 139 G0 of hatching are collected raising to changing moth (seeing Fig. 1 for details) for newly-hatched silkworm with mulberry leaf, G0 encloses G1 for silkworm seed for silkworm moth by the selfing or common acquisition 29 moths of backcrossing, with the electronic macroscopical fluorescence microscope screening of Olympus and obtain 5 positive moths circles, transformation efficiency is 17.20%.
The single separately moth circle of positive moth circle that obtains is raised, and subculture expansion obtains 5 P2 transgenosis systems, and (P2-1 P2-2) carries out Fluirescence observation to select 2 transgenosis systems at random.Below fluorescent microscope even can see through the blood of P2 and the green fluorescence (result as shown in Figure 2) that epidermis is observed midgut; Body wall is cut off to head along dorsomeson from the silkworm larva caudal horn with scissors, opened body cavity, with the pin oblique cutting both sides body wall is fixed in the cake wax, by shown in Figure 3: at P2 transgenosis system midgut the intensive green fluorescence is arranged, its hetero-organization does not have green fluorescence.
Get the organization materials such as midgut, fatty body and blood of P2-1, extract RNA, reverse transcription becomes cDNA.Utilize the special primer of EGFP to carry out RT-PCR and detect, the pcr amplification condition is: 94 ℃ of pre-sex change 4 minutes, and 40 seconds, 57 ℃ annealing of 94 ℃ of sex change were extended 10 seconds for 40 seconds, 72 ℃, totally 30 circulations, last 72 ℃ were extended 10 minutes.The PCR product carries out agarose gel electrophoresis and detects, and as shown in Figure 4, expression and the expression amount of only finding to detect at midgut EGFP are very high, illustrates that P2 is the special a large amount expression of silkworm midgut promotor really.
Explanation is at last, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although by invention has been described with reference to the preferred embodiments of the present invention, but those of ordinary skill in the art is to be understood that, can make various changes to it in the form and details, and the spirit and scope of the present invention that do not depart from appended claims and limited.
＜110〉Southwestern University
＜120〉the special a large amount of silkworm midgut is expressed promotor P2 and application thereof
<160> 6
<210> 1
<211> 899
<212> DNA
＜213〉silkworm (
Bombyx moriL.)
<220>
＜223〉the special a large amount of silkworm midgut is expressed specific promoter P2 brachymemma
<400> 1
gtcccccatc?cagcagtcct?ggtcggtggg?gacgaagtac?ggctccgcag?cgacagcgac 60
gtcgattgac?cactccgcca?tggtgtggac?gaggagatcc?tgtgccctgg?cggagtggtt 120
caaattactt?tgaaggaagc?gatggacaca?acccattacg?gggctacatc?catcgctccc 180
tcgtctgttc?cgccctgcgg?ctcgacaaca?gccgcggcgg?gaactgactc?gccggctgcc 240
cttgttgcag?ccggcttctt?tttctttccg?cccctcctcg?tgtttgtaga?ggagggggcg 300
gacttgcacg?ccgggccccc?ggcccggtgg?tcagccttcc?ttttagccgc?gtcgcacaag 360
acgcagtgcg?gcgcggctgc?ggtgcaggag?gctgccttgt?gccccggttg?gccgcagcgg 420
aagcacaggt?tgctgcggtc?cccgatagct?gttgtcctat?ccaattccat?ttttttttca 480
agtaagccaa?atttggagta?tgacaacgta?ttaagactaa?ataatttcag?gcatcttgaa 540
gtaatgccat?acatgtatta?aagaacagtt?caaaaacatt?tcatgaatct?tgacataata 600
aatatatctt?taatgtctta?aatgaactca?tcacgaaaat?gaacgaaaac?tctgcaataa 660
ggatgataat?atttacttct?ttgtttcagt?aatattttcc?aaatttatca?ccaatctatc 720
gatttcgtga?ttatcacgtc?tcaatttaat?tttgttttca?ctttgaaatg?taataatata 780
cacatttcaa?tcagataatc?ttgatcaaga?ttgttttaat?gtacgtcagc?taatagagaa 840
tacgttatca?gcttaagcgt?aggaaacagt?ataaataccg?aatgaaaatt?caataaatc 899
<210> 2
<211> 1083
<212> DNA
＜213〉silkworm (
Bombyx moriL.)
<220>
＜223〉the special a large amount of silkworm midgut is expressed promotor P2
<400> 2
gtcccccatc?cagcagtcct?ggtcggtggg?gacgaagtac?ggctccgcag?cgacagcgac 60
gtcgattgac?cactccgcca?tggtgtggac?gaggagatcc?tgtgccctgg?cggagtggtt 120
caaattactt?tgaaggaagc?gatggacaca?acccattacg?gggctacatc?catcgctccc 180
tcgtctgttc?cgccctgcgg?ctcgacaaca?gccgcggcgg?gaactgactc?gccggctgcc 240
cttgttgcag?ccggcttctt?tttctttccg?cccctcctcg?tgtttgtaga?ggagggggcg 300
gacttgcacg?ccgggccccc?ggcccggtgg?tcagccttcc?ttttagccgc?gtcgcacaag 360
acgcagtgcg?gcgcggctgc?ggtgcaggag?gctgccttgt?gccccggttg?gccgcagcgg 420
aagcacaggt?tgctgcggtc?cccgatagct?gttgtcctat?ccaattccat?ttttttttca 480
agtaagccaa?atttggagta?tgacaacgta?ttaagactaa?ataatttcag?gcatcttgaa 540
gtaatgccat?acatgtatta?aagaacagtt?caaaaacatt?tcatgaatct?tgacataata 600
aatatatctt?taatgtctta?aatgaactca?tcacgaaaat?gaacgaaaac?tctgcaataa 660
ggatgataat?atttacttct?ttgtttcagt?aatattttcc?aaatttatca?ccaatctatc 720
gatttcgtga?ttatcacgtc?tcaatttaat?tttgttttca?ctttgaaatg?taataatata 780
cacatttcaa?tcagataatc?ttgatcaaga?ttgttttaat?gtacgtcagc?taatagagaa 840
tacgttatca?gcttaagcgt?aggaaacagt?ataaataccg?aatgaaaatt?caataaatcg 900
tacacattta?tttggtgagg?taagagcatt?tgtgtttctc?agggaaacac?tgaaaattac 960
ataaatttta?acttctgttc?tctctatcaa?aacaatttca?aatcatacca?gtttaaatcg 1020
caggtgccaa?gtaacattta?tacttcatta?ttgtacgttt?ctttcagcaa?aaaatcgaca 1080
atg 1083
<210> 3
<211> 20
<212> DNA
＜213〉artificial sequence
<220>
＜223〉primer BGIBMGA014298 F
<400> 3
gatttgaacc?accgcagtat 20
<210> 4
<211> 18
<212> DNA
＜213〉artificial sequence
<220>
＜223〉primer BGIBMGA014298 R
<400> 4
cgttgacggc?gacagaag 18
<210> 5
<211> 28
<212> DNA
＜213〉artificial sequence
<220>
＜223〉primer P2 F
<400> 5
acgcgtcgac?gtcccccatc?cagcagtc 28
<210> 6
<211> 31
<212> DNA
＜213〉artificial sequence
<220>
＜223〉primer P2 R
<400> 6
cgggatcctt?ttttgctgaa?agaaacgtac?a 31
Claims (6)
1. silkworm midgut specific promoter P2 is characterized in that, silkworm midgut specific promoter P2 contains just like the nucleotide sequence shown in the SEQ ID NO:1.
2. silkworm midgut specific promoter P2 according to claim 1 is characterized in that, the nucleotide sequence of silkworm midgut specific promoter P2 shown in SEQ ID NO:2.
3. the recombinant vectors that contains claim 1 or 2 described silkworm midgut specific promoter P2.
4. the recombinant vectors of silkworm midgut specific promoter P2 according to claim 3, it is characterized in that, described recombinant vectors is recombinant expression vector P2-EGFP-SV40-1180, wherein P2 represents promotor P2, described promotor P2 upstream and downstream contains Sal I and BamH I restriction enzyme site respectively, EGFP-SV40-1180 is specially the pSLfa1180fa carrier that contains EGFP TA clone and SV40 terminator, described EGFP T clone upstream and downstream contains BamH I and Not I restriction enzyme site respectively, and described SV40 terminator upstream and downstream contains Not I and Hind III restriction enzyme site respectively.
5. the recombinant vectors of silkworm midgut specific promoter P2 according to claim 3, it is characterized in that, described recombinant vectors is recombinant expression vector pBac[P2-EGFP-SV40-3 * P3-DsRed af], described recombinant expression vector is by EGFP and pBac[3 * P3-DsRed af] be formed by connecting, described EGFP is for to cut the P2-EGFP-SV40-1180 gained with restriction enzyme A sc I enzyme, described pBac[3 * P3-DsRed af] for through Asc I enzyme is cut after, 5 ' holding the dephosphorylation linear fragment.
6. claim 1 or 2 described silkworm midgut specific promoter P2 are in the application of the specific expressed foreign protein of silkworm midgut.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110273393XA CN102296070B (en) | 2011-09-15 | 2011-09-15 | Bombyx mori midgut specific high-level expression promoter P2 and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110273393XA CN102296070B (en) | 2011-09-15 | 2011-09-15 | Bombyx mori midgut specific high-level expression promoter P2 and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102296070A true CN102296070A (en) | 2011-12-28 |
| CN102296070B CN102296070B (en) | 2012-11-21 |
Family
ID=45356746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110273393XA Active CN102296070B (en) | 2011-09-15 | 2011-09-15 | Bombyx mori midgut specific high-level expression promoter P2 and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102296070B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925484A (en) * | 2012-11-21 | 2013-02-13 | 西南大学 | Application and recombinant vector of bombyx mori nuclear polyhedrosis virus polygene inverted repeat sequence and bombyx mori lipase-1 gene |
| CN103757023A (en) * | 2014-01-23 | 2014-04-30 | 西南大学 | Ecdysone-replying silkworm vitellogenin promoter as well as preparation method and application thereof |
| CN105886511A (en) * | 2016-06-24 | 2016-08-24 | 南阳师范学院 | Bombyx mori BmP56 gene promoter as well as recombinant expression vector and application thereof |
| CN107151668A (en) * | 2017-06-30 | 2017-09-12 | 西南大学 | A kind of authentication method of the promoter with silkworm haemocyte activity specific |
| CN112852825A (en) * | 2021-01-27 | 2021-05-28 | 南阳师范学院 | Antheraea pernyi midgut specific gene ApLITAF and promoter and application thereof |
-
2011
- 2011-09-15 CN CN201110273393XA patent/CN102296070B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| 《BMC Biotechnology》 20060616 Abhimanyu Sarkar Insulated piggyBac vectors for insect transgenesis 1-9 5 第6卷, 第27期 * |
| 《农业生物技术学报》 20071231 张美蓉 红色荧光标记载体pBacA4DsRed 的构建及其在蚕卵中的瞬时表达 346-347 5 第2卷, * |
| 《蚕业科学》 20101231 高志宏 不同截短的丝素重链基因启动子驱动报告基因在家蚕组织中的表达 0391－0399 1-6 第36卷, 第3期 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925484A (en) * | 2012-11-21 | 2013-02-13 | 西南大学 | Application and recombinant vector of bombyx mori nuclear polyhedrosis virus polygene inverted repeat sequence and bombyx mori lipase-1 gene |
| CN102925484B (en) * | 2012-11-21 | 2014-09-10 | 西南大学 | Application and recombinant vector of bombyx mori nuclear polyhedrosis virus polygene inverted repeat sequence and bombyx mori lipase-1 gene |
| CN103757023A (en) * | 2014-01-23 | 2014-04-30 | 西南大学 | Ecdysone-replying silkworm vitellogenin promoter as well as preparation method and application thereof |
| CN103757023B (en) * | 2014-01-23 | 2015-09-23 | 西南大学 | Silkworm egg xanthan protein promoter of response moulting hormone and its preparation method and application |
| CN105886511A (en) * | 2016-06-24 | 2016-08-24 | 南阳师范学院 | Bombyx mori BmP56 gene promoter as well as recombinant expression vector and application thereof |
| CN105886511B (en) * | 2016-06-24 | 2018-11-06 | 南阳师范学院 | Silkworm BmP56 gene promoters and its recombinant expression carrier and application |
| CN107151668A (en) * | 2017-06-30 | 2017-09-12 | 西南大学 | A kind of authentication method of the promoter with silkworm haemocyte activity specific |
| CN112852825A (en) * | 2021-01-27 | 2021-05-28 | 南阳师范学院 | Antheraea pernyi midgut specific gene ApLITAF and promoter and application thereof |
| CN112852825B (en) * | 2021-01-27 | 2023-05-26 | 南阳师范学院 | Tussah midgut specific gene ApLITAF and promoter and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102296070B (en) | 2012-11-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kao et al. | The genome of the crustacean Parhyale hawaiensis, a model for animal development, regeneration, immunity and lignocellulose digestion | |
| Schubert et al. | Amphioxus and tunicates as evolutionary model systems | |
| Crawford et al. | Highly efficient knockout of a squid pigmentation gene | |
| CN102296070B (en) | Bombyx mori midgut specific high-level expression promoter P2 and use thereof | |
| US8232450B1 (en) | Purple transgenic fluorescent ornamental fish | |
| Handberg-Thorsager et al. | Stem cells and regeneration in planarians | |
| US8987546B2 (en) | Orange transgenic fluorescent ornamental fish | |
| CN102296071B (en) | Bombyx mori midgut specific expression promoter P3 and use thereof | |
| CN110484549A (en) | Genome targeting modification method | |
| Kontarakis et al. | Transgenesis in non-model organisms: the case of Parhyale | |
| CN102191249B (en) | Silkworm Bmlp3 gene promoter and use thereof | |
| Soper et al. | Biological science | |
| Ishibashi et al. | A method for generating transgenic frog embryos | |
| CN110468132A (en) | A kind of sgRNA and transgene expression vector, expression strain, screening technique | |
| Collin et al. | Zebrafish as a research organism: Danio rerio in biomedical research | |
| Liu et al. | Ciona intestinalis as an emerging model organism: Its regeneration under controlled conditions and methodology for egg dechorionation | |
| JP2011103816A (en) | Transgenic silkworm | |
| CN103589733B (en) | The expression cassette of skin specific expression sheep beta-catenin gene, recombinant plasmid and their application | |
| West et al. | Ribeye a-mCherry fusion protein: a novel tool for labeling synaptic ribbons of the hair cell | |
| CN1647625A (en) | Method for producing new fluorescent fish and new fluorescent fish produced by said method | |
| CN100355888C (en) | New transgenic zebra fish, production method of gene segment and transgenic zebra fish | |
| CN103421782B (en) | Isolation, cloning and expression pattern identification of sheep hair follicle specific expression promoter fragment | |
| Chaudhry et al. | The zebrafish as a model for cardiac development and regeneration | |
| Thuy et al. | Generation of transgenic medaka Oryzias curvinotus (Nichols & Pope, 1927) carrying a cyan fluorescent protein gene driven by Alpha Actin promoter | |
| CN102604954B (en) | Domestic silkworm cuticle protein BmCP231 promoter as well as recombinant expression vector and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |