CN102286625B - Seminal plasma micro RNA combination relevant to male reproductive function disorder and application thereof - Google Patents
Seminal plasma micro RNA combination relevant to male reproductive function disorder and application thereof Download PDFInfo
- Publication number
- CN102286625B CN102286625B CN201110252889.9A CN201110252889A CN102286625B CN 102286625 B CN102286625 B CN 102286625B CN 201110252889 A CN201110252889 A CN 201110252889A CN 102286625 B CN102286625 B CN 102286625B
- Authority
- CN
- China
- Prior art keywords
- mir
- mirna
- refining
- essence
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention belongs to the field of biotechnology, disclosing a seminal plasma micro RNA combination relevant to male reproductive function disorder and an application thereof. The miRNA (Ribose Nucleic Acid) combination comprises the following miRNA: miR-34c-5p, miR-181a, miR-374b and miR-509-5p. The combination can be used for preparing reagent for diagnosing or monitoring male reproductive function disorder.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of refining miRNA relevant to male reproductive function obstacle (microRNA is called for short miRNA) combination and application thereof.
Background technology
According to WHO statistics, sterile (pregnant) Mr. and Mrs account for the couple at child-bearing age's 10%～15%, and wherein male factor accounts for 30%～40%
[1,2].In recent years, the ratio of male sterility is in rising trend, and people are more and more higher to the requirement of prenatal and postnatal care, therefore, for efficient diagnosis and treatment male sterility, finds the male sterility mark that clinical value is higher extremely urgent.Current domestic clinical labororatory judges the spermatogenesis of male testical by detecting the methods such as the density of sperm in seminal fluid and vigor, seminal plasma biochemistry index, blood Levels of Sexual Hormone, karyotype and Y chromosome be micro-deleted.But current clinical detection means cannot make explanations and judge the cause of disease of many nothings, oligospermatism, have brought great puzzlement to clinical treatment.In seminal fluid, except sperm, the overwhelming majority is refining.Refining is made up of the secretory product of epididymis, seminal vesicle, prostate gland, testis net and paraurethral gland, in its chemical composition, except 90% water, also has the Multiple components such as sugar, lipid, protein, peptide hormone, amine, organic acid, organic bases and mineral ion.Research shows, with respect to normal male, the chemical composition in the seminal fluid of male reproductive function impaired patients, particularly refining tends to occur change to a certain degree.The conventional refining test item of carrying out at present comprises fructose, alpha-glucosidase, acid phosphatase, zinc and carnitine and some amynologic index, comprise antisperm antibody and the capable worm antibody of anti-bow etc., these test items only contribute to diagnose limited several male sex's Accessory sexual gland dysfunctions and indivedual immunology factor, can not directly reflect spermatogenesis and the thoroughly evaluating semen quality of testis
[3].
Therefore urgently find a kind of than existing method more reliable simultaneously again simple novel method identify the spermatogenesis of male testical and judge the pathology of Accessory sexual gland.
MiRNA be in eukaryote a class be about 22 Nucleotide and participate in genetic transcription after the non-coding strand small ribonucleic acid molecules of level regulation and control.MiRNA, by holding non-translated sequence complementary combination wholly or in part with 3 ' of said target mrna, causes said target mrna degraded or transcribes the expression that rear translation suppresses to regulate and control target gene
[4].They are high conservative on evolving, and is extensively present in animal and plant cells.Over nearly 5 years, in the multiple living species such as the mankind, mouse, rat, identify hundreds of miRNA molecules.MiRNA is present in almost in each histocyte, and various vital processes are comprised reproduction, grow and all can produce potential impact, and the protein coding gene of human body 30% is is all regulated and controled by miRNA
[5,6].
Testis is the male sex's Main Reproductive Organs, also has miRNA in the sperm of testis.In spermatogenic cells at different stages, some specific miRNA highly express, and show that these miRNA participate in the generation of sperm, and propagation and spermatogenesis to spermatogonium play an important role
[7-9].Therefore, these miRNA are studied and just likely search out some and male reproductive function, particularly with as a token of thing of the closely-related miRNA of testicular spermatogenic function, and then for clinical diagnosis and the prediction of male reproductive function obstacle.
Summary of the invention
The object of this invention is to provide a kind of refining micro RNA combination relevant to male reproductive function obstacle.
Another object of the present invention is to provide the application of above-mentioned refining micro RNA combination.
The inventor finds can detect in refining the miRNA of high expression level abundance, particularly finds that wherein the abnormal expression of one group of miRNA is relevant with reproductive function, and for example the spermatogenesis of their expression levels in refining and testis is closely related.Therefore, the present invention is by the specific variations of refining miRNA in research male reproductive function obstacle process, filter out the refining miRNA that expresses significant difference under sterile and normal fertility status, by detecting these miRNA, for diagnosis male reproductive function obstacle provides new information and mark, to improving the discovery rate of male reproductive function obstacle, specific aim and curative effect in course of disease monitoring, prognosis and evaluating drug effect process all have positive meaning.
Above-mentioned purpose of the present invention realizes by the following technical solutions:
A refining micro RNA combination relevant to male reproductive function obstacle, this miRNA combination comprises following miRNA:miR-34c-5p, miR-181a, miR-374b and miR-509-5p.
Described refining micro RNA combination, this miRNA combination also comprises miR-146-5p and miR-513a-5p, further, this miRNA combination also comprises miR-122.
Described refining micro RNA combination, wherein male reproductive function obstacle refers to without essence, few essence and/or weak essence.
Described refining micro RNA combination, wherein to without refining micro RNA combination smart and/or that weak essence is relevant comprises miR-34c-5p, miR-181a, miR-374b and miR-509-5p.Further, this is combined as miR-34c-5p, miR-181a, miR-374b, miR-509-5p, miR-122, miR-146-5p and miR-513a-5p.
Described refining micro RNA combination, wherein the refining micro RNA combination relevant to few essence comprises miR-34c-5p, miR-181a, miR-374b and miR-509-5p.Further, this is combined as miR-34c-5p, miR-181a, miR-374b, miR-509-5p, miR-146-5p and miR-513a-5p.
The application of above-mentioned refining micro RNA combination in the reagent of preparation diagnosis or monitoring male reproductive function obstacle, wherein male reproductive function obstacle refers to without essence, few essence and/or weak essence.
The screening method of above-mentioned miRNA combination comprises the following steps:
(1) collect fertility normal male and the reproductive function obstacle male sex's refining, and extract total RNA;
(2) the Solexa sequencing technologies (Solexa sequencing technology) of employing highly sensitive, accuracy and high duplication, above-mentioned RNA is detected, just filter out the significant one group of miRNA of differential expression in reproductive function obstacle and normal male refining;
(3) further with in good time fluorescence quantifying PCR method checking.
(in conjunction with Fig. 1 and embodiment) specifically, above-mentioned screening method comprises the following steps: (1) collects respectively normal fertile men and the reproductive function obstacle male sex's refining, and extracting total RNA, wherein said reproductive function obstacle comprises without essence (non-obstructivity), few essence or weak essence; (2) according to the whole ripe miRNA of known people, above-mentioned RNA is checked order and detected, primary dcreening operation goes out the obvious one group of miRNA of differential expression in the reproduction dysfunction male sex and normal male refining; (3) be cDNA by the RNA reverse transcription of extracting, adopt quantitative fluorescent PCR (TaqMan probe method) method further the miRNA just sifting out to be carried out to multiple sieve and checking, pick out one group of miRNA stable, specifically expressing, carry out clinical value assessment.
The detection method that the present invention uses can be selected from: one or more in RT-PCR method, Solexa sequencing technologies (Solexa sequencing technology), Real-time PCR method and biochip method, these methods are methods well known to those skilled in the art, and the reagent of employing all can obtain from commercial channels.For example, in refining, the detection method of miRNA molecule comprises the following steps:
(1) use Trizol reagent (Invitrogen company) to extract the total RNA of refining;
(2) obtain cDNA by RNA reverse transcription reaction;
(3) carry out PCR reaction according to the whole ripe body miRNA design primers of people;
(4) carry out the agarose gel electrophoresis of PCR product;
(5) after EB dyeing under ultraviolet lamp observations.
Described step (5) can also comprise the following steps: afterwards to detect by TaqMan probe method and compare refining sample with respect to normal male refining in the variation of amount of miRNA.
The invention provides a kind of for detection of and/or the miRNA combination of prediction male reproductive function obstacle, it comprises the combination of following miRNA:
| miRNA | Corresponding nucleotide sequence | Sequence numbering |
| miR-34c-5p | AGGCAGUGUAGUUAGCUGAUUGC | SEQ ID NO.1 |
| miR-181a | AACAUUCAACGCUGUCGGUGAGU | SEQ ID NO.2 |
| miR-374b | AUAUAAUACAACCUGCUAAGUG | SEQ ID NO.3 |
| miR-509-5p | UACUGCAGACAGUGGCAAUCA | SEQ ID NO.4 |
Aforesaid combination may further include following three kinds of miRNA:
| miRNA | Corresponding nucleotide sequence | Sequence numbering |
| miR-122 | UGGAGUGUGACAAUGGUGUUUG | SEQ ID NO.5 |
| miR-146-5p | UGAGAACUGAAUUCCAUAGGCU | SEQ ID NO.6 |
| miR-513a-5p | UUCACAGGGAGGUGUCAU | SEQ ID NO.7 |
Male reproductive function obstacle of the present invention comprises male sterility.Particularly, described male reproductive function obstacle is the male sterility that spermatogenesis obstacle and other reasons cause, for example, without essence (non-obstructivity), few essence or weak essence.
Beneficial effect of the present invention:
MiRNA of the present invention combination can be applicable in the detection of male reproductive function obstacle, for example for the supplementary new detection index of male reproductive function obstacle, among course of disease monitoring, prognosis and evaluating drug effect.Above-mentioned miRNA combination provided by the present invention has the beneficial effect of the following aspects:
First, other organizes more easily acquisition to refining relatively, compared with testis biopsy or testicular biopsy, belongs to non-invasive inspection, is very easy to healthcare givers's use, has alleviated patient's misery;
Secondly, what the miRNA in refining reflected is pathology, the physiological conditions in whole production of sperm stage, and its detected result has Clinical significance of MG;
The 3rd, refining miRNA detects and can on molecular level, reflect in during spermatogenesis regulation and control state after genetic transcription, has improved the accurate level detecting, and has been male reproductive function obstacle, and especially the treatment of spermatogenesis obstacle provides potential target spot.
In sum, detect the specific miRNA in refining, simple and effect is superior, the present invention is from this new angle of specific variations of refining miRNA, find disease and distinguish male reproductive function obstacle, a kind ofly detecting the new technology of spermatogenesis obstacle and the mark relevant to male reproductive function obstacle is provided thereby set up.This technology only needs patient's refining and without any need for other tissue, combines to detect the variation tendency of specific miRNA by the miRNA simplifying most, then the possibility occurring by this variation tendency monitoring male reproductive function obstacle, instructs diagnosis and treatment.As can be seen here, detect refining miRNA level and can expand male reproductive function obstacle, the diagnosis of for example testicular spermatogenic function or monitoring index, improve the sensitivity detecting, the means of abundant diagnosis male reproductive function obstacle, the level of these refinings miRNA is expected to become the important symbol thing of diagnosis male sterility, has epochmaking clinical application potentiality and value.
Brief description of the drawings
Fig. 1 is main schema of the present invention.
Fig. 2 is the typical curve of TaqMan probe quantitative PCR method.
Fig. 3 is the repeatability of TaqMan probe quantitative PCR method.
The repeatability of A.miRNA extracting method; B. the repeatability of quantifying PCR method.
The ROC curve (A-D) that Fig. 4 is the miRNA that filters out in few smart patient and normal fertility.
Fig. 5 is the miRNA that filters out at the ROC curve without in essence or weak smart patient and normal fertility.
A-G. azoospermia group and normal group; H-N. azoospermia group and normal group; O-U. azoospermia group and azoospermia group;
Fig. 6 is that several routine biochemistry indexs comprise zinc, fructose, alpha-glucosidase, the ROC curve of acid phosphatase in infertile patients and normal fertility.
A-C. zinc, wherein A: azoospermia group and normal group; B: azoospermia group and normal group; C: azoospermia group and azoospermia group.
D-F. fructose, wherein D: azoospermia group and normal group; E: azoospermia group and normal group; F: azoospermia group and azoospermia group.
G-I. alpha-glucosidase, wherein G: azoospermia group and normal group; H: azoospermia group and normal group; I: azoospermia group and azoospermia group.
J-L. acid phosphatase, wherein J: azoospermia group and normal group; K: azoospermia group and normal group; L: azoospermia group and azoospermia group.
Embodiment
The invention will be further elaborated by the following examples.
In embodiment, primer, probe used is the commercially produced product of American AB I company.
Embodiment 1: the special miRNA express spectra screening of reproductive function obstacle
(1) in order not take the above sterile male sex of any contraceptives 2 years after marrying, (its spouse checks normally research object, own without sexual dysfunction, varicocele, without diseases such as cardiovascular and cerebrovascular, malignant tumour, hepatic and renal function are abnormal.Patient age is between 24-34 year, the course of disease 1～7 year), (semen quality is normal as normal control for the male sex who is no more than 2 years taking educating of age-matched, without systemic disease, age is between 24-34 year), all experimenter's sexual repression was left and taken seminal fluid after 3～7 days, carried out sperm quality and functional analysis by the colored sperm quality detection system of WLJY-9000 mighty force (Beijing mighty force company).Analytical standard is all carried out (" human seminal fluid and Mucus interaction laboratory inspection handbook [M] " (the 4th edition) by WHO standard, the World Health Organization compiles, Gu Qun etc. translate, Beijing: People's Health Publisher, 2001.5.1).Through sperm analysis, experimenter is divided into following 4 classes: without smart: sperm concentration=0; Few essence: sperm concentration < 20 × 10
6/ ml, a level sperm > 25% or (a+b) level sperm > 50%; Weak essence: sperm concentration > 20 × 10
6/ ml, a level sperm < 25% or (a+b) level sperm < 50%; Normal: sperm concentration > 20 × 106/ml, a level sperm > 25% or (a+b) level sperm > 50%.
Sperm analyze after by centrifugal seminal fluid 1500g 10min, the more centrifugal 5min of 12,000g, collects refining.
(2) collect non-obstructivity without essence (semen quality detects or testis puncture biopsy is made a definite diagnosis through repeating), weak essence and fertile men refining sample 45 examples, 58 example and 100 examples respectively, sample in three groups mixes respectively, and three groups of cumulative volumes are 120ml.Extract respectively three groups of RNA that mix in refining, concrete scheme is: utilize Trizol reagent (Invitrogen company) to extract total RNA, the supernatant liquor obtaining uses phenol chloroform three-step approach further to remove the impurity purification RNA such as albumen.
(3) three groups of total RNA of refining are carried out to Solexa sequencing analysis.
Concrete scheme is: the basis of Solexa sequencing is unit molecule clone array technique, can in whole genomic level, distinguish the difference of single base, thus the difference between discriminate individuals.First joint is connected in microRNA fragment, then after pcr amplification, makes storehouse.On the chip that contains joint, add subsequently the microRNA of jointing, through reaction, different fragments is increased.In next step reaction, four kinds of principles that check order while synthesizing for fluorescently-labeled dyestuff, in each working cycle, fluorescently-labeled nucleosides and polysaccharase are added in single molecule array.Complementary nucleosides and first base pairing of nucleotide fragment, join on primer by enzyme.Unnecessary nucleosides is removed.Each like this single strand dna is extended by the pairing of complementary base, utilizes bioluminescent protein, and such as the luciferase of Lampyridea, the pyrophosphate salt discharging can be added to primer rear end by base time provides detection signal.Mark for the laser excitation of the specific wavelength of every kind of base in conjunction with upper nucleosides, this mark can discharge fluorescence.Fluorescent signal is gathered by CCD, and the whole array detection of CCD rapid scanning is specifically attached to the base in each segment.By above-mentioned combination, detection can repeat tens circulations, so just likely determines tens bases in nucleotide fragment.Finally aligned sequences again, filters out the copy number of the miRNA that will obtain.
(4) miRNA expression pattern analysis.
The miRNA comprising in mankind miRNA database (version miRbase 12.0 and Sanger data) has 692, adopt all 692 miRNA sequences and copy numerical value in Solexa technology for detection refining, copy value reflects the expression amount of each miRNA.If copy number=0 represents in refining not this miRNA, copy numerical value is larger, and the expression amount of its relative miRNA is more.
If the copy number of miRNA in normal group is greater than 50, and difference between three groups is greater than 2.0 times, is considered to change obviously, otherwise is considered as not changing.Found that, in 692 kinds of miRNA that detect, have 19 kinds and meet this condition (referring to table 1).Decline without 14 miRNA copy numbers in smart group, 5 risings; 7 declines in weak smart group, 12 risings.
What table 1.Solexa order-checking was just sifted out changes obvious miRNA in infertile patients refining
Embodiment 2: the RT-PCR of miRNA experiment in refining
By the miRNA just sifting out in table 1, more further carry out multiple sieve and checking with quantifying PCR method, filter out the significant miRNA of differential expression.
First total the refining of extraction RNA reverse transcription is become to cDNA.For each miRNA, design a gene specific reverse primer (ABI company product) containing identical loop-stem structure, utilize miRNA specific reverse primers to carry out reverse transcription, obtain containing common loop-stem structure but belong to the cDNA of specific miRNA.
What instrument used is ABI Prism 7300 quantitative real time PCR Instruments.
This experiment is made typical curve with the ripe body of every kind of miRNA of different concns synthetic.The ripe body stoste of the miRNA of synthetic reverse transcription becomes cDNA, is diluted to 10fmol/L to 10 with DEPC water
5concentration gradient between pmol/L.The cDNA of miRNA needs to reverse separately, reaction system is: (American AB I company provides the ripe body reverse transcriptase primer of 2 μ l RNA, 2 μ l 5 × AMV damping fluids, the various dNTP mixtures of 1 μ l 10mmol (Takara company), 0.5 μ l AMV (Takara company) and 1 μ l miRNA, be exclusively used in miRNA reverse transcription), supply volume to 10 μ l with 3.5 μ l DEPC water.
The ripe body quantitative fluorescent PCR of miRNA reaction system as typical curve: 1 μ l cDNA, 0.3 μ l Taq enzyme (Takara company), 0.33 μ l TaqMan probe (provided by ABI company, be exclusively used in miRNA fluorescent quantitation), 1.2 μ l 25mM MgCl
2, the various dNTP mixtures of 0.4 μ l 2.5m M (Takara company product), 2 μ l 10 × PCR damping fluids and 14.77 μ l DEPC water.
The reverse transcription system that every kind of miRNA in sample to be measured adopts while detection and quantitative fluorescent PCR reaction system be with the ripe body of miRNA of the synthetic as typical curve, but distinctive reverse transcriptase primer and TaqMan probe (being provided by ABI company) separately for every kind of miRNA.Data processing method is absolute quantitation method, while carrying out quantitative fluorescent PCR at every turn, the sample of required detection and typical curve are carried out to pcr amplification simultaneously, amplification finishes to set unified threshold value according to amplification curve afterwards, and then according to the concentration of standard substance and Cq value drawing standard curve (Fig. 2) corresponding to each concentration, (this typical curve is with the typical curve of every kind of miRNA maturation volume drawing of synthesizing; The calculating of Cq value is known; What the R in figure referred to is pearson relation conefficient, can reflect from the side the slope of done straight line, account form can be drawn scatter diagram and be added Trendline by Excel and be obtained, also can be by other conventional statistical softwares as spss13.0, the calculating such as statistics6.0) and calculate the miRNA absolute content of the required mensuration of this sample according to the Cq value of this typical curve and sample to be tested.
The repeatability of the quantifying PCR method that assessment adopts: the repeatability of 1.miRNA extracting method: get 20 routine normal people's refinings, (every part of 500 μ l) after mixing, to be divided into identical two parts, extract respectively its total RNA, then measure expression level 16 kinds of miRNA from low to high with quantifying PCR method and (comprise miR-1, miR-106b, miR-122, miR-128, miR-146b-5p, miR-181a, miR-193a-3p, miR-19b, miR-34c-5p, miR-374b, miR-495, miR-509-5p, miR-513a-5p, miR-532-5p, miR-890, miR-9).These 16 kinds of miRNA are random selections, comprise expression amount three class miRNA from low to high, are that the miRNA that extracts various concentration in order to illustrate has good repeatability.Every kind of miRNA replication 3 times, averages.Correlation analysis showed, the relation conefficient of two parts of sample measured results (pearson ' s coefficient) approaches 1 (R
2=0.9692) (Fig. 3 A), prompting miRNA extracting method is reproducible.2. the repeatability of quantifying PCR method: separately get 20 routine normal people's refinings, extract total RNA after mixing, RNA is divided into identical two parts, then measure above-mentioned 16 kinds of miRNA with quantifying PCR method.Equally, every kind of miRNA repeats 3 times, averages.Correlation analysis showed, the relation conefficient of two parts of RNA measured results approaches 1 (R
2=0.9776) (Fig. 3 B), shows that quantifying PCR method of the present invention has good repeatability.
Embodiment 3: quantifying PCR method sieves again to the serum miRNA just sifting out
Male sterility person is totally 60 examples, and wherein non-obstructivity azoospermia 30 examples, azoospermia 30 examples compare with the normal male sex's 24 examples of Fertility of age-matched.Patient and normal people's screening criteria is with embodiment 1.Tester's clinical information is in table 2.Experimenter's refining sample is detected one by one with TaqMan quantifying PCR method, 19 kinds of miRNA that just sift out from Solexa method, filter out the significant miRNA of differential expression (concrete steps are referring to embodiment 2) between patient's group and control group.Found that, in 19 kinds of miRNA that just sift out, have 7 kinds of miRNA in patient's group expression amount there were significant differences compared with control group (p < 0.01), they all significantly reduce in without smart group, and all obviously raise in weak smart group, these 7 kinds of miRNA are miR-34c-5p, miR-122, miR-146b-5p, miR-181a, miR-374b, miR-509-5p and miR-513a-5p (in table 3).
All experimenters' clinical information is organized in the multiple screen banks of table 2. and checking
*data represent .P1 with mean ± SD: normal without smart vs; P2: weak smart vs is normal; P3: without the weak essence of smart vs; B: with two-sided x
2test represents.
The miRNA that table 3. quantifying PCR method sifts out again
*
*miRNAs concentration represents .P1 with mean ± SEM (fM/L): without essence group vs control group; P2: weak essence group vs control group; P3: without weak smart group of essence group vs.
Embodiment 4: the clinical verification of quantifying PCR method to the refining miRNA sifting out again
7 kinds of miRNA that sift out again (are comprised to miR-34c-5p, miR-122, miR-146b-5p, miR-181a, miR-374b, miR-509-5p and miR-513a-5p) further verify in clinical samples in enormous quantities with quantifying PCR method, filter out stable, the significant miRNA of differential expression.The experimenter of clinical study is without smart person's 43 examples, and weak smart person's 49 examples, compare (patient and normal people's screening criteria is with embodiment 1, and clinical information is in table 2 in detail) with normal 44 examples.The result confirmation, the variation tendency of 7 kinds of miRNA that sift out again in two patient's groups is more obvious, in without smart group, significantly reduce, and in weak smart group, obviously raise (the results are shown in Table 4).These 7 kinds of miRNA contribute to the diagnosis without essence and weak essence.
In addition, also these miRNA levels in the few smart patient's refining of 34 example have been measured, find except miR-122, the concentration of other 6 kinds of miRNA in few smart person's refining is all lower than normal control, wherein 4 kinds (comprising miR-34c-5p, miR-181a, miR-374b and miR-509-5p), there were significant differences compared with Normal group (at least P < 0.05), but reduction amplitude is not so good as without smart person (table 5), and therefore these 4 kinds of miRNA contribute to the diagnosis of aspermia or oligospermia.
Table 4. quantifying PCR method is to the further the result of the miRNA sifting out again
*
*miRNAs concentration represents .P1 with mean ± SEM (fM/L): without essence group vs control group; P2: weak essence group vs control group; P3: without weak smart group of essence group vs.
Table 5. quantifying PCR method detects few smart patient's result
*
*miRNAs concentration represents with mean ± SEM (fM/L).
Embodiment 5: the miRNA clinical value assessment filtering out
Draw ROC curve (Fig. 4) according to 4 kinds in the significantly reduced miRNA of few smart patient's refining concentration (comprising miR-34c-5p, miR-181a, miR-374b and miR-509-5p) concentration, and under calculated curve area (AUC) (table 6) to assess the miRNA that the filters out accuracy to few essence diagnosis.Found that, the AUC of these 4 kinds of miRNA is (be shown in table 6) between 0.628～0.721.
To answer screen banks and checking group refining sample integrates (without smart n=73, weak smart n=79, normal n=68), draw under ROC curve (Fig. 5) calculated curve area (AUC) (table 7) to assess the miRNA filtering out to the accuracy without essence or weak essence diagnosis according to the concentration of every part of sample refining miRNA.The AUC that found that these 7 kinds of miRNA is (be shown in table 7) between 0.733～0.921.
We simultaneously also at present clinically the AUC of conventional seminal plasma biochemistry index (comprising zinc, fructose, alpha-glucosidase, acid phosphatase) carried out analyzing (Fig. 6).These 5 kinds existing biochemical indicator AUC (in table 8) between 0.510～0.622.
Can obviously find out by comparing, the accuracy that we selected miRNA diagnoses nothing essence, weak essence or few essence is apparently higher than the current biochemical indicator that used clinically.
The ROC area under curve (AUC) (few smart patient and control group) of table 6.4 kind of miRNA
The ROC area under curve (AUC) (without essence or weak smart group and control group) of table 7.7 kind of miRNA
The ROC area under curve (AUC) of several routine biochemistry indexs of table 8.
Reference:
1.Lian J，Zhang X，Tian H，Liang N，Wang Y，Liang C，et al.Altered microRNA expression in patients with non-obstructive azoospermia.Reproductive Biology and Endocrinology2009；7：13.
2.Feng HL.Molecular biology ofmale infertility.Arch Androl 2003；49：19-27.
3.Huang S，Li H，Ding X，Xiong C.Presence and characterization of cell-free seminal RNA in healthy individuals：Implications for noninvasive disease diagnosis and gene expression studies ofthe male reproductive system.Clinical Chemistry 2009；55：1967-6.
4.Stark A，Bushati N，Jan CH，Kheradpour P，Hodges E，Brennecke J，et al.A single Hox locus in Drosophila produces functional microRNAs from opposite DNA strands.Genes Dev 2008；22：8-13.
5.Bartel DP.MicroRNAs：genomics，biogenesis，mechanism，and function.Cell2004；116：281-97.
6.Rosenfeld N，Aharonov R，Meiri E，Rosenwald S，Spector Y，Zepeniuk M，et al.MicroRNAs accurately identify cancer tissue origin.Nat Biotechnol 2008；26：462-9.
7.He Z，Kokkinaki M，Pant D，Gallicano GI，Dym M.Small RNA molecules in the regulation of spermatogenesis.Reproduction 2009；137：901-11.
8.Yan N，Lu Y，Sun H，Qiu W，Tao D，Liu Y，et al.Microarray profiling of microRNAs expressed in testis tissues ofdeveloping primates.J Assist Reprod Genet 2009；26：179-86.
9.Bouhallier F，Allioli N，Lavial F，Chalmel F，Perrard MH，Durand P，et al.Role of miR-34c microRNA in the late steps of spermatogenesis.RNA 2010；16：720-31.
10.Lian J，Zhang X，Tian H，Liang N，Wang Y，Liang C，et al.Altered microRNA expression in patients with non-obstructive azoospermia.Reprod Bio Endocrin 2009；7：13.
Claims (3)
1. the application of refining micro RNA combination in the reagent of preparation diagnosis or monitoring male reproductive function obstacle, described refining micro RNA combination comprises following miRNA:miR-34c-5p, miR-181a, miR-374b and miR-509-5p; Described male reproductive function obstacle refers to without essence, few essence and/or weak essence; The sequence of described miR-34c-5p is SEQ ID NO.1, and the sequence of miR-181a is SEQ ID NO.2, and the sequence of miR-374b is SEQ ID NO.3, and the sequence of miR-509-5p is SEQ ID NO.4.
2. application according to claim 1, is characterized in that the refining micro RNA combination relevant to nothing essence or weak essence is miR-34c-5p, miR-181a, miR-374b, miR-509-5p, miR-122, miR-146-5p and miR-513a-5p; The sequence of described miR-122 is SEQ ID NO.5, and the sequence of miR-146-5p is SEQ ID NO.6, and the sequence of miR-513a-5p is SEQ ID NO.7.
3. application according to claim 1, is characterized in that the refining micro RNA combination relevant to few essence is miR-34c-5p, miR-181a, miR-374b, miR-509-5p, miR-146-5p and miR-513a-5p; The sequence of described miR-146-5p is SEQ ID NO.6, and the sequence of miR-513a-5p is SEQ ID NO.7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110252889.9A CN102286625B (en) | 2011-08-30 | 2011-08-30 | Seminal plasma micro RNA combination relevant to male reproductive function disorder and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110252889.9A CN102286625B (en) | 2011-08-30 | 2011-08-30 | Seminal plasma micro RNA combination relevant to male reproductive function disorder and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102286625A CN102286625A (en) | 2011-12-21 |
| CN102286625B true CN102286625B (en) | 2014-06-18 |
Family
ID=45333380
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110252889.9A Expired - Fee Related CN102286625B (en) | 2011-08-30 | 2011-08-30 | Seminal plasma micro RNA combination relevant to male reproductive function disorder and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102286625B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450707B (en) * | 2014-12-25 | 2017-08-29 | 厦门大学 | A kind of application of Serum miRNA biomarker |
| CN104450702B (en) * | 2014-12-25 | 2017-08-29 | 厦门大学 | A kind of Serum miRNA biomarker composition and application |
| GB201504772D0 (en) * | 2015-03-20 | 2015-05-06 | Univ Aston | Preeclampsia |
| CN110760576B (en) * | 2019-11-08 | 2021-07-09 | 河北医科大学第一医院 | Kit for male fertility diagnosis |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101555518A (en) * | 2008-04-10 | 2009-10-14 | 上海市肿瘤研究所 | Micro ribonucleic acid and application thereof |
| EP2354246A1 (en) * | 2010-02-05 | 2011-08-10 | febit holding GmbH | miRNA in the diagnosis of ovarian cancer |
-
2011
- 2011-08-30 CN CN201110252889.9A patent/CN102286625B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101555518A (en) * | 2008-04-10 | 2009-10-14 | 上海市肿瘤研究所 | Micro ribonucleic acid and application thereof |
| EP2354246A1 (en) * | 2010-02-05 | 2011-08-10 | febit holding GmbH | miRNA in the diagnosis of ovarian cancer |
Non-Patent Citations (2)
| Title |
|---|
| Patterns of microRNA expression in normal and early Alzheimer’s disease human temporal cortex: white matter versus gray matter;Wang-Xia Wang等;《Acta Neuropathol》;20101010;第121卷;193–205 * |
| Wang-Xia Wang等.Patterns of microRNA expression in normal and early Alzheimer’s disease human temporal cortex: white matter versus gray matter.《Acta Neuropathol》.2010,第121卷193–205. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102286625A (en) | 2011-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20180127835A1 (en) | Gene expression signature for classification of tissue of origin of tumor samples | |
| CN102369294B (en) | Non-small cell lung cancer detection marker, detection method thereof, related reagent kit and biochip | |
| CN101942502B (en) | Pancreatic cancer marker, and detection method, kit and biochip thereof | |
| CN102333888B (en) | Gene expression signature for classification of tissue of origin of tumor samples | |
| US20150376704A1 (en) | Biomarker assay for diagnosis and classification of cardiovascular disease | |
| US20200157631A1 (en) | CIRCULATING miRNAs AS MARKERS FOR BREAST CANCER | |
| US20100178653A1 (en) | Gene expression signature for classification of cancers | |
| US8911940B2 (en) | Methods of assessing a risk of cancer progression | |
| CN101988059B (en) | Gastric cancer detection marker and detecting method thereof, kit and biochip | |
| CN111667918A (en) | Method for constructing mathematical model for in vitro detection of lung cancer and application | |
| CN101851682B (en) | MiRNA combination used for detecting esophageal squamous cell carcinoma and application thereof | |
| CN105483218A (en) | Seminal plasma piRNA markers or their combination for detecting and/or predicting male reproductive dysfunction and application thereof | |
| CN101988061A (en) | Breast cancer detecting marker as well as detecting method, kit and biological chip thereof | |
| CN105603101A (en) | Application of system for detecting expression quantity of eight miRNAs in preparation of product for diagnosing or assisting in diagnosing hepatocellular carcinoma | |
| CN102286625B (en) | Seminal plasma micro RNA combination relevant to male reproductive function disorder and application thereof | |
| JP2013509169A (en) | Blood miRNAs are non-invasive markers for prostate cancer diagnosis and staging | |
| CN101555519A (en) | Gene chip and application thereof | |
| CN106755343A (en) | Cancer of pancreas Prognosis molecular marked compound | |
| CN111424085B (en) | Application of tRNA source fragment in preparation of breast cancer diagnostic reagent | |
| CN101988062A (en) | cervical cancer detection markers and detection method, kit and biochip thereof | |
| CN108300788A (en) | A kind of micro RNA combination and its application for detecting light-duty brain trauma | |
| CN109563548A (en) | For identifying the in-vitro method of cancer of pancreas or pancreatic intraductal papillary mucinous tumor | |
| CN108611417A (en) | A kind of specific expressed collection of illustrative plates and analysis system for Diagnosis of Bladder | |
| CN116287252B (en) | Application of long-chain non-coding RNA APCDD1L-DT in preparation of pancreatic cancer detection products | |
| US10011876B2 (en) | Method and system for prognosis and treatment of diseases using portfolio of genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140618 Termination date: 20150830 |
|
| EXPY | Termination of patent right or utility model |