CN102286086A - Protein GmLEC1B related with synthesis of aliphatic acid as well as encoding gene and application thereof - Google Patents

Abstract

The invention discloses protein GmLEC1B related with synthesis of aliphatic acid as well as an encoding gene and an application thereof. The protein related with the synthesis of aliphatic acid, disclosed by the invention is called as GmLEC1B, is from Glycine max L. and is the protein of the following (1) or (2): (1) protein consisting of an amino acid sequence shown in a sequence 1 in a sequence list; and (2) protein, derivative from (1), obtained by substituting and/or lacking and/or adding one or more amino acid residues in an amino acid residue sequence of the sequence 1 of the sequence list, and related with the synthesis of the aliphatic acid. After the gene GmLEC1B protected by the invention is overexpressed in arabidopsis thaliana, the content of the aliphatic acid in the arabidopsis thaliana seedling can be increased; therefore, the protein GmLEC1B related with the synthesis of the aliphatic acid, the encoding gene and the application, disclosed by the invention, bring important theoretical and practical significance for the improvement of the aliphatic acid content of soybeans and the modification of related properties, and have wider application and market prospect in the agriculture field.

Description

With synthetic relevant Protein G mLEC1B and encoding gene and the application of lipid acid

Technical field

The present invention relates to synthesize relevant Protein G mLEC1B and encoding gene and application with lipid acid in the biological technical field.

Background technology

Vegetables oil is as main edible oil and important renewable energy material and be subjected to extensive concern.At present, 85% of edible oil comes from vegetables oil in the world, has only 25% to come from animal and marine organisms.Simultaneously, vegetables oil also is widely used in industrial circle, as washing composition, and lubricating oil, paint and biodegradable plastic etc.In addition, what deserves to be mentioned is that the exploitation of prosene may provide a new approach for solving global energy crisis and environmental pollution.Along with people are increasing to the demand of vegetables oil, existing output will can not satisfy the demand of society far away.

Soybean is the important source of edible vegetable oil as one of main economic crops.Relative other the vegetables oil (as rapeseed oil, peanut wet goods) with the ratio of unsaturated fatty acids of the saturated fatty acid of soybean oil is comparatively reasonable, its consumption and amount have also progressively surpassed other vegetables oil, become one of important source of nutrition of people's diet.China is the native place of soybean, and the soybean of other countries' plantation is mostly directly or indirectly imported into from China in the world.Before the 1950's, China is the great producing country of world soybean.Yet from nineteen fifty-three, this status is replaced by the U.S., along with soybean America take root, fostered and transgenic technology in vogue, by 1996, China became net importer by soybean net exporter.To 2006,90% of the approaching Chinese grain import total amount of soybean import, and mostly from America.Therefore the output and the oleaginousness that improve soybean oil are the problems that China presses for solution at present.

Along with development of biology, transgenic engineering provides a valid approach for us.At first identify and the synthetic relevant regulatory gene of grease, utilize engineered method to improve these regulatory genes then, thereby improve the oleaginousness of soybean seeds by genetic method.Over surplus in the of nearly ten year, scientists utilizes biotechnology that the key gene in the fatty acid biological building-up process is carried out genetic improvement, but all fail to obtain significant effect, one of them chief reason be the intravital lipid acid of plant synthetic be the process of a complexity and hight coordinate, being that polygene is collaborative finishes, therefore improve one lipid acid synthetic gene, can not effectively improve the content of lipid acid.Nearest discovers, in the metabolic process of lipid acid, exists a kind of protein kinase or other regulatory factor (for example transcription factor) playing comprehensive regulating and controlling effect (Girke probably, T., Todd, J., Ruuska, S., White, J., Benning, C., and Ohlrogge, J..Microarray analysis of developing Arabidopsis seeds.Plant Physiol.2000,124,1570-1581.).Reach the purpose that increases fatty acid content by genetic improvement so and will become possibility these regulatory factors.

At present, by Arabidopis thaliana discovered that the most important transcription factor of involved in plant fatty acid metabolism is LEC1 (Leafy Cotyledon 1).LEC1 is the regulatory factor of a key in Arabidopis thaliana embryo generation and the seed maturity process, also (Lotan, T. is regulated and control in the accumulation of embryo's storage thing in embryo's forming process simultaneously, Ohto, M., Yee, K.M., West, M.A., Lo, R., Kwong, R.W., Yamagishi, K., Fischer, R.L., Goldberg, R.B., and Harada, J.J.Arabidopsis LEAFY COTYLEDON1 is sufficient to induce embryo development invegetative cells.Cell.1998,93,1195-1205.).Overexpression LEC1 can induce numerous and the expression lipid acid synthesis related gene, comprises the gene of three nuclear gene group coding subunits in the crucial rate-limiting enzyme acetyl-CoA carboxylase of coding lipid acid de novo synthesis, matches therewith, the content of main fatty acid component rise significantly (Mu, J., Tan in LEC1 overexpression plant, H., Zheng, Q., Fu, F., Liang, Y., Zhang, J., Yang, X., Wang, T., Chong, K., Wang, X.J., et al..LEAFY COTYLEDON1 is a key regulator of fatty acid biosynthesis in Arabidopsis.Plant Physiol.2008,148,1042-1054.).

Summary of the invention

An object of the present invention is to provide and synthetic relevant albumen and the encoding gene thereof of lipid acid.

The synthetic relevant albumen of provided by the present invention and lipid acid is called GmLEC1B, derives from soybean (Glycine max L.), is following 1) or 2) protein:

1) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1;

2) with the amino acid residue sequence of sequence in the sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and synthetic relevant with lipid acid by 1) deutero-protein.

In order to make 1) in GmLEC1B albumen be convenient to purifying, 6XMYC label (sequence is EQKLISEEDL) on proteinic N-terminal that can the aminoacid sequence shown in the sequence 1 is formed in by sequence table or C-terminal connect.

Above-mentioned 2) but in GmLEC1B albumen synthetic, also can synthesize its encoding gene earlier, carry out biology again and express and to obtain.Above-mentioned 2) encoding gene of the GmLEC1B in can be by lacking or add the codon of one or several amino-acid residue in the dna sequence dna shown in the sequence in the sequence table 2, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the 6XMYC label.

Above-mentioned and encoding gene (called after GmLEC1B gene) the lipid acid synthesis associated protein also belongs to protection scope of the present invention.

Described and the encoding gene lipid acid synthesis associated protein are following 1)-6) in arbitrary described gene:

1) its nucleotide sequence is the sequence 2 in the sequence table;

2) its nucleotide sequence be in the sequence table sequence 3 from shown in 5 ' the terminal 49-2118 position;

3) its nucleotide sequence is the sequence 3 in the sequence table;

4) its nucleotide sequence is the sequence 4 in the sequence table;

5) under stringent condition with 1) or 2) or 3) or 4) gene recombination and the gene of encoding said proteins;

6) with 1) or 2) or 3) or 4) gene have the homology more than 90% and the gene of encoding said proteins.

Above-mentioned stringent condition can be with 6 * SSC, and the solution of 0.5%SDS 65 ℃ of hybridization down, is used 2 * SSC then, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.

Sequence 3 in the sequence table is by 2118 based compositions, from 5 ' terminal 1-48 bit base is 5 '-UTR, from 5 ' terminal 49-99 bit base is first exon, from 5 ' terminal 100-1491 bit base is first intron, is second exon from 5 ' terminal 1492-2118 bit base.

The expression cassette, recombinant expression vector, transgenic cell line or the reorganization bacterium that contain the encoding gene of above-mentioned and lipid acid synthesis associated protein also belong to protection scope of the present invention.

Described recombinant expression vector specifically can be between the multiple clone site of binary vector pER10 to insert and above-mentionedly obtains recombinant expression vector with the encoding gene lipid acid synthesis associated protein.

The encoding gene total length of described and lipid acid synthesis associated protein of increasing or its arbitrary segmental primer are to also belonging to protection scope of the present invention;

Described primer centering, a primer sequence is shown in sequence in the sequence table 5, and another primer sequence is shown in sequence in the sequence table 6.

Another object of the present invention provides a kind of method of cultivating transgenic plant.

The method of cultivation transgenic plant provided by the present invention is to change in the purpose plant with encoding gene GmLEC1B or genomic dna the lipid acid synthesis associated protein above-mentioned, obtains the transgenic plant that fatty acid content is higher than described purpose plant.

Described lipid acid is: at least a among C16:0, C18:0, C18:1, C18:2, C18:3, C20:0 and the C20:1.

Above-mentioned encoding gene GmLEC1B with the lipid acid synthesis associated protein imports in the purpose plant by above-mentioned recombinant expression vector.

Described recombinant expression vector is for inserting the described recombinant expression vector that obtains with the encoding gene lipid acid synthesis associated protein between the multiple clone site of binary vector pER10.

Above-mentioned and lipid acid synthesis associated protein GmLEC1B, encoding gene GmLEC1B and/or the expression cassette, recombinant expression vector, transgenic cell line or the application of reorganization bacterium in synthetic fatty acid that contain encoding gene GmLEC1B also belong to the scope of protection of the invention; Described lipid acid is: at least a among C16:0, C18:0, C18:1, C18:2, C18:3, C20:0 and the C20:1.

Carry the GmLEC1B gene of the present invention's coding or the plant expression vector of its homologous sequence and can pass through to use protoplastis-chemical mediated method (Ca ²⁺, PEG), Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, pollen tube, microinjection, electricity swash, combination transformed plant cells, tissue or the organ of any or several method in the particle gun, conventional biological method such as agriculture bacillus mediated, and plant transformed cell, tissue or organ cultivated into plant; Described tissue and organ can comprise fruit pod, callus, stem apex, blade and the seed etc. of host plant.By host transformed plant (purpose plant) is dicotyledons; Described dicotyledons is specially Arabidopis thaliana or soybean.

The present invention has obtained and the synthetic relevant gene GmLEC1B of lipid acid, and has verified the function of this gene by transgenic experiments.Experiment showed, that the gene GmLEC1B with the present invention's protection behind the overexpression, can improve the content of lipid acid in the Arabidopis thaliana seedling in Arabidopis thaliana.This has important theory and practical significance to the fatty acid content of raising soybean and the improvement of correlated character, has wide application and market outlook at agriculture field.

Description of drawings

Fig. 1 is the collection of illustrative plates of recombinant expression vector pER10-GmLEC1B-6XMYC.

Fig. 2 detects GmLEC1B expression of gene amount in the transfer-gen plant by RT-PCR.

Fig. 3 is the variation by Sudan red dyeing indication transgenic arabidopsis plant body fat acid content.

Fig. 4 is the content by the lipid acid each component of chromatography of gases-mass spectrum logotype instrument (GC-MS) mensuration.

Fig. 5 is the lipid acid relative content of wild-type Arabidopis thaliana plant and transgenic arabidopsis plant.

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.

The discovery of embodiment 1, gene

By the homologous sequence comparison, in soybean, find the homologous gene GmLEC1B of Arabidopis thaliana AtLEC1 gene.Find that in sequence alignment soybean GmLEC1B gene and Arabidopis thaliana AtLEC1 gene conservative structural domain reach 95.5% homology.

Acquisition of embodiment 2, transgenic plant and detection thereof

One, the acquisition of transgenic plant

1, recombinant expression vector makes up

(public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity with soybean (Glycine max cultivar Nannong11382), the non-patent literature of putting down in writing this material is Liao Y, Zou HF, Wei W, Hao YJ, Tian AG, Huang J, Liu YF, Zhang JS*and Chen SY*.Soybean GmbZIP44, GmbZ IP62 and GmbZIP78 genes function as negative regulator of ABA signaling and conf er salt and freezing tolerance in transgenic Arabidopsis.Planta.2008, blade genomic dna 228:225-240) is a template, uses following primer:

GmLEC1B-F:CCctcgagAACGCCTACTTCATCTCTCTTATA (lowercase is the restriction enzyme site of XhoI) (sequence 5 in the sequence table) and

GmLEC1B-R:GGgaattccTATGGAGCGAGCATTTGGTTCATG (lowercase is the EcoRI restriction enzyme site) (sequence 6 in the sequence table) carries out pcr amplification, the PCR product that obtains is connected on the intermediate carrier pGEM-TEasy (Promega company), obtain recombinant vectors pT-GmLEC1B, obtain the nucleotide sequence shown in the sequence 3 1-2118 positions in the sequence table through order-checking.

Sequence 3 in the sequence table is by 2118 based compositions, for comprising the genomic DNA fragment of GmLEC1B gene.Sequence 3 is 5 '-UTR from 5 ' terminal 1-48 bit base, from 5 ' terminal 49-99 bit base first exon that is this gene, from first intron that 5 ' terminal 100-1491 bit base is this gene, be second exon of this gene from 5 ' terminal 11492-2118 bit base.

The nucleotide sequence of the cDNA coding region of the genomic dna correspondence shown in the sequence 3 49-2118 positions in the sequence table is shown in sequence in the sequence table 2.Sequence 2 is by 678 based compositions, and coding has the albumen of the aminoacid sequence of sequence 1 in the sequence table, with this albumen called after GmLEC1B.Sequence 1 is made up of 226 amino-acid residues in the sequence table.

(public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity to carrier pBA-6xMYC with SmaI and BamHI enzyme, the non-patent literature of putting down in writing this carrier is Zhou Q, Hare PD, Yang SW, Zeidler M, Huang LF and Chua NH.FHL is required for full phytochrome A signaling and shares overlapping functions with FHY1.Plant Journal.2005.43,356-370.) small segment that obtains of double digestion inserts between the SmaI and BamHI restriction enzyme site of intermediate carrier pSK (available from Shanghai office of Merck ﹠ Co., Inc.), obtains recombinant vectors pSK-6xMYC.The small segment that obtains with the pT-GmLEC1B of XhoI and the above-mentioned acquisition of EcoRI double digestion inserts between the XhoI and EcoRI recognition site of pSK-6xMYC then, obtains pSK-GmLEC1B-6xMYC.Use the pSK-GmLEC1B-6xMYC of XhoI and the above-mentioned acquisition of XbaI double digestion then, (public can obtain with developmental biology institute from the Chinese Academy of Sciences's heredity small segment that obtains with using XhoI and SpeI double digestion binary vector pER10, the non-patent literature of putting down in writing this carrier is Zuo, J., Hare, P.D., and Chua, N.H.Applications of chemical-inducible expression systems in functional genomics and biotechnology.Methods in Molecular Biology-Arabidopsis Protocols, eds.Salinas, J., and Sanchez-Serrano, J.J., pp 2006.329-342.Humana Press, NJ) (the pER10 bacterial resistance is grand enzyme element, the transgenic plant resistance is that enzyme element of card) connect, because of XbaI can produce identical sticky end with SpeI, therefore obtain final carrier pER10-GmLEC1B-6XMYC, sequence verification, the result has inserted dna fragmentation shown in the sequence 4 between the XhoI of pER10 and SpeI restriction enzyme site, the 1-2118 position is the GmLEC1B gene in the sequence 4, and the 2149-2387 position is 6xMYC, shows that the vector construction of structure is correct.Fig. 1 is recombinant expression vector pER10-GmLEC1B-6XMYC structural pattern figure: wherein promoter refers to promotor; Ter is a terminator; NPTII is that resistance screening gene of card; LexA is bacteriostatic; XVE is that the DNA of LexA bacteriostatic constitutes in conjunction with the trans activation domain (V) of territory (X) and hsv protein VP16 and the ligand binding domain (E) of estrogen receptor, pER10 can make goal gene overexpression in plant materials under estrogenic inducing, be 3-5 times of 35S promoter.

2, transgenic plant obtain

The sharp method for transformation of recombinant expression vector pER10-GmLEC1-6XMYC electricity consumption that step 1 is obtained changes in Agrobacterium GV3101 (available from the Invitrogen company) bacterial strain.Filtering out the Agrobacterium with spectinomycin resistance is positive conversion Agrobacterium.The picking positive transforms the single colony inoculation of Agrobacterium in 20ml LB liquid nutrient medium (containing the plain 50mg/L of grand enzyme, Rifampin 50mg/L), and 28 ℃, 150rpm shaking culture 2 days.The bacterium liquid that obtains connect bacterium in the 300ml LB substratum that contains Rifampin and grand enzyme element with 2% inoculum size, according to above-mentioned condition shaking culture 16-18 hour.Institute's bacterium liquid that obtains is through 5, and 000rpm, 20 minutes centrifugal collection thalline, thalline are resuspended in 250ml and contain in 5% sucrose and Silwet L-77 (the LEHLE SEEDS company) conversion fluid, slowly shake up.Conversion fluid changes in the 250ml beaker, (public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity with removing the wild-type Arabidopis thaliana Col-0 of flower with the fruit pod, the non-patent literature of putting down in writing this material is: Ren, B., Liang, Y., Deng, Y., Che n, Q., Zhang, J., Yang, X., and Zuo, J. (2009) Genome-wide comparative analysis of type-A Arabidopsis response regulator genes by overexpression studies reveals their diverse roles and regulatory mechanisms in cytokinin signaling.Cell Res.19:1178-1190.) be inverted in the beaker, keep being advisable in 20 seconds at vacuum state.Arabidopis thaliana cultivation after transforming is obtained seed, the Arabidopis thaliana seed that obtains is cultivated in containing the substratum of kantlex, the seedling that grows greenery and root system is transgenic arabidopsis T1 generation.Gather in the crops seed from T1 for the transgenic arabidopsis individual plant, after planting obtain T2 and be for isozygotying of transgenic arabidopsis plant.Simultaneously, use and obtain to change the identical method of GmLEC1B gene plant, obtain changeing empty carrier contrast Arabidopis thaliana plant; And establish and do not carry out Arabidopis thaliana that any transgenosis handles as the wild-type adjoining tree.

Two, the detection of transgenic plant

1, detects GmLEC1B expression of gene amount by RT-PCR

T2 generation is genetically modified isozygotys is behind the seed germination of seed and wild-type adjoining tree 7 days, behind oestrogenic hormon (Sigma company) the processing 24h with 10 μ M, extract RNA with reference to following method, and get 1 μ g RNA and be inverted to corresponding cDNA, utilize primer GmLEC1B-F and GmLEC1B-R to carry out RT-PCR then and detect GmLEC1B expression of gene amount.Utilize primer UBQ5-F1 and UBQ5-F2 amplification UBQ gene as interior mark, primer sequence such as table 1.The result as shown in Figure 2, Col represents the wild-type plant, and L42 represents different pER10-GmLEC1B-6XMYC transgenic lines respectively with L43, as seen from the figure, compare with wild-type (Col) adjoining tree, GmLEC1B expression of gene amount significantly increases in the transfer-gen plant.The pER10-GmLEC1B-6XMYC transgenic line L42 and the L43 of these two high expression level amounts are used for the detection of following lipid acid.GmLEC1B expression of gene amount and wild-type adjoining tree do not have significant difference in the commentaries on classics empty carrier contrast Arabidopis thaliana plant.

Table 1 primer sequence

The primer title	Primer sequence (5 '-3 ')
		GmLEC1B-F	CCctcgagAACGCCTACTTCATCTCTCTTATA
GmLEC1A-R	GGgaattccTATGGAGCGAGCATTTGGTTCATG
		UBQ5-F1	CTTCAGCAGCCGTTGCCTCA
UBQ5-F2	CTGGTAAACGTAGGTGAGTCC

The RNA extracting method is as follows:

TRIzol method: carry out with reference to the operation instruction that manufacturer (Invitrogen) provides.At first precooling mortar, pestle, 1.5ml centrifuge tube and TRIzol reagent.Getting the different strain of above-mentioned transgenosis respectively is 100mg, pulverizes fast with liquid nitrogen, is transferred to the centrifuge tube of precooling.Add 1ml TRIzol reagent, the vibration mixing.Room temperature was placed 5 minutes, and 4 ℃ 12, centrifugal 10 minutes of 000g.Get supernatant and move into new centrifuge tube, add 200 μ l chloroforms, the jog mixing.Room temperature was placed 3 minutes, centrifugal 10 minutes of 4 ℃ of 12000g.Get upper water and move into new pipe mutually, add 250 μ l Virahols and the high salt precipitation agent of 250 μ l (0.8M Trisodium Citrate, 1.2M sodium-chlor), room temperature was placed 3 minutes, and centrifugal 10 minutes of 4 ℃ of 12000g remove supernatant.Precipitation is with 1ml 75% washing with alcohol, and centrifugal 5 minutes of 4 ℃ of 7500g remove supernatant.Be deposited in drying at room temperature 5-10 minute, and added an amount of (about 50 μ l) DEPC water dissolution (, can place 50 ℃ of water-bath 10-30 minutes) and obtain RNA in order to help the RNA dissolving.

The cDNA reverse transcription:

Synthesizing of cDNA first chain:

(1) gets the RNA 1-2 μ g of said extracted, add DEPC water to 10 μ l;

(2) add 1 μ l (0.5g) Oligo (dT) ₁₅With 1 μ l 10mM dNTP, mixing;

(3) 65 ℃, 5 minutes, be placed on then on ice, add fast: 5 * buffer, 4 μ l, RNAse inhibitor 1 μ l, 0.1M DTT 2 μ l, 5U/ μ l ThermoScript II H 0.5 μ l;

(4) reverse transcription reaction (cDNA first chain is synthetic) carries out on the PCR instrument, uses following program:

42 ℃ earlier, 50 minutes; 45 ℃ again, 10 minutes; 50 ℃ again, 10 minutes; 70 ℃ again, 15 minutes;

(5) take out fast after reaction finishes, add 10mg/ml 1 μ l RNase on ice, placed 30-60 minute at 37 ℃ then, obtain cDNA.

Pcr amplification:

PCR reaction system (20 μ l): template DNA 1 μ l; 10 * buffer, 2 μ l; 2.5mM dNTP 2 μ l; 10 μ Mprimers, 2 μ l; Ultrapure water 12.8 μ l; 5U/ μ l Taq archaeal dna polymerase 0.2 μ l.

The pcr amplification program is: 94 ℃ of pre-sex change 2min of elder generation; 94 ℃ of sex change 30s again, 54 ℃ of annealing 30s, 72 ℃ prolong 1min, and cycle number is respectively 27 and 33; And then 72 ℃ of prolongation 10min; 4 ℃ of preservations.

Used PCR instrument model is Whatman Biometra T Gradient 96 and MJ PTC-200.

2, the fatty acid metabolism of transfer-gen plant detects

(1) the sprouting phenotype of transfer-gen plant on inducing culture

The mistake of above-mentioned acquisition being expressed the seed of positive transgenic line, commentaries on classics empty carrier contrast Arabidopis thaliana plant and the wild-type Col-0 of pER10-GmLEC1B-6XMYC broadcasts respectively on the MS substratum (Sigma company) that does not contain and contain 10 μ M oestrogenic hormon (Sigma company), placed 2 days, and moved to then in the greenhouse for 4 ℃ at 22 ℃, intensity of illumination 80-120 μ E ^-2S ^-1Cultivated 7 days under the condition.When sprouting on not adding estrogenic substratum, transfer-gen plant and wild-type be significantly difference not.And when on adding estrogenic substratum, sprouting, transgenic plant then show as serious paramophia, mainly show as the very little and yellow of cotyledon, (A among Fig. 3: the left side is a wild-type, and the right side is representational pER10-GmLEC1B-6XMYC transgenic line L42 not break up true leaf; B among Fig. 3: the left side is a wild-type, and the right side is representational pER10-GmLEC1B-6XMYC transgenic line L43; Scale is 1mm) sprout after whole soon plant strain growth and growing almost stop, final dead.The phenotype and the wild-type adjoining tree that change empty carrier contrast Arabidopis thaliana plant do not have significant difference.

(2) variation of Sudan red dyeing indication body fat acid content

Be soaked in 1% Sudan red (Fat Red7B) (Sigma company) respectively with in containing the estrogenic MS substratum of 10 μ M, sprouting back growth 7 days pER10-GmLEC1B-6XMYC transfer-gen plant and wild-type Col-0 in above-mentioned (1), behind the room temperature 30min, with washed with de-ionized water 3 times, every all over 2min, (A among Fig. 4: the left side is a wild-type to coloration result, and the right side is representational pER10-GmLEC1B-6XMYC transgenic line L42 as shown in Figure 4; B among Fig. 4: the left side is a wild-type, and the right side is representational pER10-GmLEC1B-6XMYC transgenic line L43; Scale is 1mm).As seen from the figure, at the root and the cotyledon place of pER10-GmLEC1B-6XMYC transfer-gen plant, the accumulation volume of lipid acid is apparently higher than wild-type.The body fat acid content of this explanation transfer-gen plant improves greatly.The fatty acid content and the wild-type adjoining tree that change empty carrier contrast Arabidopis thaliana plant do not have significant difference.

(3) the GC-MS method detects the variation of body fat acid content

Each 0.05 gram of seedling of the seedling and the wild-type plant of 7 days pER10-GmLEC1B-6XMYC transfer-gen plant of back growth will be sprouted in containing the estrogenic MS substratum of 10 μ M in above-mentioned (1), in liquid nitrogen, grind to form dry powder, transfer to then in the test tube of with closure, add 1.5mL methyl alcohol (containing 2.5% (V/V) vitriol oil), 80 ℃ of heating in water bath 90 minutes. add the 2mL 0.9%NaCl aqueous solution and 1mL normal hexane again, mixing, 4, centrifugal 10 minutes of 000rpm collects the normal hexane phase.Vacuum is drained, use the 50ul acetic acid ethyl dissolution, get 1ul and go up sample, analyze the content situation of various fatty acid components with the TurboMass GC/MS instrument of PerkinElmer company, used GC post is 30m * 0.25mmBPX-70 post, and the GC heating schedule is: 120 ℃ of initial temperatures, kept 1 minute, speed with 10 ℃ of per minutes rises to 150 ℃ again, and the speed with 4 ℃ of per minutes is warming up to 230 ℃ then, keeps 10 minutes.

Detected result is as follows:

In the pER10-GmLEC1B-6XMYC transfer-gen plant, detect following fatty acid component: C16:0, C18:0, C18:1, C18:2, C18:3, C20:0, C20:1;

In the wild-type adjoining tree, detect following fatty acid component: C16:0, C18:0, C18:1, C18:2, C18:3;

In order to contrast the fatty acid content between wild-type and the transgenic plant, each component is made the relative content that interior mark is converted to lipid acid with the trig lyceride of C17:0, three repetitions, results averaged ± standard deviation are established in experiment.Result such as table 2 and shown in Figure 5 (the grey post is represented the wild-type plant among Fig. 5, and fatty acid content is that three secondary pollutants are learned multiple mean value; The black post is represented the pER10-GmLEC1B-6XMYC transfer-gen plant, fatty acid content is that two each three secondary pollutants of strain system are learned multiple mean value) from the result as seen, compare with the wild-type contrast, each component concentration of pER10-GmLEC1B-6XMYC transfer-gen plant lipid acid after inducing all obviously rises, wherein the amplitude maximum of 18 carbon, three diluted acids (C18:3) raising.The fatty acid component that changes empty carrier contrast Arabidopis thaliana plant does not have significant difference with each components contents and wild-type adjoining tree.

The lipid acid relative content contrast situation of table 2 wild-type and transfer-gen plant

Claims (10)

1. an albumen is following 1) or 2) protein:

1) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 1;

2) with the amino acid residue sequence of sequence in the sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and synthetic relevant with lipid acid by 1) deutero-protein.

2. the described proteic encoding gene of claim 1.

3. encoding gene according to claim 2 is characterized in that: described encoding gene is following 1)-6) in arbitrary described gene:

1) its nucleotide sequence is the sequence 2 in the sequence table;

2) its nucleotide sequence be in the sequence table sequence 3 from shown in 5 ' the terminal 49-2118 position;

3) its nucleotide sequence is the sequence 3 in the sequence table;

4) its nucleotide sequence is the sequence 4 in the sequence table;

5) under stringent condition with 1) or 2) or 3) or 4) gene recombination and the described proteic gene of coding claim 1;

6) with 1) or 2) or 3) or 4) or 5) gene have the homology 90% or more and the described proteic gene of claim 1 of encoding.

4. the expression cassette, recombinant expression vector, transgenic cell line or the reorganization bacterium that contain claim 2 or 3 described encoding genes.

5. a method of cultivating transgenic plant is that claim 2 or 3 described encoding genes are changed in the purpose plant, obtains the transgenic plant that fatty acid content is higher than described purpose plant.

6. method according to claim 5 is characterized in that: claim 2 or 3 described encoding genes are to import in the purpose plant by the described recombinant expression vector of claim 4.

7. according to claim 5 or 6 described methods, it is characterized in that: described recombinant expression vector is for inserting the recombinant expression vector that claim 2 or 3 described encoding genes obtain between the multiple clone site of binary vector pER10.

8. according to arbitrary described method among the claim 5-7, it is characterized in that: described purpose plant is a dicotyledons; Described dicotyledons is specially Arabidopis thaliana or soybean.

9. according to arbitrary described method among the claim 5-8, it is characterized in that: described lipid acid is: at least a among C16:0, C18:0, C18:1, C18:2, C18:3, C20:0 and the C20:1.

10. the described albumen of claim 1, claim 2 or 3 described encoding genes and/or the described expression cassette of claim 4, recombinant expression vector, transgenic cell line or the application of reorganization bacterium in synthetic fatty acid;

Described lipid acid is: at least a among C16:0, C18:0, C18:1, C18:2, C18:3, C20:0 and the C20:1.

Images