CN102276707B - Pichia pastoris wall protein Gcw19 as well as surface display system and construction method thereof - Google Patents
Pichia pastoris wall protein Gcw19 as well as surface display system and construction method thereof Download PDFInfo
- Publication number
- CN102276707B CN102276707B CN 201110215853 CN201110215853A CN102276707B CN 102276707 B CN102276707 B CN 102276707B CN 201110215853 CN201110215853 CN 201110215853 CN 201110215853 A CN201110215853 A CN 201110215853A CN 102276707 B CN102276707 B CN 102276707B
- Authority
- CN
- China
- Prior art keywords
- pichia pastoris
- pastoris phaff
- gcw19
- protein
- wall
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses pichia pastoris wall protein Gcw19 as well as a surface display system and construction method thereof. The amino acid sequence of the pichia pastoris wall protein is shown as SEQ NO:1; and surface display system of a pichia pastoris cell is constructed by taking the pichia pastoris wall protein Gcw19 as an anchored protein and fixing target protein on the surface of the pichia pastoris cell. The wall protein Gcw19 has extremely high expression level in the pichia pastoris; and the expression level is 6 times and 14 times higher than those of the conventional endogenous anchored proteins Pirl and Pir2 for the surface display system of the pichia pastoris cell respectively.
Description
Technical field
The present invention relates to biological technical field, be specifically related to surface display system and the construction process of a kind of pichia pastoris phaff wall-held protein Gcw19 and structure thereof.
Background technology
Microorganism cells surface display technology is a kind of technology that protein or polypeptide is fixed on cell surface by anchorin.The microorganism cells surface display system comprises host bacterium, anchorin and target protein, also adds one section connection (linker) sequence sometimes between anchorin and target protein.The microorganism cells surface display all has broad application prospects at aspects such as polypeptide separation, whole-cell catalyst, full cell sorbent material, vaccine and antibody producing, albumen library screening, biosensor, biological restoration.
In the microorganism surface display system, use many host bacterium at present and mainly contain phage, bacterium (as intestinal bacteria
Escherichia. coli, proteus mirabilis
Proteus mirabilisDeng), yeast saccharomyces cerevisiae (
Saccharomyces cerevisiae) and pichia pastoris phaff (
Pichia pastoris).The anchorin that surface display uses generally has following feature: (1) is anchored on cell surface more securely, can not come off from cell surface easily; (2) can effectively merge with target protein sequence and do not influence the structure and function of target protein; (3) proteolytic enzyme there is certain resistance.The anchorin of bacterium surface exhibiting system mainly contains bacterial pilli albumen, S layer albumen, ice nucleation protein (INP) and some outer membrane proteins.The anchorin of yeast saccharomyces cerevisiae surface display system mainly contains the lectin system, the prime system that flocculates is unified other GPI grappling (glycosylphosphatidylinositol anchored) protein system and some Pir protein systems.Pichia pastoris phaff has can realize that high density fermentation (cell density can up to 140g/L), albumen appropriateness glycosylation and fermention medium form advantages such as simple, has boundless prospect in the application aspect the microorganism cells surface display, at present existing many kinds of albumen successfully have been illustrated in the pichia pastoris phaff surface as separating fat Ye Shi yeast fat enzyme, Kluyveromyces lactis yellow enzyme, Rhizopus oryzae lipase etc.At present the anchorin that uses in the pichia pastoris phaff surface display system is mainly from lectin system, the flocculation prime system of the yeast saccharomyces cerevisiae Sed1p albumen etc. of unifying.But these anchorins are not the moietys of pichia spp, but introduce by artificial means external source.Therefore with the anchorin of external source wall-held protein as the pichia spp surface display system, may compete the wall-held protein binding site with endogenous wall-held protein, cause showing that efficient is not high.
Khasa YP (Khasa YP, et al. Isolation of Pichia pastoris PIR genes and their utilization for cell surface display and recombinant protein secretion. Yeast. 2010. (published online) .) etc. has reported and has utilized pichia spp Pir albumen to carry out the cell surface display of foreign protein as anchorin.But the contriver finds that the expression amount of Pir albumen itself is lower, and is general as the anchorin effect of pichia spp surface display system.
Summary of the invention
The technical problem to be solved in the present invention is to improve the expression efficiency of the endogenous anchorin that is used for the pichia pastoris phaff surface display system.
The technical scheme that the present invention addresses the above problem is:
A kind of pichia pastoris phaff wall-held protein Gcw19, the aminoacid sequence of this albumen is SEQ NO:1.
Pichia pastoris phaff wall-held protein of the present invention is made up of 126 amino acid, and size is about 11.6KDa.Pichia pastoris phaff wall-held protein of the present invention is combined on the pichia pastoris phaff cell walls with the form of covalent linkage, can not extract with the sodium lauryl sulphate method, can extract with the beta-1,3-glucanase method.
Pichia pastoris phaff wall-held protein Gcw19 of the present invention can be used for making up pichia spp cell surface display system, and described pichia pastoris phaff cell surface display system is that anchorin is fixed on the pichia spp cell surface with target protein and constitutes with described wall-held protein.
The encode gene of described pichia pastoris phaff wall-held protein GCW19, nucleotide sequence is shown in SEQ NO:4.
A kind of pichia pastoris phaff cell surface display system is to be anchorin with described pichia pastoris phaff wall-held protein Gcw19, target protein is fixed on the pichia pastoris phaff cell surface constitutes.
Above-mentioned pichia pastoris phaff cell surface display system can make up by following steps:
(1) with the described gene clone of claim 2 in the expression cassette of expression vector, the surface display expression vector that to obtain with the described pichia pastoris phaff wall-held protein of claim 1 be anchorin;
(2) gene order of target protein is cloned into the upstream of the pichia pastoris phaff wall-held protein gene order of described surface display expression vector, forms fusion gene with described pichia pastoris phaff wall-held protein gene;
(3) transform pichia pastoris phaff, according to the screening of the selection markers on described expression vector positive transformant, namely obtain surface display system.
Described target protein is alkalescent xylanase, rhizomucor miehei lipase or candida antarctica lipase B.
Described pichia pastoris phaff is pichia pastoris phaff GS115.
In the aforesaid method, described expression vector is the pichia pastoris phaff expression vector of using always that has the secretion signal peptide sequence, as pPIC9K, pPICZ α A, pPICZ α B, pPICZ α C, pGAPZ α A, pGAPZ α B, pGAPZ α C etc.; If the expression vector of no signal peptide can add the secretion signal peptide sequence in the upstream of target protein gene order.
When expression vector is pPIC9K, behind the structure surface display expression vector, the gene order clone of target protein is connected to the restriction enzyme digestion sites of the pichia pastoris phaff wall-held protein gene order upstream of described surface display expression vector
EcoRI with
MluBetween the I.
Advantage and beneficial effect that the present invention has with respect to prior art.
Wall-held protein Gcw19 of the present invention is the endogenous wall-held protein of pichia pastoris phaff, and expression amount is very high in pichia spp, compare with Pir2 albumen with the endogenous anchorin Pir1 albumen that now is used for the pichia pastoris phaff surface display system, high 6 times and 14 times respectively.Therefore, pichia pastoris phaff of the present invention can be used for making up the pichia pastoris phaff surface display system of high expression level efficient.
Description of drawings
Fig. 1.: with the Western blot result of SDS method and beta-1,3-glucanase method extraction pichia pastoris phaff wall-held protein Gcw19.A. the SDS method is extracted wall-held protein Gcw19; B. the beta-1,3-glucanase method is extracted wall-held protein Gcw19.
Fig. 2: the flow cytometer detected result of reorganization bacterium GS115/GCW19 and contrast bacterium GS115.Dotted line: contrast bacterium GS115; Solid line: reorganization bacterium GS115/GCW19.
Fig. 3: the dull and stereotyped hydrolysis circle of tributyrin emulsification method detects the GS115/GCW19-CALB positive transformant.A. contrast bacterium GS115; B. positive transformant GS115/GCW19-CALB.
Fig. 4: fluorescent microscope checking fusion rotein GCW19-CALB is in pichia spp cell walls surface display result.A. the ordinary optical microgram of GS115/GCW19-CALB;
B. the fluorescence microscopy figure of GS115/GCW19-CALB;
C. contrast the ordinary optical microgram of bacterium GS115;
D. contrast the fluorescence microscopy figure of bacterium GS115.
Fig. 5: bacterial enzyme graphic representation alive.Wherein,
The bacterial enzyme curve alive of expression reorganization bacterium GS115/GCW19-CALB;
The bacterial enzyme curve alive of expression contrast bacterium GS115.
Fig. 6: adopt Gcw19, Pir1 and Pir2 to show that as anchorin the enzyme of CALB is relatively alive.
Terminological interpretation
MD flat board: 13.4g/L yeast nitrogen, 4 * 10
-4G/L vitamin H, 20g/L glucose and 20g/L agar
BMGY substratum: 20g/L peptone, 10g/L yeast extract, 100 mM potassium phosphate buffers (pH6.0), 13.4g/L yeast nitrogen, 4 * 10
-4The g/L vitamin H, 10g/L glycerine.
BMMY substratum: 20g/L peptone, 10g/L yeast extract, 100 mM potassium phosphate buffers (pH6.0), 13.4g/L yeast nitrogen, 4 * 10
-4The g/L vitamin H, 5g/L methyl alcohol.
Tributyrin emulsification flat board:: 13.4g/L yeast nitrogen, 10g/L tributyrin, 5g/L polyvinyl alcohol, 20g/L agar, 100mM phosphate buffered saline buffer (pH6.0).
Embodiment
Embodiment 1: clone, expression and the evaluation of pichia pastoris phaff wall-held protein GCW19 gene
(1) clone of pichia pastoris phaff wall-held protein GCW19 gene
According to the gene order SEQ NO.4 of pichia pastoris phaff wall-held protein GCW19 and the multiple clone site feature on the pichia pastoris phaff plasmid pPIC9K, the design synthetic primer:
Wherein primer P1 square frame partly is
EcoRI restriction enzyme site, underscore partly are
MluI restriction enzyme site, italicized item are the FLAG sequence label; Primer P2 underscore partly is
NotThe I restriction enzyme site.Being template with pichia pastoris phaff GS115 genomic dna, is primer with P1 and P2, amplifies wall-held protein GCW19 gene order by PCR method, and amplification condition is: 94 ℃ of pre-sex change 5 minutes; Carry out circulation below 30 again: 30 seconds, 55 ℃ annealing of 94 ℃ of sex change were extended 1 minute for 30 seconds, 72 ℃; Last 72 ℃ were extended 7 minutes.
(2) structure of carrier p9KGCW19-FLAG
The PCR product of wall-held protein GCW19 gene is used
EcoRI and
NotThe product that I double digestion, enzyme are cut and pichia pastoris phaff expression plasmid pPIC9K's
EcoRI and
NotI double digestion product connects, and pichia pastoris phaff surface display expression plasmid p9KGCW19 obtains recombinating.With the p9KGCW19 plasmid transformation escherichia coli host Top10F that obtains.With the LB plate screening transformant that contains the 50mg/L penbritin, the transformant of the picking amicillin resistance positive, extract plasmid, by
EcoRI and
NotThe I double digestion is identified also order-checking, and the result shows that wall-held protein GCW19 gene order correctly inserts, and the FLAG label is in the upstream of described wall-held protein GCW19 gene.
(3) expression of pichia pastoris phaff wall-held protein GCW19 and evaluation
Adopt restriction enzyme
SacAfter the p9KGCW19 plasmid of I carries out linearizing, transform pichia pastoris phaff GS115, picking His on the MD flat board with the LiCl method
+Transformant extracts genomic dna as template, is primer with P1, P2, carries out pcr amplification, and the result proves that the gene order of pichia pastoris phaff wall-held protein GCW19 has been incorporated in the genome of GS115, the reorganization bacterium called after GS115/ GCW19 that obtains.GS115/ GCW19 is inoculated in the 50mL BMGY substratum, 30 ℃, 200rpm shaking culture 16-20h to OD
600To 2-6.Centrifugal collection thalline is suspended in it in BMMY substratum again, is diluted to OD
600Be 1, continue shaking culture, add 1% methyl alcohol every 24h in the BMMY substratum and carry out abduction delivering.Behind the fermentation 96h, the centrifugal collection thalline of 10000 rpm, adopt β-1,3-dextran enzyme process extracts cell wall protein, carry out the SDS-PAGE electrophoresis, and carry out Western blot with anti-FLAG antibody and verify (Fig. 1), the result shows that pichia pastoris phaff wall-held protein GCW19 successfully obtains expressing at the pichia pastoris phaff cell surface.After carrying out immune response with anti-FLAG antibody, adopt flow cytometer that reorganization bacterium GS115/ GCW19 and GS115 are analyzed comparison (Fig. 2), result's demonstration is compared with GS115, bigger skew takes place in the fluorescence of reorganization bacterium GS115/ GCW19, shows the fusion rotein of successfully having expressed pichia pastoris phaff wall-held protein GCW19-FLAG at the cell surface of reorganization bacterium GS115/ GCW19.
Embodiment 2: the structure of pichia pastoris phaff wall-held protein GCW19 surface display carrier p9KGCW19
(1) clone of pichia pastoris phaff wall-held protein GCW19 gene
According to the multiple clone site feature on pichia pastoris phaff wall-held protein GCW19 gene order and the pichia pastoris phaff plasmid pPIC9K, the design synthetic primer:
Primer P2 underscore partly is
NotThe I restriction enzyme site; Primer P3 square frame partly is
EcoRI restriction enzyme site, underscore partly are
MluThe I restriction enzyme site.Being template with pichia pastoris phaff GS115 genomic dna, is primer with P2 and P3, amplifies wall-held protein GCW19 gene order by PCR method, and amplification condition is: 94 ℃ of pre-sex change 5 minutes; Carry out circulation below 30 again: 30 seconds, 55 ℃ annealing of 94 ℃ of sex change were extended 1 minute for 30 seconds, 72 ℃; Last 72 ℃ were extended 7 minutes.Obtain pichia pastoris phaff wall-held protein GCW19 gene fragment.
(2) structure of surface display expression vector p9KGCW19
The PCR product of wall-held protein GCW19 gene is used
EcoRI and
NotThe product that I double digestion, enzyme are cut and pichia pastoris phaff expression plasmid pPIC9K's
EcoRI and
NotI double digestion product connects, and pichia pastoris phaff surface display expression plasmid p9KGCW19 obtains recombinating.With the p9KGCW19 plasmid transformation escherichia coli host Top10F that obtains.With the LB plate screening transformant of 50mg/L penbritin, the transformant of the picking amicillin resistance positive, extract plasmid, by
EcoRI and
NotThe I double digestion is identified also order-checking, and the result shows that wall-held protein GCW19 gene order correctly inserts.
Embodiment 3: the structure of pichia pastoris phaff wall-held protein GCW19 surface display carrier pZ α AGCW19
(1) clone of pichia pastoris phaff wall-held protein GCW19 gene
According to the multiple clone site feature on pichia pastoris phaff wall-held protein GCW19 gene order and the pichia pastoris phaff plasmid pPIC9K, the design synthetic primer:
P2：5’- TATTAT
GCGGCCGCTCAAATTAACATAGC -3’ (SEQ NO：3)
P4：5’ –ATAT
CTCGAGGAGCCAATCTTCAC -3’ (SEQ NO：6)
Primer P2 underscore partly is
NotThe I restriction enzyme site; Primer P4 underscore partly is
XhoThe I restriction enzyme site.Being template with pichia spp GS115 genomic dna, is primer with P2 and P4, amplifies wall-held protein GCW19 gene order by PCR method, and amplification condition is: 94 ℃ of pre-sex change 5 minutes; Carry out circulation below 30 again: 30 seconds, 55 ℃ annealing of 94 ℃ of sex change were extended 1 minute for 30 seconds, 72 ℃; Last 72 ℃ were extended 7 minutes.Obtain pichia pastoris phaff wall-held protein GCW19 gene fragment.
(2) structure of surface display expression vector pZ α AGCW19
The PCR product of wall-held protein GCW19 gene is used
XhoI and
NotThe product that I double digestion, enzyme are cut and pichia pastoris phaff expression plasmid pPICZ α A's
XhoI and
NotI double digestion product connects, and obtains recombinant yeast pichia pastoris surface display expression plasmid pZ α AGCW19.With the pZ α AGCW19 plasmid transformation escherichia coli host Top10F that obtains.With the LB plate screening transformant that contains 100mg/L Zeocin, the transformant of the picking Zeocin resistance positive, extract plasmid, by
XhoI and
NotThe I double digestion is identified also order-checking, and the result shows that wall-held protein GCW19 gene order correctly inserts.
Embodiment 4: the structure of pichia pastoris phaff wall-held protein GCW19 surface display carrier pG α AGCW19
(1) clone of pichia pastoris phaff wall-held protein GCW19 gene
According to the multiple clone site feature on pichia pastoris phaff wall-held protein GCW19 gene order and the pichia spp plasmid pPIC9K, the design synthetic primer:
P2：5’- TATTAT
GCGGCCGCTCAAATTAACATAGC -3’ (SEQ NO：3)
P4：5’ –ATAT
CTCGAGGAGCCAATCTTCAC -3’ (SEQ NO：6)
Primer P2 underscore partly is
NotThe I restriction enzyme site; Primer P4 underscore partly is
XhoThe I restriction enzyme site.Being template with pichia spp GS115 genomic dna, is primer with P2 and P4, amplifies wall-held protein GCW19 gene order by PCR method, and amplification condition is: 94 ℃ of pre-sex change 5 minutes; Carry out circulation below 30 again: 30 seconds, 55 ℃ annealing of 94 ℃ of sex change were extended 1 minute for 30 seconds, 72 ℃; Last 72 ℃ were extended 7 minutes.Obtain pichia pastoris phaff wall-held protein GCW19 gene fragment.
(2) structure of surface display expression vector pG α AGCW19
The PCR product of wall-held protein GCW19 gene is used
XhoI and
NotThe product that I double digestion, enzyme are cut and pichia pastoris phaff expression plasmid pGAPZ α A's
XhoI and
NotI double digestion product connects, and obtains recombinant yeast pichia pastoris surface display expression plasmid pG α AGCW19.With the pG α AGCW19 plasmid transformation escherichia coli host Top10F that obtains.With the LB plate screening transformant that contains 100mg/L Zeocin, the transformant of the picking Zeocin resistance positive, extract plasmid, by
XhoI and
NotThe I double digestion is identified also order-checking, and the result shows that wall-held protein GCW19 gene order correctly inserts.
Embodiment 5: utilize the p9KGCW19 surface display system to show candida antarctica lipase B
(1) clone of candida antarctica lipase B gene
According to the feature of the restriction endonuclease recognition sequence of the plasmid pKNS-CALB that contains candida antarctica lipase B (CALB, gene order is shown in SEQ NO:7) gene order, adopt
EcoRI and
MluI carries out double digestion, obtains the dna sequence dna of FLAG-CALB fusion rotein.
(2) utilize p9KGCW19 surface display expression vector at pichia pastoris phaff cell surface display candida antarctica lipase B
With the dna sequence dna of FLAG-CALB fusion rotein
EcoRI and
MluI double digestion product and p9KGCW19 carrier
EcoRI and
MluI double digestion product connects, and obtains recombinant plasmid p9KGCW19-CALB, transformed into escherichia coli host Top10F.The picking positive transformant extracts plasmid, by
EcoRI and
MluThe I double digestion is identified also order-checking, and sequencing result shows that wall-held protein CALB gene order correctly inserts.
Recombinant plasmid p9KGCW19-CALB is transformed pichia spp GS115, by MD plate screening transformant.Transformant behind MD flat board growth 48h, picking His at random
+Transformant is forwarded to tributyrin emulsification flat board and identifies.Positive transformant GS115/GCW19-CALB bacterium colony forms tangible hydrolysis circle (Fig. 3) at flat board, shows that CALB expresses in pichia pastoris phaff, and shows the lipase hydrolysis activity.
Positive transformant GS115/GCW19-CALB is inoculated in the 50mL BMGY substratum, 30 ℃, 200rpm shaking culture 16-20h to OD
600To 2-6.Centrifugal collection thalline is suspended in it in BMMY substratum again, is diluted to OD
600Be 1, continue shaking culture, add 1% methyl alcohol every 24h in the BMMY substratum and carry out abduction delivering.Behind the fermentation 96h, the centrifugal collection thalline of 10000rpm adopts β-1,3-dextran enzyme process method is extracted cell wall protein, carry out the SDS electrophoresis, and carry out Western blot checking with anti-FLAG antibody, the result shows that CALB successfully obtains showing at the pichia pastoris phaff cell surface.After carrying out immune response with anti-FLAG antibody, adopt fluorescent microscope that GS115/GCW19-CALB and control strain GS115 are analyzed comparison (Fig. 4), the result shows, the cell surface of GS115/GCW19-CALB can send tangible fluorescence, and the cell surface of contrast bacterium GS115 does not then almost have fluorescence.Show the fusion rotein of successfully having showed FLAG-CALB at the cell surface of GS115/GCW19-CALB.
(3) mensuration of the fermentation of positive transformant GS115/GCW19-CALB and lipase activity
Positive transformant GS115/GCW19-CALB is inoculated in the 50mL BMGY substratum, 30 ℃, 200rpm shaking culture 16-20h to OD
600To 2-6.Centrifugal collection thalline is suspended in it in BMMY substratum again, is diluted to OD
600Be 1, continue shaking culture, add 1% methyl alcohol every 24h in the BMMY substratum and carry out abduction delivering.Every 24h sampling utilizes the enzyme activity of spectrophotometry lipase: at 1mL 50mM Tris-HCl(pH 8.0), 1.25mM
pAdd 10 μ L thalline suspensions in the reaction system of NPB, 45 ℃ of reaction 5min measure OD
405Value.1 enzyme activity unit is defined as the per minute hydrolysis substrate and generates the required enzyme amount of 1 μ mol p-NP.
The result of lipase activity determination (Fig. 5) shows that the bacterial enzyme work of GS115/GCW19-CALB can reach 1349U/g along with the increase of fermentation time raises gradually to 96h, and the thalline of contrast bacterium GS115 does not then almost have enzyme to live.Show that CALB successfully is illustrated in the pichia pastoris phaff cell surface with activity form.
Embodiment 6: utilize p9KGCW19 surface display expression vector to show rhizomucor miehei lipase
(1) according to the sequence signature that contains the plasmid pKFS-RML of rhizomucor miehei lipase (RML) gene order, design and synthesize primer:
P5：GCGG
GAATTCG
ATTACAAGGATGATGACGATAAGGTTCCAATTAAGAGAC
AATCTAACT (SEQ NO：8)
P6：GCGC
ACGCGTAGTACACAAACCAGTGTTAATACCA (SEQ NO：9)
Wherein the P5 underscore partly is
EcoRI recognition site, italicized item are the FLAG sequence label; Underscore partly is among the P6
MluThe I site.Amplify the RML gene order by PCR method, amplification condition is: 94 ℃ of pre-sex change 5 minutes; Carry out circulation below 30 again: 30 seconds, 55 ℃ annealing of 94 ℃ of sex change were extended 1 minute 45 seconds for 1 minute, 72 ℃; Last 72 ℃ were extended 10 minutes.Obtain the FLAG-RML gene fragment.The order-checking structure shows that RML gene (SEQ NO:10) is correctly increased:
(2) utilize p9KGCW19 surface display expression vector at pichia pastoris phaff cell surface display RML
With the dna sequence dna of FLAG-RML fusion rotein
EcoRI and
MluI double digestion product and p9KGCW19 carrier
EcoRI and
MluI double digestion product connects, and obtains recombinant plasmid p9KGCW19-RML, transformed into escherichia coli host Top10F.The picking positive transformant extracts plasmid, by
EcoRI and
MluThe I double digestion is identified.Recombinant plasmid p9KGCW19-RML is transformed pichia spp GS115, by MD plate screening transformant.Transformant is behind MD flat board growth 48h, and picking part transformant is forwarded to tributyrin emulsification flat board and identifies at random.Form the positive transformant GS115/GCW19-RML of transformant of obvious hydrolysis circle at tributyrin emulsification flat board.
Embodiment 7: utilize p9KGCW19 surface display expression vector to show alkalescent xylanase
(1) according to the sequence signature that contains the plasmid pPIC9K-XYN of alkalescent xylanase gene (XYN) sequence, design and synthesize primer:
P7：CGT
GAATTCATGATTACTTTGTTTAAGAAGCC (SEQ NO：11)
P8：GAT
ACGCGTTTAATCAATAATTCTCCAG (SEQ NO：12)
Wherein the P7 underscore partly is
EcoRThe I recognition site; Underscore partly is among the P8
MluThe I site.Amplify the XYN gene order by PCR method, amplification condition is: 94 ℃ of pre-sex change 5 minutes; Carry out circulation below 35 again: 30 seconds, 55 ℃ annealing of 94 ℃ of sex change were extended 2 minutes for 1 minute, 72 ℃; Last 72 ℃ were extended 10 minutes.Obtain the XYN gene fragment.The order-checking structure shows that XYN gene (SEQ NO:13) is correctly increased:
(2) utilize p9KGCW19 surface display expression vector at pichia pastoris phaff cell surface display XYN
With the XYN sequence
EcoRI and
MluI double digestion product and p9KGCW19 carrier
EcoRI and
MluI double digestion product connects, and obtains recombinant plasmid p9KGCW19-XYN, transformed into escherichia coli host Top10F.The picking positive transformant extracts plasmid, by
EcoRI and
MluThe I double digestion is identified.Recombinant plasmid p9KGCW19-XYN is transformed pichia spp GS115, by MD plate screening transformant.Transformant is behind MD flat board growth 48h, and picking part transformant carries out bacterium colony PCR and order-checking evaluation p9KGCW19-XYN positive transformant at random.
Embodiment 8:
The effect of the pichia pastoris phaff surface display system that the pichia pastoris phaff surface display system that wall-held protein of the present invention is constructed and usefulness Pir albumen are constructed relatively.
1, experiment material
(1) the constructed pichia pastoris phaff surface display system of wall-held protein of the present invention:
GS115/GCW19-CALB, the preparation method is referring to embodiment 5.
(2) with the constructed pichia pastoris phaff surface display system of Pir albumen:
Anchorin among the GS115/GCW19-CALB is replaced with Pir1 or Pir2, obtains GS115/ Pir1-CALB and GS115/ Pir2-CALB, and method is as follows:
The structure of pZ α A/Pir1 and pZ α A/Pir2 expression vector: see for details Khasa YP report (Khasa YP, et al. Isolation of Pichia pastoris PIR genes and their utilization for cell surface display and recombinant protein secretion. Yeast. 2010. (published online).
The structure of pZ α A/Pir1-CALB and pZ α A/Pir2-CALB: CALB gene (SEQ NO:7) is inserted into respectively among pZ α A/Pir1 and the pZ α A/Pir2 (
Sfu1 He
Not1 double digestion).
GS115/ Pir1-CALB and GS115/ Pir2-CALB: pZ α A/Pir1-CALB and pZ α A/Pir2-CALB are transformed pichia spp GS115 respectively, with the YPD plate screening positive transformant that contains 100mg/L Zeocin.
2, experimental technique
GS115/GCW19-CALB, GS115/ Pir1-CALB and GS115/ Pir2-CALB behind the abduction delivering, measure the CALB enzyme of thalline and live in difference BMMY substratum, and method is referring to embodiment 5.
3, experimental result
The result as shown in Figure 6, the work of the bacterial enzyme of GS115/ Pir1-CALB and GS115/ Pir2-CALB only is 15.57% and 7.04% of GS115/GCW19-CALB.
SEQUENCE LISTING
＜110〉South China Science ﹠ Engineering University
＜120〉pichia spp wall-held protein Gcw19 and surface display system thereof and construction process
<130>
<160> 13
<170> PatentIn version 3.5
<210> 1
<211> 126
<212> PRT
＜213〉pichia pastoris phaff (Pichia pastoris)
<400> 1
Glu Pro Ile Phe Thr Asn Asp Val Asn Val Thr Val Pro Thr Val Pro
1 5 10 15
Pro Glu Ile Thr Ser Thr Pro Asp Val Ser Val Pro Gly Asn Leu Thr
20 25 30
Glu Thr Gly Gly Leu Thr Asn Thr Thr Gly Thr Gly Gly Phe Thr Asn
35 40 45
Thr Thr Ala Thr Gly Thr Gly Gly Phe Thr Asn Thr Thr Ala Thr Gly
50 55 60
Thr Gly Thr Gly Thr Gly Thr Gly Thr Gly Thr Gly Thr Gly Thr Gly
65 70 75 80
Thr Gly Thr Gly Thr Gly Thr Gly Thr Gly Thr Gly Thr Gly Thr Thr
85 90 95
Gly Thr Gly Thr Glu Thr Gly Asn Gly Ala Gln Ala Val Leu Gly Ser
100 105 110
Ser Val Leu Ala Ala Ala Gly Leu Phe Val Ala Met Leu Ile
115 120 125
<210> 2
<211> 53
<212> DNA
＜213〉artificial sequence
<400> 2
atatgaattc attacaagga tgacgacgat aagacgcgtg agccaatctt cac 53
<210> 3
<211> 29
<212> DNA
＜213〉artificial sequence
<400> 3
tattatgcgg ccgctcaaat taacatagc 29
<210> 4
<211> 381
<212> DNA
＜213〉pichia pastoris phaff (Pichia pastoris)
<400> 4
gagccaatct tcacaaatga tgtcaatgtc acagtcccca cggtgccacc agagatcact 60
tcaacccctg atgttagtgt tcctggaaac ttgaccgaaa ctggaggact cacaaacacc 120
acaggaacag gaggatttac taataccact gcaactggca caggaggttt cactaatacc 180
actgcaacag gcacgggcac aggcacaggc actggaaccg gaaccggcac aggcacaggc 240
acaggcacag gaactggcac tggaaccggt actggtactg gtaccactgg cacaggtaca 300
gaaactggta acggtgccca agcggtacta ggtagttcag tcttagccgc agctggtctc 360
ttcgtcgcta tgttaatttg a 381
<210> 5
<211> 30
<212> DNA
＜213〉artificial sequence
<400> 5
atatgaattc acgcgtgagc caatcttcac 30
<210> 6
<211> 24
<212> DNA
＜213〉artificial sequence
<400> 6
atatctcgag gagccaatct tcac 24
<210> 7
<211> 972
<212> DNA
＜213〉antarctic candida (Candida antarctica)
<400> 7
gccactcctt tggtgaagcg tctgccttcc ggttcggacc ctgccttttc gcagcccaag 60
tcggtgctcg atgcgggtct gacctgccag ggtgcttcgc catcctcggt ctccaaaccc 120
atccttctcg tccccggaac cggcaccaca ggtccacagt cgttcgactc gaactggatc 180
cccctctctg cgcagctggg ttacacaccc tgctggatct cacccccgcc gttcatgctc 240
aacgacaccc aggtcaacac ggagtacatg gtcaacgcca tcaccacgct ctacgctggt 300
tcgggcaaca acaagcttcc cgtgctcacc tggtcccagg gtggtctggt tgcacagtgg 360
ggtctgacct tcttccccag tatcaggtcc aaggtcgatc gacttatggc ctttgcgccc 420
gactacaagg gcaccgtcct cgccggccct ctcgatgcac tcgcggttag tgcaccctcc 480
gtatggcagc aaaccaccgg ttcggcactc actaccgcac tccgaaacgc aggtggtctg 540
acccagatcg tgcccaccac caacctctac tcggcgaccg acgagatcgt tcagcctcag 600
gtgtccaact cgccactcga ctcatcctac ctcttcaacg gaaagaacgt ccaggcacag 660
gctgtgtgtg ggccgctgtt cgtcatcgac catgcaggct cgctcacctc gcagttctcc 720
tacgtcgtcg gtcgatccgc cctgcgctcc accacgggcc aggctcgtag tgcagactat 780
ggcattacgg actgcaaccc tcttcccgcc aatgatctga ctcccgagca aaaggtcgcc 840
gcggctgcgc tcctggcgcc ggcggctgca gccatcgtgg cgggtccaaa gcagaactgc 900
gagcccgacc tcatgcccta cgcccgcccc tttgcagtag gcaaaaggac ctgctccggc 960
atcgtcaccc cc 972
<210> 8
<211> 59
<212> DNA
＜213〉artificial sequence
<400> 8
gcgggaattc gattacaagg atgatgacga taaggttcca attaagagac aatctaact 59
<210> 9
<211> 35
<212> DNA
＜213〉artificial sequence
<400> 9
gcgcacgcgt agtacacaaa ccagtgttaa tacca 35
<210> 10
<211> 1017
<212> DNA
＜213〉rice black root Mucor (Rhizomucor miehei)
<400> 10
gttccaatta agagacaatc taactctact gttgattctt tgccaccatt gattccatct 60
agaacttctg ctccatcttc ttctccatct actactgatc cagaagctcc agctatgtct 120
agaaacggtc cattgccatc tgatgttgaa actaagtacg gtatggcttt gaacgctact 180
tcttacccag atactgttgt tcaagctatg tctattgatg gtggtattag agctgctact 240
tctcaagaaa ttaacgaatt gacttactac actactttgt ctgctaactc ttactgtaga 300
actgttattc caggtgctac ttggggttgt attcattgtg atgctactga agatttgaag 360
attattaaga cttggtctac tttgatttac gatactaacg ctatggttgc tagaggtgat 420
tctgaaaaga ctatttacat tgtttttaga ggttcttctt ctattagaaa ctggattgct 480
gatttgactt ttgttccagt ttcttaccca ccagtttctg gtactaaggt tcataagggt 540
tttttggatt cttacggtga agttcaaaac gaattggttg ctactgtttt ggatcaattt 600
aagcaatacc catcttacaa ggttgctgtt actggtcatt ctttgggtgg tgctactgct 660
ttgttgtgtg ctttggattt gtaccaaaga gaagaaggtt tgtcttcttc taacttgttt 720
ttgtacactc aaggtcaacc aagagttggt gatccagctt ttgctaacta cgttgtttct 780
actggtattc catacagaag aactgttaac gaaagagata ttgttccaca tttgccacca 840
gctgcttttg gttttttgca tgctggtgaa gaatactgga ttactgataa ctctccagaa 900
actgttcaag tttgtacttc tgatttggaa acttctgatt gttctaactc tattgttcca 960
tttacttctg ttttggatca tttgtcttac tttggtatta acactggttt gtgtact 1017
<210> 11
<211> 32
<212> DNA
＜213〉artificial sequence
<400> 11
cgtgaattca tgattacttt gtttaagaag cc 32
<210> 12
<211> 28
<212> DNA
＜213〉artificial sequence
<400> 12
gatacgcgtt taatcaataa ttctccag 28
<210> 13
<211> 1188
<212> DNA
＜213〉subtilis (Bacillus subtilis)
<400> 13
atgattactt tgtttaagaa gccatttgtt gctggtttgg ctatttcttt gttggttggt 60
ggtggtttgg gtaacgttgc tgctgctcaa ggtggtccac caaagtctgg tgtttttggt 120
gaaaaccaaa agagaaacga tcaaccattt gcttggcaag ttgcttcttt gtctgaaaga 180
taccaagaac aatttgatat tggtgctgct gttgaaccat accaattgga aggtagacaa 240
gctcaaattt tgaagcatca ttacaactct ttggttgctg aaaacgctat gaagccagtt 300
tctttgcaac caagagaagg tgaatggaac tgggaaggtg ctgataagat tgttgaattt 360
gctagaaagc ataacatgga attgagattt catactttgg tttggcattc tcaagttcca 420
gaatggtttt ttattgatga aaacggtaac agaatggttg atgaaactga tccagaaaag 480
agaaaggcta acaagcaatt gttgttggaa agaatggaaa accatattaa gactgttgtt 540
gaaagataca aggatgatgt tacttcttgg gatgttgtta acgaagttat tgatgatggt 600
ggtggtttga gagaatctga atggtaccaa attactggta ctgattacat taaggttgct 660
tttgaaactg ctagaaagta cggtggtgaa gaagctaagt tgtacattaa cgattacaac 720
actgaagttc catctaagag agatgatttg tacaacttgg ttaaggattt gttggaacaa 780
ggtgttccaa ttgatggtgt tggtcatcaa tctcatattc aaattggttg gccatctatt 840
gaagatacta gagcttcttt tgaaaagttt acttctttgg gtttggataa ccaagttact 900
gaattggata tgtctttgta cggttggcca ccaactggtg cttacacttc ttacgatgat 960
attccagaag aattgtttca agctcaagct gatagatacg atcaattgtt tgaattgtac 1020
gaagaattgt ctgctactat ttcttctgtt actttttggg gtattgctga taaccatact 1080
tggttggatg atagagctag agaatacaac aacggtgttg gtgttgatgc tccatttgtt 1140
tttgatcata actacagagt taagccagct tactggagaa ttattgat 1188
Claims (4)
1. pichia pastoris phaff cell surface display system, it is characterized in that, be to be anchorin with pichia pastoris phaff wall-held protein Gcw19, target protein is fixed on the pichia pastoris phaff cell surface constitutes, the aminoacid sequence of described pichia pastoris phaff wall-held protein Gcw19 is shown in SEQ NO:1; Described target protein is alkalescent xylanase, rhizomucor miehei lipase or candida antarctica lipase B.
2. the construction process of the described pichia pastoris phaff cell surface display of claim 1 system, this method is made up of following steps:
(1) will encode the gene clone of pichia pastoris phaff wall-held protein Gcw19 in the expression cassette of the pichia pastoris phaff expression vector that has the secretion signal peptide sequence, obtaining with pichia pastoris phaff wall-held protein Gcw19 is the pichia pastoris phaff expression vector that has the secretion signal peptide sequence of anchorin, and the gene nucleotide series of described coding pichia pastoris phaff wall-held protein Gcw19 is shown in SEQ NO:4;
(2) gene order of target protein is cloned into the upstream of the pichia pastoris phaff wall-held protein gene order of the described pichia pastoris phaff expression vector that has a secretion signal peptide sequence, forms fusion gene with described pichia pastoris phaff wall-held protein gene;
(3) transform pichia pastoris phaff, according to the screening of the selection markers on described expression vector positive transformant, namely obtain surface display system.
3. construction process according to claim 2 is characterized in that, described expression vector is pPIC9K, pPICZ α A, pPICZ α B, pPICZ α C, pGAPZ α A, pGAPZ α B or pGAPZ α C.
4. according to the described construction process of one of claim 2～3, it is characterized in that described pichia pastoris phaff is pichia pastoris phaff GS115.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110215853 CN102276707B (en) | 2011-07-29 | 2011-07-29 | Pichia pastoris wall protein Gcw19 as well as surface display system and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110215853 CN102276707B (en) | 2011-07-29 | 2011-07-29 | Pichia pastoris wall protein Gcw19 as well as surface display system and construction method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102276707A CN102276707A (en) | 2011-12-14 |
| CN102276707B true CN102276707B (en) | 2013-09-25 |
Family
ID=45102485
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110215853 Expired - Fee Related CN102276707B (en) | 2011-07-29 | 2011-07-29 | Pichia pastoris wall protein Gcw19 as well as surface display system and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102276707B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105754916B (en) * | 2015-12-16 | 2019-06-07 | 中国人民解放军第三军医大学 | A kind of staphylococcus aureus film bubble display systems and its preparation method and application |
| CN108865912A (en) * | 2018-06-22 | 2018-11-23 | 华南理工大学 | A kind of methanol height tolerance pichia pastoris engineered strain and its construction method |
| CN111793568B (en) * | 2019-04-09 | 2024-03-26 | 上海自然堂集团有限公司 | Pichia pastoris and application thereof |
| JP2021090384A (en) * | 2019-12-10 | 2021-06-17 | 国立大学法人神戸大学 | Transformed yeast that expresses cellulase on cell surface layer |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101565713A (en) * | 2009-06-01 | 2009-10-28 | 华南理工大学 | Candida Antarctica lipase B gene and applications thereof in yeast display |
| WO2010069913A1 (en) * | 2008-12-16 | 2010-06-24 | Novartis Ag | Yeast display systems |
| CN101792721A (en) * | 2009-09-30 | 2010-08-04 | 华南理工大学 | Pichia pastoris engineering bacteria of surface display candida antarctica lipase B (CALB) and method for catalyzing and synthesizing short-chain aromatic ester |
| CN101945998A (en) * | 2008-02-20 | 2011-01-12 | 格利科菲公司 | Vectors and yeast strains for protein production |
-
2011
- 2011-07-29 CN CN 201110215853 patent/CN102276707B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101945998A (en) * | 2008-02-20 | 2011-01-12 | 格利科菲公司 | Vectors and yeast strains for protein production |
| WO2010069913A1 (en) * | 2008-12-16 | 2010-06-24 | Novartis Ag | Yeast display systems |
| CN101565713A (en) * | 2009-06-01 | 2009-10-28 | 华南理工大学 | Candida Antarctica lipase B gene and applications thereof in yeast display |
| CN101792721A (en) * | 2009-09-30 | 2010-08-04 | 华南理工大学 | Pichia pastoris engineering bacteria of surface display candida antarctica lipase B (CALB) and method for catalyzing and synthesizing short-chain aromatic ester |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102276707A (en) | 2011-12-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100547078C (en) | In the mutants of aspergillus that lacks enzyme, produce the method for biological substance | |
| CN102180954B (en) | Pichia pastoris wall protein and surface display system constructed by same and construction method of surface display system | |
| CN105802854B (en) | Cellulase high-yield strain and application thereof | |
| CN102276707B (en) | Pichia pastoris wall protein Gcw19 as well as surface display system and construction method thereof | |
| CN102260331B (en) | Pichia pastoris wall protein Gcw34, surface display system constructed by same and construction method of surface display system | |
| CN102260336B (en) | Pichia pastoris wall protein Gcw5, surface display system constructed by same and construction method of surface display system | |
| CN102276702B (en) | Pichia pastoris wall protein Gcw30 and surface display system and construction method thereof | |
| CN113106114A (en) | Factor for regulating and controlling trichoderma reesei protein expression efficiency, regulating and controlling method and application | |
| CN102260334B (en) | Pichia pastoris wall protein Gcw21 as well as surface display system and building method | |
| CN102276703B (en) | Pichia pastoris wall protein Gcw51, and surface display system and construction method thereof | |
| CN102260333B (en) | Pichia pastoris wall protein Gcw12, and surface display system and construction method thereof | |
| CN102276705B (en) | Pichia pastoris wall protein Gcw17, surface display system constructed by same and construction method of surface display system | |
| CN102260330B (en) | Pichia pastoris wall protein Gcw42, surface display system constructed by same and construction method of surface display system | |
| CN102276704B (en) | Pichia pastoris wall protein Gcw28, and surface display system and construction method thereof | |
| CN102260329B (en) | Pichia pastoris wall protein Gcw45, and surface display system and construction method thereof | |
| CN102260332B (en) | Pichia pastoris wall protein Gcw49, surface display system constructed by same and construction method of surface display system | |
| CN102260335B (en) | Pichia pastoris wall protein Gcw3, and surface display system and construction method thereof | |
| CN114634920B (en) | Recombinant pichia pastoris for producing human hyaluronidase PH20 and construction method thereof | |
| CN102276706B (en) | Pichia pastoris wall protein Gcw15, surface display system constructed by same and construction method of surface display system | |
| CN106636088B (en) | Application of yeast upstream activation element in filamentous fungi | |
| CN101157898A (en) | Schizosaccharomyces pombe engineering strain having cellulase activity and constructing method thereof | |
| JP2015012852A (en) | Method of producing biofuel comprising microalgae biomass as raw material | |
| JP2007517519A (en) | Ultrafast selection method of protein fusion factors for recombinant protein production and protein fusion factors selected thereby | |
| KR101412468B1 (en) | Mutant Beta-glucosidase with Advanced Activity and Process for Preparing Bio-ethanol Employing the Same | |
| CN113201055B (en) | Protein POX01387, and related biological material and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130925 Termination date: 20200729 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |