CN102276706B - Pichia pastoris wall protein Gcw15, surface display system constructed by same and construction method of surface display system - Google Patents

Abstract

The invention discloses a pichia pastoris wall protein, a surface display system constructed by the same and a construction method of the surface display system. The pichia pastoris wall protein is characterized in that the amino acid sequence of the protein is SEQNO:1. The pichia pastoris cell surface display system is characterized by being constructed by taking the pichia pastoris wall protein GCW15 as anchoring protein to fix target protein on the surface of a pichia pastoris cell. The pichia pastoris wall protein, the surface display system and the construction method have the following advantages and beneficial effects: the wall protein GCW15 has very high expression in pichia pastoris and the expression of the wall protein GCW15 is 10 times and 23 times higher than the expression of the existing endogenous anchoring proteins Pir1 and Pir2 for the pichia pastoris surface display system respectively.

Description

Pichia spp wall-held protein Gcw15 and surface display system thereof and construction process

Technical field

The present invention relates to biological technical field, be specifically related to surface display system and the construction process of a kind of pichia pastoris phaff wall-held protein Gcw15 and structure thereof.

Background technology

Microorganism cells surface display technology is a kind of technology of cell surface that protein or polypeptide is fixed on by anchorin.The microorganism cells surface display system comprises Host Strains, anchorin and target protein, sometimes between anchorin and target protein, also adds one section connection (linker) sequence.The microorganism cells surface display all has broad application prospects at aspects such as polypeptide separation, whole-cell catalyst, full cell sorbent material, vaccine and antibody producing, albumen library screening, biosensor, biological restoration.

In the microorganism surface display system, the many Host Strains of application mainly contain phage, bacterium (as intestinal bacteria at present escherichia. coli, proteus mirabilis proteus mirabilisdeng), yeast saccharomyces cerevisiae ( saccharomyces cerevisiae) and pichia pastoris phaff ( pichia pastoris).The anchorin that surface display is used generally has following characteristics: (1) is anchored on cell surface more securely, can from cell surface, not come off easily; (2) can not affect with the target protein sequence effective integration structure and function of target protein; (3) proteolytic enzyme is had to certain resistance.The anchorin of bacterium surface exhibiting system mainly contains bacterial pilli albumen, S layer albumen, ice nucleation protein (INP) and some outer membrane proteins.The anchorin of yeast saccharomyces cerevisiae surface display system mainly contains the lectin system, the prime system that flocculates is unified other GPI grappling (glycosylphosphatidylinositol anchored) protein system and some Pir protein systems.Pichia pastoris phaff has can realize that high density fermentation (cell density can up to 140g/L), albumen appropriateness glycosylation and fermention medium form the advantages such as simple, there is boundless prospect in the application aspect the microorganism cells surface display, at present existing many kinds of albumen, as Yarrowia lipolytica lipase, Kluyveromyces lactis yellow enzyme, Rhizopus oryzae lipase etc. successfully have been illustrated in the pichia pastoris phaff surface.The anchorin used in the pichia pastoris phaff surface display system at present is mainly from lectin system, the flocculation prime system of the yeast saccharomyces cerevisiae Sed1p albumen etc. of unifying.But these anchorins are not the moietys of pichia spp, but introduce by artificial means external source.Therefore the anchorin as the pichia spp surface display system with the external source wall-held protein, may compete the wall-held protein binding site with endogenous wall-held protein, causes showing that efficiency is not high.

Khasa YP (Khasa YP, et al. Isolation of Pichia pastoris PIR genes and their utilization for cell surface display and recombinant protein secretion. Yeast. 2010. (published online) .) etc. has reported and has utilized pichia spp Pir albumen to carry out the cell surface display of foreign protein as anchorin.But the contriver finds that the expression amount of Pir albumen itself is lower, general as the anchorin effect of pichia spp surface display system.

Summary of the invention

The technical problem to be solved in the present invention is the expression efficiency improved for the endogenous anchorin of pichia pastoris phaff surface display system.

The technical scheme that the present invention addresses the above problem is:

A kind of pichia pastoris phaff wall-held protein GCW15, the aminoacid sequence of this albumen is SEQ NO:1.

Pichia pastoris phaff wall-held protein of the present invention is comprised of 218 amino acid, and size is about 23.9KDa.Pichia pastoris phaff wall-held protein of the present invention is combined on the pichia pastoris phaff cell walls with the form of covalent linkage, by the sodium lauryl sulphate method, can not extract, and can extract by the beta-1,3-glucanase method.

Pichia pastoris phaff wall-held protein Gcw15 of the present invention can be used for building the Pichia pastoris surface display system, and described pichia pastoris phaff cell surface display system be take described wall-held protein and formed as anchorin is fixed on Pichia pastoris surface by target protein.

The encode gene of described pichia pastoris phaff wall-held protein GCW15, nucleotide sequence is as shown in SEQ NO:4.

A kind of pichia pastoris phaff cell surface display system, be that to take described pichia pastoris phaff wall-held protein Gcw15 be anchorin, target protein is fixed on to the pichia pastoris phaff cell surface forms.

Above-mentioned pichia pastoris phaff cell surface display system can build by following steps:

(1) by gene clone claimed in claim 2 in the expression cassette of expression vector, the surface display expression vector that to obtain take the described pichia pastoris phaff wall-held protein of claim 1 be anchorin;

(2) gene order of target protein is cloned into to the upstream of the pichia pastoris phaff wall-held protein gene order of described surface display expression vector, with described pichia pastoris phaff wall-held protein gene, forms fusion gene;

(3) transform pichia pastoris phaff, according to the screening of the selection markers on described expression vector positive transformant, obtain surface display system.

Described target protein is alkalescent xylanase, rhizomucor miehei lipase or candida antarctica lipase B.

Described pichia pastoris phaff is pichia pastoris phaff GS115.

In aforesaid method, described expression vector is the expression vector of the pichia pastoris phaff with the secretion signal peptide sequence of commonly using, as pPIC9K, pPICZ α A, pPICZ α B, pPICZ α C, pGAPZ α A, pGAPZ α B, pGAPZ α C etc.; If the expression vector of no signal peptide can add the secretion signal peptide sequence in the upstream of target protein gene order.

When expression vector is pPIC9K, after building the surface display expression vector, the gene order of target protein clone is connected to the restriction enzyme digestion sites of the pichia pastoris phaff wall-held protein gene order upstream of described surface display expression vector ecoRi with mlubetween I.

The advantage that the present invention has with respect to prior art and beneficial effect.

Wall-held protein Gcw15 of the present invention is the endogenous wall-held protein of pichia pastoris phaff, and expression amount is very high in pichia spp, with now for the endogenous anchorin Pir1 albumen of pichia pastoris phaff surface display system, with Pir2 albumen, compare, respectively high 10 times and 23 times.Therefore, pichia pastoris phaff of the present invention can be used for building the pichia pastoris phaff surface display system of high expression level efficiency.

The accompanying drawing explanation

Fig. 1.: the Western blot result of extracting pichia pastoris phaff wall-held protein Gcw15 by SDS method and beta-1,3-glucanase method.A. the SDS method is extracted wall-held protein Gcw15; B. the beta-1,3-glucanase method is extracted wall-held protein Gcw15.

Fig. 2: the flow cytometer detected result of recombinant bacterium GS115/GCW15 and contrast bacterium GS115.Dotted line: contrast bacterium GS115; Solid line: recombinant bacterium GS115/GCW15.

Fig. 3: the dull and stereotyped hydrolysis of tributyrin emulsification circle method detects the GS115/GCW15-CALB positive transformant.A. contrast bacterium GS115; B. positive transformant GS115/GCW15-CALB.

Fig. 4: fluorescent microscope checking fusion rotein GCW15-CALB shows result at the Pichia pastoris wall surface.A. the ordinary optical microgram of GS115/GCW15-CALB;

B. the fluorescence microscopy figure of GS115/GCW15-CALB;

C. contrast the ordinary optical microgram of bacterium GS115;

D. contrast the fluorescence microscopy figure of bacterium GS115.

Fig. 5: bacterial enzyme graphic representation alive.Wherein,

the bacterial enzyme curve alive that means recombinant bacterium GS115/GCW15-CALB;

the bacterial enzyme curve alive that means contrast bacterium GS115.

Fig. 6: adopt Gcw15, Pir1 and Pir2 to show that as anchorin the enzyme of CALB is relatively alive.

Terminological interpretation

MD flat board: 13.4g/L yeast nitrogen, 4 * 10 ^-4g/L vitamin H, 20g/L glucose and 20g/L agar

BMGY substratum: 20g/L peptone, 10g/L yeast extract, 100 mM potassium phosphate buffers (pH6.0), 13.4g/L yeast nitrogen, 4 * 10 ^-4the g/L vitamin H, 10g/L glycerine.

BMMY substratum: 20g/L peptone, 10g/L yeast extract, 100 mM potassium phosphate buffers (pH6.0), 13.4g/L yeast nitrogen, 4 * 10 ^-4the g/L vitamin H, 5g/L methyl alcohol.

Tributyrin emulsification flat board:: 13.4g/L yeast nitrogen, 10g/L tributyrin, 5g/L polyvinyl alcohol, 20g/L agar, 100mM phosphate buffered saline buffer (pH6.0).

Embodiment

Embodiment 1: clone, expression and the evaluation of pichia pastoris phaff wall-held protein GCW15 gene

(1) clone of pichia pastoris phaff wall-held protein GCW15 gene

According to the gene order SEQ NO.4 of pichia pastoris phaff wall-held protein GCW15 and the multiple clone site feature on the pichia pastoris phaff plasmid pPIC9K, the design synthetic primer:

Wherein primer P1 square frame is partly ecoRthe I restriction enzyme site, underscore is partly mluthe I restriction enzyme site, italicized item is the FLAG sequence label; Primer P2 underscore is partly notthe I restriction enzyme site.The pasteur Pichia pastoris GS115 genomic dna of take is template, take P1 and P2 as primer, by PCR method, amplifies wall-held protein GCW15 gene order, and amplification condition is: 94 ℃ of denaturations 5 minutes; Carry out again circulation below 30: 30 seconds, 72 ℃ extensions of 30 seconds, 55 ℃ annealing of 94 ℃ of sex change 1 minute; Last 72 ℃ are extended 7 minutes.

(2) structure of carrier p9KGCW15-FLAG

The PCR product of wall-held protein GCW15 gene is used ecoRi and notthe I double digestion, the product that enzyme is cut and pichia pastoris phaff expression plasmid pPIC9K's ecoRi and noti double digestion product connects, and obtains Recombinant Pichia pastoris surface display expression plasmid p9KGCW15.By the p9KGCW15 plasmid transformation escherichia coli host Top10F obtained.With the LB plate screening transformant containing the 50mg/L penbritin, the transformant of the picking amicillin resistance positive, extract plasmid, by ecoRi and notthe I double digestion identifies and checks order, and result shows that wall-held protein GCW15 gene order correctly inserts, and the FLAG label is in the upstream of described wall-held protein GCW15 gene.

(3) expression of pichia pastoris phaff wall-held protein GCW15 and evaluation

Adopt restriction enzyme sacafter I carries out linearizing to the p9KGCW15 plasmid, by the LiCl method, transform pichia pastoris phaff GS115, picking His on the MD flat board ⁺transformant, extract genomic dna as template, take P1, P2 as primer, carries out pcr amplification, and the gene order of result proof pichia pastoris phaff wall-held protein GCW15 has been incorporated in the genome of GS115, the recombinant bacterium called after GS115/ GCW15 obtained.GS115/ GCW15 is inoculated in 50mL BMGY substratum, 30 ℃, 200rpm shaking culture 16-20h to OD ₆₀₀to 2-6.Centrifugal collection thalline, then it is suspended in the BMMY substratum, be diluted to OD ₆₀₀be 1, continue shaking culture, every 24h, to the methyl alcohol of adding 1% in the BMMY substratum, carry out abduction delivering.After fermentation 96h, the centrifugal collection thalline of 10000 rpm, adopt β-1,3-dextran enzyme process extracts cell wall protein, carry out the SDS-PAGE electrophoresis, and carry out Western blot checking (Fig. 1) with anti-FLAG antibody, result shows that pichia pastoris phaff wall-held protein GCW15 is successfully expressed at the pichia pastoris phaff cell surface.After carrying out immune response with anti-FLAG antibody, adopt flow cytometer to analyze relatively (Fig. 2) to recombinant bacterium GS115/ GCW15 and GS115, result shows to be compared with GS115, larger skew occurs in the fluorescence of recombinant bacterium GS115/ GCW15, shows successfully to have expressed at the cell surface of recombinant bacterium GS115/ GCW15 the fusion rotein of pichia pastoris phaff wall-held protein GCW15-FLAG.

Embodiment 2: the structure of pichia pastoris phaff wall-held protein GCW15 surface display carrier p9KGCW15

(1) clone of pichia pastoris phaff wall-held protein GCW15 gene

According to the multiple clone site feature on pichia pastoris phaff wall-held protein GCW15 gene order and pichia pastoris phaff plasmid pPIC9K, the design synthetic primer:

Primer P2 underscore is partly notthe I restriction enzyme site; Primer P3 square frame is partly ecoRthe I restriction enzyme site, underscore is partly mluthe I restriction enzyme site.The pasteur Pichia pastoris GS115 genomic dna of take is template, take P2 and P3 as primer, by PCR method, amplifies wall-held protein GCW15 gene order, and amplification condition is: 94 ℃ of denaturations 5 minutes; Carry out again circulation below 30: 30 seconds, 72 ℃ extensions of 30 seconds, 55 ℃ annealing of 94 ℃ of sex change 1 minute; Last 72 ℃ are extended 7 minutes.Obtain pichia pastoris phaff wall-held protein GCW15 gene fragment.

(2) structure of surface display expression vector p9KGCW15

The PCR product of wall-held protein GCW15 gene is used ecoRi and notthe I double digestion, the product that enzyme is cut and pichia pastoris phaff expression plasmid pPIC9K's ecoRi and noti double digestion product connects, and obtains Recombinant Pichia pastoris surface display expression plasmid p9KGCW15.By the p9KGCW15 plasmid transformation escherichia coli host Top10F obtained.With the LB plate screening transformant of 50mg/L penbritin, the transformant of the picking amicillin resistance positive, extract plasmid, by ecoRi and notthe I double digestion identifies and checks order, and result shows that wall-held protein GCW15 gene order correctly inserts.

Embodiment 3: the structure of pichia pastoris phaff wall-held protein GCW15 surface display carrier pZ α AGCW15

(1) clone of pichia pastoris phaff wall-held protein GCW15 gene

According to the multiple clone site feature on pichia pastoris phaff wall-held protein GCW15 gene order and pichia pastoris phaff plasmid pPIC9K, the design synthetic primer:

P2：5’- TATTAT GCGGCCGC TTATACAACGATTGTGCTC -3’ (SEQ NO：3)

P4：5’ –GAGT CTCGAGAAAGAGCCGTTTGAAATT -3’ (SEQ NO：6)

Primer P2 underscore is partly notthe I restriction enzyme site; Primer P4 underscore is partly xhothe I restriction enzyme site.Take the Pichia pastoris GS115 genomic dna as template, take P2 and P4 as primer, by PCR method, amplify wall-held protein GCW15 gene order, amplification condition is: 94 ℃ of denaturations 5 minutes; Carry out again circulation below 30: 30 seconds, 72 ℃ extensions of 30 seconds, 55 ℃ annealing of 94 ℃ of sex change 1 minute; Last 72 ℃ are extended 7 minutes.Obtain pichia pastoris phaff wall-held protein GCW15 gene fragment.

(2) structure of surface display expression vector pZ α AGCW15

The PCR product of wall-held protein GCW15 gene is used xhoi and notthe I double digestion, the product that enzyme is cut and pichia pastoris phaff expression plasmid pPICZ α A's xhoi and noti double digestion product connects, and obtains recombinant yeast pichia pastoris surface display expression plasmid pZ α AGCW15.By the pZ α AGCW15 plasmid transformation escherichia coli host Top10F obtained.With the LB plate screening transformant containing 100mg/L Zeocin, the transformant of the picking Zeocin resistance positive, extract plasmid, by xhoi and notthe I double digestion identifies and checks order, and result shows that wall-held protein GCW15 gene order correctly inserts.

Embodiment 4: the structure of pichia pastoris phaff wall-held protein GCW15 surface display carrier pG α AGCW15

(1) clone of pichia pastoris phaff wall-held protein GCW15 gene

According to the multiple clone site feature on pichia pastoris phaff wall-held protein GCW15 gene order and pichia spp plasmid pPIC9K, the design synthetic primer:

P2：5’- TATTAT GCGGCCGC TTATACAACGATTGTGCTC -3’ (SEQ NO：3)

P4：5’ –GAGT CTCGAGAAAGAGCCGTTTGAAATT -3’ (SEQ NO：6)

Primer P2 underscore is partly notthe I restriction enzyme site; Primer P4 underscore is partly xhothe I restriction enzyme site.Take the Pichia pastoris GS115 genomic dna as template, take P2 and P4 as primer, by PCR method, amplify wall-held protein GCW15 gene order, amplification condition is: 94 ℃ of denaturations 5 minutes; Carry out again circulation below 30: 30 seconds, 72 ℃ extensions of 30 seconds, 55 ℃ annealing of 94 ℃ of sex change 1 minute; Last 72 ℃ are extended 7 minutes.Obtain pichia pastoris phaff wall-held protein GCW15 gene fragment.

(2) structure of surface display expression vector pG α AGCW15

The PCR product of wall-held protein GCW15 gene is used xhoi and notthe I double digestion, the product that enzyme is cut and pichia pastoris phaff expression plasmid pGAPZ α A's xhoi and noti double digestion product connects, and obtains recombinant yeast pichia pastoris surface display expression plasmid pG α AGCW15.By the pG α AGCW15 plasmid transformation escherichia coli host Top10F obtained.With the LB plate screening transformant containing 100mg/L Zeocin, the transformant of the picking Zeocin resistance positive, extract plasmid, by xhoi and notthe I double digestion identifies and checks order, and result shows that wall-held protein GCW15 gene order correctly inserts.

Embodiment 5: utilize the p9KGCW15 surface display system to show candida antarctica lipase B

(1) clone of candida antarctica lipase B gene

According to the feature of the restriction endonuclease recognition sequence of the plasmid pKNS-CALB that contains candida antarctica lipase B (CALB, gene order is as shown in SEQ NO:7) gene order, adopt ecoRi and mlui carries out double digestion, obtains the DNA sequence dna of FLAG-CALB fusion rotein.

(2) utilize p9KGCW15 surface display expression vector at pichia pastoris phaff cell surface display candida antarctica lipase B

By the DNA sequence dna of FLAG-CALB fusion rotein ecoRi and mlui double digestion product and p9KGCW15 carrier ecoRi and mlui double digestion product connects, and obtains recombinant plasmid p9KGCW15-CALB, transforms escherichia coli host Top10F.The picking positive transformant extracts plasmid, by ecoRi and mluthe I double digestion identifies and checks order, and sequencing result shows that wall-held protein CALB gene order correctly inserts.

Recombinant plasmid p9KGCW15-CALB is transformed to Pichia pastoris GS115, by MD plate screening transformant.Transformant is grown after 48h on the MD flat board, random picking His ⁺transformant is forwarded to tributyrin emulsification flat board and is identified.Positive transformant GS115/GCW15-CALB bacterium colony forms significantly hydrolysis circle (Fig. 3) on flat board, shows that CALB expresses in pichia pastoris phaff, and shows the lipase hydrolysis activity.

Positive transformant GS115/GCW15-CALB is inoculated in 50mL BMGY substratum, 30 ℃, 200rpm shaking culture 16-20h to OD ₆₀₀to 2-6.Centrifugal collection thalline, then it is suspended in the BMMY substratum, be diluted to OD ₆₀₀be 1, continue shaking culture, every 24h, to the methyl alcohol of adding 1% in the BMMY substratum, carry out abduction delivering.After fermentation 96h, the centrifugal collection thalline of 10000rpm, adopt β-1,3-dextran enzyme process method is extracted cell wall protein, carry out the SDS electrophoresis, and carry out Western blot checking with anti-FLAG antibody, result shows that CALB is successfully showed at the pichia pastoris phaff cell surface.After carrying out immune response with anti-FLAG antibody, adopt fluorescent microscope to analyze relatively (Fig. 4) to GS115/GCW15-CALB and control strain GS115, result shows, the cell surface of GS115/GCW15-CALB can send obvious fluorescence, and the cell surface of contrast bacterium GS115 does not almost have fluorescence.Show successfully to have showed at the cell surface of GS115/GCW15-CALB the fusion rotein of FLAG-CALB.

(3) mensuration of the fermentation of positive transformant GS115/GCW15-CALB and lipase activity

Positive transformant GS115/GCW15-CALB is inoculated in 50mL BMGY substratum, 30 ℃, 200rpm shaking culture 16-20h to OD ₆₀₀to 2-6.Centrifugal collection thalline, then it is suspended in the BMMY substratum, be diluted to OD ₆₀₀be 1, continue shaking culture, every 24h, to the methyl alcohol of adding 1% in the BMMY substratum, carry out abduction delivering.Every 24h sampling, utilize the enzyme activity of spectrophotometry lipase: at 1mL 50mM Tris-HCl(pH 8.0), 1.25mM padd 10 μ L thalline suspensions in the reaction system of NPB, 45 ℃ of reaction 5min, measure OD ₄₀₅value.1 enzyme activity unit is defined as the per minute hydrolysis substrate and generates the required enzyme amount of 1 μ mol p-NP.

The result of lipase activity determination (Fig. 5) demonstration, the bacterial enzyme work of GS115/GCW15-CALB, along with the increase of fermentation time raises gradually, can reach 2191U/g to 120h, and the thalline of contrast bacterium GS115 does not almost have enzyme to live.Show that CALB successfully is illustrated in the pichia pastoris phaff cell surface with activity form.

Embodiment 6: utilize p9KGCW15 surface display expression vector to show rhizomucor miehei lipase

(1) according to the sequence signature of the plasmid pKFS-RML that contains rhizomucor miehei lipase (RML) gene order, design and synthesize primer:

P5：GCGG GAATTCG ATTACAAGGATGATGACGATAAGGTTCCAATTAAGAGAC

AATCTAACT (SEQ NO：8)

P6：GCGC ACGCGTAGTACACAAACCAGTGTTAATACCA (SEQ NO：9)

Wherein the P5 underscore is partly ecoRthe I recognition site, italicized item is the FLAG sequence label; In P6, underscore is partly mluthe I site.Amplify the RML gene order by PCR method, amplification condition is: 94 ℃ of denaturations 5 minutes; Carry out again circulation below 30: 1 minute, 72 ℃ extensions of 30 seconds, 55 ℃ annealing of 94 ℃ of sex change 1 minute 45 seconds; Last 72 ℃ are extended 10 minutes.Obtain the FLAG-RML gene fragment.The order-checking structure shows that RML gene (SEQ NO:10) is correctly increased:

(2) utilize p9KGCW15 surface display expression vector at pichia pastoris phaff cell surface display RML

By the DNA sequence dna of FLAG-RML fusion rotein ecoRi and mlui double digestion product and p9KGCW15 carrier ecoRi and mlui double digestion product connects, and obtains recombinant plasmid p9KGCW15-RML, transforms escherichia coli host Top10F.The picking positive transformant extracts plasmid, by ecoRi and mluthe I double digestion is identified.Recombinant plasmid p9KGCW15-RML is transformed to Pichia pastoris GS115, by MD plate screening transformant.Transformant is grown after 48h on the MD flat board, and random picking Partial Conversion is forwarded to tributyrin emulsification flat board and is identified.Form the obviously positive transformant GS115/GCW15-RML of transformant of hydrolysis circle on tributyrin emulsification flat board.

Embodiment 7: utilize p9KGCW15 surface display expression vector to show alkalescent xylanase

(1) according to the sequence signature of the plasmid pPIC9K-XYN that contains alkalescent xylanase gene (XYN) sequence, design and synthesize primer:

P7：CGT GAATTCATGATTACTTTGTTTAAGAAGCC (SEQ NO：11)

P8：GAT ACGCGTTTAATCAATAATTCTCCAG (SEQ NO：12)

Wherein the P7 underscore is partly ecoRthe I recognition site; In P8, underscore is partly mluthe I site.Amplify the XYN gene order by PCR method, amplification condition is: 94 ℃ of denaturations 5 minutes; Carry out again circulation below 35: 1 minute, 72 ℃ extensions of 30 seconds, 55 ℃ annealing of 94 ℃ of sex change 2 minutes; Last 72 ℃ are extended 10 minutes.Obtain the XYN gene fragment.The order-checking structure shows that XYN gene (SEQ NO:13) is correctly increased:

(2) utilize p9KGCW15 surface display expression vector at pichia pastoris phaff cell surface display XYN

By the XYN sequence ecoRi and mlui double digestion product and p9KGCW15 carrier ecoRi and mlui double digestion product connects, and obtains recombinant plasmid p9KGCW15-XYN, transforms escherichia coli host Top10F.The picking positive transformant extracts plasmid, by ecoRi and mluthe I double digestion is identified.Recombinant plasmid p9KGCW15-XYN is transformed to Pichia pastoris GS115, by MD plate screening transformant.Transformant is grown after 48h on the MD flat board, and random picking Partial Conversion carries out bacterium colony PCR and the p9KGCW15-XYN positive transformant is identified in order-checking.

Embodiment 8:

The effect of the pichia pastoris phaff surface display system that the pichia pastoris phaff surface display system that wall-held protein of the present invention is constructed and use Pir albumen are constructed relatively.

1, experiment material

(1) the constructed pichia pastoris phaff surface display system of wall-held protein of the present invention:

GS115/GCW15-CALB, the preparation method is referring to embodiment 5.

(2) with the constructed pichia pastoris phaff surface display system of Pir albumen:

Anchorin in GS115/GCW15-CALB is replaced with Pir1 or Pir2, obtains GS115/ Pir1-CALB and GS115/ Pir2-CALB, and method is as follows:

The structure of pZ α A/Pir1 and pZ α A/Pir2 expression vector: refer to Khasa YP report (Khasa YP, et al. Isolation of Pichia pastoris PIR genes and their utilization for cell surface display and recombinant protein secretion. Yeast. 2010. (published online).

The structure of pZ α A/Pir1-CALB and pZ α A/Pir2-CALB: CALB gene (SEQ NO:7) is inserted into respectively in pZ α A/Pir1 and pZ α A/Pir2 ( sfu1 He not1 double digestion).

GS115/ Pir1-CALB and GS115/ Pir2-CALB: pZ α A/Pir1-CALB and pZ α A/Pir2-CALB are transformed respectively to Pichia pastoris GS115, with the YPD plate screening positive transformant containing 100mg/L Zeocin.

2, experimental technique

GS115/GCW15-CALB, GS115/ Pir1-CALB and GS115/ Pir2-CALB after abduction delivering, measure the CALB enzyme of thalline and live in difference BMMY substratum, and method is referring to embodiment 5.

3, experimental result

As shown in Figure 6, the work of the bacterial enzyme of GS115/ Pir1-CALB and GS115/ Pir2-CALB is only 9.58% and 4.34% of GS115/GCW15-CALB to result.

SEQUENCE LISTING

<110 > South China Science & Engineering University

<120 > pichia spp wall-held protein Gcw15 and surface display system thereof and construction process

<130>

<160> 13

<170> PatentIn version 3.5

<210> 1

<211> 218

<212> PRT

<213 > pichia pastoris phaff (Pichia pastoris)

<400> 1

Lys Glu Pro Phe Glu Ile Asn Gly Phe Asp Ser His Asp Lys Cys Asn

1 5 10 15

Asn Gln Asp Leu Ala Val Leu Asn His Cys Ala Lys Glu Val Leu Lys

20 25 30

Lys Leu Asp Gln Cys Gly Ala Asp Asp Leu Ala Cys Glu Cys Cys Ala

35 40 45

Leu Gln Ser Leu Lys His Val Cys Tyr Asp Leu Cys Ser Asp Ser Phe

50 55 60

Ser Ser Asn Phe Leu Asn Val Leu Tyr Glu Asp Cys Glu Pro Phe Lys

65 70 75 80

Glu Val Asn Ala Cys Ser Phe Gln Phe Lys Glu Lys Asp Tyr Ala Ser

85 90 95

Ala Ile Gly Ser Lys Lys Asn Lys Lys Thr Lys Asn Ser Val Leu Lys

100 105 110

Met Asp Gly Ser Lys Ile Val Ser Gly Asn Arg Ser Val Ser Gln Gly

115 120 125

Ser Thr Thr Ser Lys Val Pro Phe Ile Thr Lys Gly Lys Tyr Lys Thr

130 135 140

Glu Ala Gln Lys Asn Arg Ser Arg Asp Ser Thr Pro Pro Gly Leu Gln

145 150 155 160

Val Lys Asp Asp Ser Arg Val Ser Pro Asp Gly Lys Phe Leu Gln Gly

165 170 175

Ser Thr Tyr Asn His Thr Asn Thr Ser Asn Thr Thr Val Ser Lys Gln

180 185 190

Asp Leu Ser Ser Ser Val Arg Leu Leu Pro Lys Val Leu Ala Leu Met

195 200 205

Leu Gly Thr Leu Val Ser Thr Ile Val Val

210 215

<210> 2

<211> 57

<212> DNA

<213 > artificial sequence

<400> 2

gagtgaattc attacaagga tgacgacgat aagacgcgta aagagccgtt tgaaatt 57

<210> 3

<211> 33

<212> DNA

<213 > artificial sequence

<400> 3

tattatgcgg ccgcttatac aacgattgtg ctc 33

<210> 4

<211> 657

<212> DNA

<213 > pichia pastoris phaff (Pichia pastoris)

<400> 4

aaagagccgt ttgaaattaa tggttttgat tctcatgaca aatgcaataa ccaagacttg 60

gctgtgctga accattgtgc caaggaagtt ctcaaaaagc tggatcaatg tggagctgat 120

gatctggcgt gtgaatgctg cgccttgcaa tcattaaagc acgtttgtta tgacttgtgt 180

tccgattctt tttcaagtaa ctttttaaat gttttgtatg aagattgtga acctttcaag 240

gaagtaaatg cctgcagttt tcaattcaaa gaaaaagact atgcatccgc cataggatca 300

aaaaagaaca aaaagactaa aaactcagtc ttgaaaatgg atgggtccaa gattgtatct 360

ggaaacagat cagtgagcca aggatcgacc acttccaaag ttccctttat cacaaaagga 420

aaatataaaa cagaggccca aaaaaataga tctagggatt cgacgcctcc aggactacag 480

gttaaagatg atagcagagt tagcccagac ggtaaattct tgcaaggttc tacttataac 540

cacaccaaca catcaaatac aacagtgagc aagcaggatt tgtcctcatc agttagactc 600

ctaccaaaag tgttagcatt gatgcttggt acattggtga gcacaatcgt tgtataa 657

<210> 5

<211> 34

<212> DNA

<213 > artificial sequence

<400> 5

gagtgaattc acgcgtaaag agccgtttga aatt 34

<210> 6

<211> 28

<212> DNA

<213 > artificial sequence

<400> 6

gagtctcgag aaagagccgt ttgaaatt 28

<210> 7

<211> 972

<212> DNA

<213 > antarctic candida (Candida antarctica)

<400> 7

gccactcctt tggtgaagcg tctgccttcc ggttcggacc ctgccttttc gcagcccaag 60

tcggtgctcg atgcgggtct gacctgccag ggtgcttcgc catcctcggt ctccaaaccc 120

atccttctcg tccccggaac cggcaccaca ggtccacagt cgttcgactc gaactggatc 180

cccctctctg cgcagctggg ttacacaccc tgctggatct cacccccgcc gttcatgctc 240

aacgacaccc aggtcaacac ggagtacatg gtcaacgcca tcaccacgct ctacgctggt 300

tcgggcaaca acaagcttcc cgtgctcacc tggtcccagg gtggtctggt tgcacagtgg 360

ggtctgacct tcttccccag tatcaggtcc aaggtcgatc gacttatggc ctttgcgccc 420

gactacaagg gcaccgtcct cgccggccct ctcgatgcac tcgcggttag tgcaccctcc 480

gtatggcagc aaaccaccgg ttcggcactc actaccgcac tccgaaacgc aggtggtctg 540

acccagatcg tgcccaccac caacctctac tcggcgaccg acgagatcgt tcagcctcag 600

gtgtccaact cgccactcga ctcatcctac ctcttcaacg gaaagaacgt ccaggcacag 660

gctgtgtgtg ggccgctgtt cgtcatcgac catgcaggct cgctcacctc gcagttctcc 720

tacgtcgtcg gtcgatccgc cctgcgctcc accacgggcc aggctcgtag tgcagactat 780

ggcattacgg actgcaaccc tcttcccgcc aatgatctga ctcccgagca aaaggtcgcc 840

gcggctgcgc tcctggcgcc ggcggctgca gccatcgtgg cgggtccaaa gcagaactgc 900

gagcccgacc tcatgcccta cgcccgcccc tttgcagtag gcaaaaggac ctgctccggc 960

atcgtcaccc cc 972

<210> 8

<211> 59

<212> DNA

<213 > artificial sequence

<400> 8

gcgggaattc gattacaagg atgatgacga taaggttcca attaagagac aatctaact 59

<210> 9

<211> 35

<212> DNA

<213 > artificial sequence

<400> 9

gcgcacgcgt agtacacaaa ccagtgttaa tacca 35

<210> 10

<211> 1017

<212> DNA

<213 > rhizomucor miehei (Rhizomucor miehei)

<400> 10

gttccaatta agagacaatc taactctact gttgattctt tgccaccatt gattccatct 60

agaacttctg ctccatcttc ttctccatct actactgatc cagaagctcc agctatgtct 120

agaaacggtc cattgccatc tgatgttgaa actaagtacg gtatggcttt gaacgctact 180

tcttacccag atactgttgt tcaagctatg tctattgatg gtggtattag agctgctact 240

tctcaagaaa ttaacgaatt gacttactac actactttgt ctgctaactc ttactgtaga 300

actgttattc caggtgctac ttggggttgt attcattgtg atgctactga agatttgaag 360

attattaaga cttggtctac tttgatttac gatactaacg ctatggttgc tagaggtgat 420

tctgaaaaga ctatttacat tgtttttaga ggttcttctt ctattagaaa ctggattgct 480

gatttgactt ttgttccagt ttcttaccca ccagtttctg gtactaaggt tcataagggt 540

tttttggatt cttacggtga agttcaaaac gaattggttg ctactgtttt ggatcaattt 600

aagcaatacc catcttacaa ggttgctgtt actggtcatt ctttgggtgg tgctactgct 660

ttgttgtgtg ctttggattt gtaccaaaga gaagaaggtt tgtcttcttc taacttgttt 720

ttgtacactc aaggtcaacc aagagttggt gatccagctt ttgctaacta cgttgtttct 780

actggtattc catacagaag aactgttaac gaaagagata ttgttccaca tttgccacca 840

gctgcttttg gttttttgca tgctggtgaa gaatactgga ttactgataa ctctccagaa 900

actgttcaag tttgtacttc tgatttggaa acttctgatt gttctaactc tattgttcca 960

tttacttctg ttttggatca tttgtcttac tttggtatta acactggttt gtgtact 1017

<210> 11

<211> 32

<212> DNA

<213 > artificial sequence

<400> 11

cgtgaattca tgattacttt gtttaagaag cc 32

<210> 12

<211> 28

<212> DNA

<213 > artificial sequence

<400> 12

gatacgcgtt taatcaataa ttctccag 28

<210> 13

<211> 1188

<212> DNA

<213 > subtilis (Bacillus subtilis)

<400> 13

atgattactt tgtttaagaa gccatttgtt gctggtttgg ctatttcttt gttggttggt 60

ggtggtttgg gtaacgttgc tgctgctcaa ggtggtccac caaagtctgg tgtttttggt 120

gaaaaccaaa agagaaacga tcaaccattt gcttggcaag ttgcttcttt gtctgaaaga 180

taccaagaac aatttgatat tggtgctgct gttgaaccat accaattgga aggtagacaa 240

gctcaaattt tgaagcatca ttacaactct ttggttgctg aaaacgctat gaagccagtt 300

tctttgcaac caagagaagg tgaatggaac tgggaaggtg ctgataagat tgttgaattt 360

gctagaaagc ataacatgga attgagattt catactttgg tttggcattc tcaagttcca 420

gaatggtttt ttattgatga aaacggtaac agaatggttg atgaaactga tccagaaaag 480

agaaaggcta acaagcaatt gttgttggaa agaatggaaa accatattaa gactgttgtt 540

gaaagataca aggatgatgt tacttcttgg gatgttgtta acgaagttat tgatgatggt 600

ggtggtttga gagaatctga atggtaccaa attactggta ctgattacat taaggttgct 660

tttgaaactg ctagaaagta cggtggtgaa gaagctaagt tgtacattaa cgattacaac 720

actgaagttc catctaagag agatgatttg tacaacttgg ttaaggattt gttggaacaa 780

ggtgttccaa ttgatggtgt tggtcatcaa tctcatattc aaattggttg gccatctatt 840

gaagatacta gagcttcttt tgaaaagttt acttctttgg gtttggataa ccaagttact 900

gaattggata tgtctttgta cggttggcca ccaactggtg cttacacttc ttacgatgat 960

attccagaag aattgtttca agctcaagct gatagatacg atcaattgtt tgaattgtac 1020

gaagaattgt ctgctactat ttcttctgtt actttttggg gtattgctga taaccatact 1080

tggttggatg atagagctag agaatacaac aacggtgttg gtgttgatgc tccatttgtt 1140

tttgatcata actacagagt taagccagct tactggagaa ttattgat 1188

Claims (5)

1. a pichia pastoris phaff cell surface display system, is characterized in that, is that to take pichia pastoris phaff wall-held protein Gcw15 be anchorin, target protein is fixed on to the pichia pastoris phaff cell surface forms; The aminoacid sequence of described pichia pastoris phaff wall-held protein Gcw15 is as shown in SEQ NO:1.

2. the construction process of pichia pastoris phaff cell surface display system claimed in claim 1, the method is comprised of following steps:

(1) will encode the gene clone of pichia pastoris phaff wall-held protein GCW15 in the expression cassette of expression vector, the surface display expression vector that to obtain take described pichia pastoris phaff wall-held protein be anchorin; Described expression vector is the pichia pastoris phaff expression vector with the secretion signal peptide sequence; The nucleotide sequence of the gene of described coding pichia pastoris phaff wall-held protein GCW15 is as shown in SEQ NO:4;

(2) gene order of target protein is cloned into to the upstream of the pichia pastoris phaff wall-held protein gene order of described surface display expression vector, with described pichia pastoris phaff wall-held protein gene, forms fusion gene;

(3) transform pichia pastoris phaff, according to the screening of the selection markers on described expression vector positive transformant, obtain surface display system.

3. construction process according to claim 2, is characterized in that, described expression vector is pPIC9K, pPICZ α A, pPICZ α B, pPICZ α C, pGAPZ α A, pGAPZ α B or pGAPZ α C.

4. according to the described construction process of claim 2 or 3, it is characterized in that, described target protein is alkalescent xylanase, rhizomucor miehei lipase or candida antarctica lipase B.

5. according to the described construction process of claim 2 or 3, it is characterized in that, described pichia pastoris phaff is pichia pastoris phaff GS115.

Images