CN102251050A - Reagent for detecting cell apoptosis signal path and PCR method using same - Google Patents
Reagent for detecting cell apoptosis signal path and PCR method using same Download PDFInfo
- Publication number
- CN102251050A CN102251050A CN2011102282070A CN201110228207A CN102251050A CN 102251050 A CN102251050 A CN 102251050A CN 2011102282070 A CN2011102282070 A CN 2011102282070A CN 201110228207 A CN201110228207 A CN 201110228207A CN 102251050 A CN102251050 A CN 102251050A
- Authority
- CN
- China
- Prior art keywords
- gene
- primer
- pcr
- follows
- detects
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a reagent for detecting a cell apoptosis signal path and a PCR (polymerase chain reaction) method using the same. The detection reagent comprises PCR primers for detecting expression of BAX gene, ANGPTL4 gene, IL1A gene, MYBL2 gene, PEA15 gene, PRKAA1 gene, BIRC5 gene, CASP1 gene, DAPK3 gene, NUDT2 gene and reference GAPDH control gene. In the invention, cell apoptosis related signal molecules are concentrated on a plate, real-time fluorescent quantitative PCR is carried out once to reflect the survival conditions of the cells and discuss the possible ways for causing cell apoptosis, thereby providing the most direct evidence for researching the apoptosis signal path of the key protein. The invention quickly and accurately finds out the related apoptosis signal path on the transcription level, thereby providing a powerful tool for screening anticancer drugs, discussing new targeting drug mechanisms and the like.
Description
Technical field
The invention belongs to biology field, relate in particular to a kind of reagent and PCR detection method thereof that detects apoptosis pathway.
Background technology
Apoptosis is a kind of programmed cell death process of being regulated of being brought out by dead signal in essence, is the common form of cell physiological death.Be body under physiology or pathological conditions, start self internal mechanism, through multipath signal transmission, finish the process of himself life.Apoptosis has distinctive morphology and biological chemistry changes.Apoptosis mainly shows as the kytoplasm cavity in early days, and chromatin concentrates and arranges along nuclear membrane; Apoptotic cell separates with extracellular matrix or peripheral cell.Along with the progress of apoptotic process, kytoplasm cavity and after birth merge, and cause the film foaming, and cavity and cellular segregation cause loss of moist subsequently, cell shrinkage, and carrying out property of chromatin pyknosis simultaneously, and be fragmented into lumphy structure, last cell also is fragmented into apoptotic body.The apoptosis of inducing tumor cell has become a kind of key means of treatment tumour at present.But apoptosis has complicated signal pathway, how can be from numerous and jumbled apoptosis signal pathway, thereby find out clear and definite apoptotic signal approach exploitation tumour related drugs, so that the apoptosis of further inducing tumor cell has become tumour medicine now and has researched and developed the major issue that the urgent need in field solves.
Summary of the invention
The present invention is directed to the difficulty that inducing apoptosis of tumour cell runs in the prior art, a kind of reagent and PCR detection method thereof that detects apoptosis pathway is provided, the present invention will be referred to apoptotic signaling molecule and concentrates on the flat board, by doing a real-time fluorescence quantitative PCR reaction, the survival condition of reacting cells, discussion causes apoptotic possibility approach, for the apoptotic signal path of studying key protein provides the most direct evidence.
For achieving the above object, the present invention adopts following technical proposals to be achieved:
A kind of reagent that detects apoptosis pathway, it comprises following primer:
(1) PCR that detects the BAX gene reacts primer, and its primer sequence is as follows:
5'-GGGTGGTTGGGTGAGACTC-3'；
5'-AGACACGTAAGGAAAACGCATTA-3'；
(2) PCR that detects the ANGPTL4 gene reacts primer, and its primer sequence is as follows:
5'-GTCCACCGACCTCCCGTTA-3'；
5'-CCTCATGGTCTAGGTGCTTGT-3'；
(3) detect the IL1A gene PCR reaction primer, its primer sequence is as follows:
5'-ATCATGTAAGCTATGGCCCACT-3'；
5'-CTTCCCGTTGGTTGCTACTAC-3'；
(4) detect the MYBL2 gene PCR reaction primer, its primer sequence is as follows:
5'-ATCGCCAAGATGTTGCCAGG-3'；
5'-GGACTCGCTCAAGAAGCCT-3'；
(5) detect the PEA15 gene PCR reaction primer, its primer sequence is as follows:
5'-CCTGACCTACTCACTATGGTGG-3'；
5'-GCTGCCGGATAATGTCTTTGTA-3'；
(6) detect the PRKAA1 gene PCR reaction primer, its primer sequence is as follows:
5'-GCGACAAGCCCACCTGATT-3'；
5'-TGTTTCAGCAACCAAGAATGGTA-3'；
(7) PCR that detects the BIRC5 gene reacts primer, and its primer sequence is as follows:
5'-AGGACCACCGCATCTCTACAT-3'；
5'-AAGTCTGGCTCGTTCTCAGTG-3'；
(8) PCR that detects the CASP1 gene reacts primer, and its primer sequence is as follows:
5'-TCCAATAATGGACAAGTCAAGCC-3'；
5'-GCTGTACCCCAGATTTTGTAGCA-3'；
(9) PCR that detects the DAPK3 gene reacts primer, and its primer sequence is as follows:
5'-TCACTACCTGCACTCTAAGCG-3'；
5'-TTCCCCGCCTCGATCTTGT-3'；
(10) PCR that detects the NUDT2 gene reacts primer, and its primer sequence is as follows:
5'-GCCTTGAGAGCATGTGGCTT-3'；
5'-ATGAATGCCATCTGATGCCTG-3'；
(11) PCR that detects confidential reference items GAPDH controlling gene reacts primer, and its primer sequence is as follows:
5'-TCATGGGTGTGAACCATGAGAA-3'；
5'-GGCATGGACTGTGGTCATGAG-3'。
The present invention also provides the PCR detection method that detects apoptosis pathway with described detection reagent, and described PCR detection method is a real time fluorescence quantifying PCR method.
To further improvement in the technical proposal: the reaction system of described real-time fluorescence quantitative PCR is: Taq polymeric enzyme reaction mixed solution 20 μ l, upstream primer 0.1-0.5 μ mol, downstream primer 0.1-0.5 μ mol, cDNA template 50-200ng, sterile purified water supply 40 μ l.
To further improvement in the technical proposal: described Taq polysaccharase is 2 * SYBR Premix Ex Taq polysaccharase.
To further improvement in the technical proposal: the response procedures of described real-time fluorescence quantitative PCR is: 95 ℃ of pre-sex change, 5 minutes; 98 ℃ of sex change 10 seconds, 55 ℃, 20 seconds, 72 ℃, 15 seconds, are carried out 40 circulations.
Compared with prior art, advantage of the present invention and positively effect are: the invention provides the reagent that detects apoptosis pathway, can go out the gene relevant in the transcriptional level rapid detection by real-time fluorescence quantitative PCR by means of described detection reagent with apoptosis, the mechanism of action process of the tumour of analyzing and researching on this basis related drugs, thereby find the apoptotic signal path of tumour related drugs fast and accurately, for the mechanism discussion of screening anticancer medicine, new targeted drug etc. provides strong instrument.
The present invention simultaneously also provides the PCR method that detects, described experimental system can carry out on any real-time fluorescence quantitative PCR instrument, experimental implementation is easy, expense is cheap, good reproducibility as a result, helping reducing the unnecessary detection in downstream, is a kind of important means of the research tumour related drugs mechanism of action.
After reading the specific embodiment of the present invention in conjunction with the accompanying drawings, other characteristics of the present invention and advantage will become clearer.
Description of drawings
Fig. 1 has shown that the present invention utilizes Ad5.TRAIL adenovirus research purpose gene TRAIL to cause the variation of the Expression of Related Genes level of lung cancer cell line A549 apoptosis.
Embodiment
Below in conjunction with the drawings and specific embodiments technical scheme of the present invention is described in further detail.
The present invention sets forth by the apoptosis of inducing nonsmall-cell lung cancer with trail dna and detects apoptotic reagent, and the TRAIL Chinese is the relevant apoptosis-induced part of tumour necrosis factor, and it is a kind of apoptosis-inducing ligand.
Used restriction enzyme is purchased in precious biotechnology (Dalian) company limited and NEB company among the present invention, and adenovirus shuttle vector pAd5-Track-CMV, skeleton carrier pAdEasy-1 are available from U.S. Agilent company.The T4 dna ligase is available from U.S. promega company.HEK293 cell, A549 cell and BJ5183 bacterial strain are all bought in Chinese Academy of Sciences's Shanghai cell bank (http://www.cellbank.org.cn/mulu.asp).Plasmid extraction kit is available from Shanghai Hua Shun company.Agarose gel reclaims test kit available from the vast Imtech in Beijing.
Utilize reagent of the present invention to detect apoptosis pathway and comprise following concrete steps:
One, makes up the adenovirus shuttle vector that contains goal gene TRAIL
1, enzyme is cut
Adenovirus shuttle vector pAd5-Track-CMV and plasmid vector pGEMT/TRAIL are carried out double digestion according to following system:
Composition pAd5-Track-CMV pGEMT/TRAIL
10×buffer?K 7.5?μL 7.5?μL
Deionized water complements to 50 μ L, 50 μ L
Gently behind the mixing in 37 ℃ of incubation 2 h.
2, reclaim
Sample full dose after enzyme cut is splined on 1.0% agarose gel electrophoresis, reclaims test kit according to the sepharose of the vast Imtech in Beijing and reclaims, and concrete steps are as follows:
A gets the Eppendorf pipe, weighs mark;
B extracts the little agar sugar that contains target DNA of trying one's best, and puts into pipe, weighs once more, tries to achieve the agarose quality;
The per 100 mg agaroses of c add 300 μ L sol solutionses;
50 ℃ of water-bath 7 min of d, per 2 min put upside down mixing once, and agarose is dissolved fully;
E will dissolve the back mixed solution and move into adsorption column, and centrifugal 30 s of 12,000 g outwell the liquid in the collection tube, adsorption column are put into same collection tube again;
F adds 650 μ L washingss in adsorption column, leave standstill 2 min after, centrifugal 30 s of 12,000 g outwell the liquid in the collection tube;
G puts into adsorption column same collection tube again, and it is rapid to repeat previous step;
H is reentered into adsorption column in the collection tube, centrifugal 2 min;
I puts into a clean Eppendorf pipe with adsorption column, and central authorities add 30 μ L elutriants at adsorption film, after room temperature leaves standstill 2 min, and centrifugal 1 min of 12,000 g;
The fragment that j 1.0% agarose gel electrophoresis detect to reclaim, the DNA that recovery is obtained is in-20 ℃ of preservations.
3, connect
Use the T4 dna ligase and carry out ligation, system is as follows:
2 * Rapid connects damping fluid 5 μ L
pAd5-Track-CMV?vector?(50?ng) 1?μL
Trail dna (300 ng) 2 μ L
————————————————————
Cumulative volume to 10 μ L
4, transform
To transform DH5 α competence step as follows for the product that is connected of pAd5-Track-CMV and trail dna:
(1) the DH5 α competent cell of getting 100 μ L places on the ice bath and melts;
(2) 10 μ L are connected product and add in the DH5 α competent cell of 100 μ L, rotate the mixing content gently, on ice bath, place 40 min;
(3) place 42 ℃ of water-bath 90 s, do not shake;
(4) rapidly centrifuge tube is transferred in the ice bath, placed 2 min;
(5) the liquid LB substratum of adding 400 μ L places 37 ℃ of shaking tables, and 100 rpm cultivate 45 min;
(6) bacterium liquid is drawn onto on that the LB solid medium plate of card that contains 30 mgL-1, lightly bacterium liquid evenly is coated with out with aseptic elbow glass stick;
(7) seal film plate is sealed, be inverted, 37 ℃, baking oven incubated overnight 16 h.
5, the extraction of single bacterium colony cultivation of the DH5 α behind the conversion recombinant vectors and plasmid
From transforming on the plate the single bacterium colony of picking white at random, be inoculated in the triangular pyramidal bottle of the 10 mL LB liquid nutrient mediums that contain that microbiotic of card (30 mg/L), every pipe is numbered, place 37 ℃ of shaking tables, 180 rpm cultivate 10 h; Extract (in a small amount) test kit (Shanghai Hua Shun) extracting plasmid to being muddy bacterium liquid with plasmid, residue bacterium liquid is got 800 μ L and is added 15% glycerine, 200 μ L, is stored in-70 ℃ of refrigerators.
Plasmid after extracting carried out enzyme is cut and sequence verification, prove that goal gene TRAIL has changed in the plasmid, the correct plasmid called after pAd5-Track-CMV-TRAIL that checks order.
Two, the structure of pAd5.TRAIL carrier
1, pAd5-Track-CMV-TRAIL carrier PmeI linearizing
The pAd5-Track-CMV-TRAIL carrier carries out single endonuclease digestion according to following system:
10×buffer?4 5?μL
——————————————
Deionized water complements to 50 μ L
Gently behind the mixing in 37 ℃ of incubation 2 h, every pipe full dose is splined on 1.0% agarose gel electrophoresis, reclaims according to above-mentioned recycling step.
2, electric shock changes over to
A with the linearizing pAd5-Track-CMV-TRAIL of PmeI with the deionized water dissolving of 15 μ L and mix;
B starts electroporation apparatus, and the working order of establishing prokaryotic cell prokaryocyte, and setting program is U=1650 V, T=4 ms, and prepares 1 mL nutrient agar in centrifuge tube;
C changes adenovirus skeleton carrier pAdEasy-1 in the BJ5183 bacterial strain over to, and the BJ5183 that will contain pAdEasy-1 again makes competent cell, gets BJ5183 competent cell 50 μ L, melts 4-5 min in ice approximately;
D draws the linearizing pAd5-Track-CMV-TRAIL of PmeI of 1 μ L, adds among the BJ5183 that has melted, and in the mixing adding electroporation cup, after electroporation cup periphery wiped clean, puts into electroporation apparatus, presses the START key, the electroporation reaction of beginning cell;
The LB substratum that e draws 1 mL adds the electroporation reaction system of rinse step d in the electroporation cup, sucks back mixed solution in the centrifuge tube again;
F in 37 ℃, shakes bacterium 1-1.5 h with this bacterium liquid under the 225 rpm conditions;
The above-mentioned bacterium liquid that g draws 100 μ L, 200 μ L respectively is coated with LB flat board (this LB flat board contains kantlex 30 mg/L), 37 ℃ of overnight incubation;
H second day observes the bacterial plaque upgrowth situation, picking mono-clonal bacterium colony.
Filter out positive bacterium colony through kantlex, extract positive plasmid, this plasmid is cut evaluation through the EcoRI enzyme, and the correct back of sample presentation order-checking called after pAd5.TRAIL, pAd5.TRAIL is linearizing pAd5-Track-CMV-TRAIL and the adenovirus carrier of skeleton carrier pAdEasy-1 through homologous recombination formation.
Three, preparation adenovirus Ad5.TRAIL and Ad5.eGFP
1, with PacI linearizing pAd5.TRAIL
PacI is carried out linearizing according to following system:
10×buffer?4 5?μL
DNA 10?μg
———————————————
Deionized water complements to 50 μ L
Carry out electrophoresis and recovery that the DNA enzyme is cut product according to the method described above.
2, with linearizing pAd5.TRAIL transfection HEK293 cell
The linearizing pAd5.TRAIL that reclaims is according to the adherent HEK293 cell (buying from Chinese Academy of Sciences's Shanghai cell bank) of liposome 2000 step transfections 70% of invitrogen company, be replaced by the DMEM substratum that contains 10% FBS after the transfection, changed one time nutrient solution every 2-3 days, continue to cultivate 10-14 days, under fluorescent microscope, observed fluorescence on the 3rd ~ 5 day.Treat that cell has plaque pathology (Cytopathic effect, CPE) collecting cell suspension the time, centrifugal 5 min of 2000 r/min, after cell precipitation washs 2 ~ 3 times with aseptic PBS, with cell suspension multigelation 3 times between-80 ℃-37 ℃, discharge virus, the centrifugal 5min of 2000r/min, get supernatant, after infecting, many wheels obtain high titre recombinant adenovirus Ad5.TRAIL, this virus contains eGFP gene and trail dna simultaneously (because of pAd5-Track-CMV carrier itself wherein contains the expression of eGFP, after so the adenovirus carrier that forms after the homologous recombination adds goal gene, also can express eGFP and goal gene simultaneously), recording virus titer (pt/mL) by OD260 nm is 5.5 * 10
12The viral nomenclature that contrast virus promptly only contains the eGFP gene is Ad5.eGFP, and eGFP is the abbreviation of enhanced green fluorescence protein, in-80 ℃ frozen should virus.
Four, Ad5.TRAIL and Ad5.eGFP infect the A549 cell
1, the cultivation of A549 cell: the A549 cell is placed the DMEM nutrient solution of 10% foetal calf serum, in 37 ℃ of CO
2Cultivate in the incubator; When treating that cell density grows to 70-80%, the cultivation of going down to posterity.
2, inoculating cell: people's non-small cell lung cancer cell (A549) in the vegetative period of taking the logarithm is inoculated in 25cm after 0.1% trysinization
2Culturing bottle in, 37 ℃, 5% CO2 incubator was hatched 24 hours.Cell count is about 1 * 10
3
3, virus treated: Ad5.TRAIL and Ad5.eGFP are infected the A549 cell respectively, and after 48 hours, collecting cell carries out detected downstream.
Five, total RNA extracts and reverse transcription reaction
1, extracts total RNA
A gets CO
2Be in cell one dish of logarithmic phase 60 mm plates in the incubator, sop up nutrient solution after, clean 2 times with aseptic 1 * PBS after, add 1 mL Trizol at cell surface, aspirate repeatedly evenly with the rifle head, change in the sterile tube.
The b room temperature is cultivated 5 min, with dissolving nucleoprotein.Add 0.2 mL phenol/chloroform (1:1), thermal agitation 15 sec, incubated at room 2-3 min.
4 ℃ of c, centrifugal 15 min of 12000 g, cell can produce layering.
D goes to supernatant liquid in the centrifuge tube of no RNase, adds 0.5 mL Virahol, puts upside down mixing 3 times, and room temperature is cultivated 10 min.
4 ℃ of e, centrifugal 10 min of 12000 g, RNA forms bottom settlings.
F abandons supernatant, with 75% ethanol, the 1 mL washing precipitation of no RNase.4 ℃, centrifugal 5 min of 7000 g.
The about 5-10 min of g air drying RNA.Should not be too dried.
H 30-50 μ L DEPC water dissolution RNA.
2, cDNA's is synthetic
A adds following reaction mixture in the test tube of precooling:
Total RNA 1-5 μ g
oligo(dT)(0.5?μg/μl) 1?μL
Be settled to 12 μ L with RNase-free water.
The b mixing, centrifugal 3-5 sec.
Ice bath 30 sec behind 70 ℃ of effects of c, 5 min, centrifugal 3-5 sec.
D adds following component again with the test tube ice bath:
5 * reaction buffer, 4 μ L
Rnase?Inhibiter?(20?U/μL) 1?μL
dNTP?mix?(10?mM) 2?μL
E is mixing gently, centrifugal 3-5 sec.
37 ℃ of water-bath 5 min of f add the M-MuLV Reverse Transcriptase (20 U/ μ L) of 1 μ L, mixing.
37 ℃ of effects of g, 60 min.Hatch 10 min for 70 ℃ and finish reaction, put and carry out downstream tests on ice.
Six, real-time fluorescence quantitative PCR reaction detection apoptosis pathway
The present invention is by detecting in conjunction with real-time fluorescence quantitative PCR with the reagent that detects apoptosis pathway, and described detection reagent comprises that one group is detected the nucleotide sequence of anti-apoptotic gene, one group of nucleotide sequence that detects halfcystine and aspartase activity gene, one group of nucleotide sequence and nucleotide sequence that detects confidential reference items GAPDH controlling gene that detects the cell death inducing gene.The nucleotide sequence of described anti-apoptotic gene can detect the expression of gene of anti-apoptotic; Halfcystine enzyme and L-Aspartase are the last expression products of apoptosis, and the nucleotide sequence of described halfcystine and aspartase activity gene can detect the expression of apoptosis downstream gene; The nucleotide sequence of described cell death inducing gene can detect the activating cells expression of apoptosis-related genes.
This experiment is divided into two groups, i.e. Ad5.TRAIL and Ad5.eGFP group.Every group is provided with 36 holes respectively, and wherein 12 holes are independent sample, and each sample respectively has 3 repetitions.Add the primer of BAX gene, ANGPTL4 gene, IL1A gene, MYBL2 gene, PEA15 gene, PRKAA1 gene, BIRC5 gene, CASP1 gene, DAPK3 gene, NUDT2 gene and confidential reference items GAPDH controlling gene in every group of 11 hole respectively, another hole adds entry in contrast.
1, one group is used for the nucleotide sequence that real-time fluorescence quantitative PCR detects the anti-apoptotic gene:
(1) BAX gene, promptly relevant X protein (the BCL2-associated X protein) gene of BCL2 family uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
BAX forward primer 5'-GGGTGGTTGGGTGAGACTC-3'(SEQ ID No:1)
BAX reverse primer 5'-AGACACGTAAGGAAAACGCATTA-3'(SEQ ID No:2)
Amplify the BAX gene, the Genbank accession number is: NM_004324, fragment length are 191bp.
(2) ANGPTL4 gene, i.e. angiogenin similar protein 4(angiopoietin-like4) gene,
Use a pair of polymerase chain reaction primer of artificial design, increase, its nucleotide sequence is as follows:
ANGPTL4 forward primer 5'-GTCCACCGACCTCCCGTTA(SEQ ID No:3)
ANGPTL4 reverse primer 5'-CCTCATGGTCTAGGTGCTTGT(SEQ ID No:4)
Amplify the ANGPTL4 gene, the Genbank accession number is: NM_001039667, expanding fragment length are 212bp.
(3) IL1A gene, promptly interleukin-11 A uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
ATCATGTAAGCTATGGCCCACT（SEQ?ID?No:5）
CTTCCCGTTGGTTGCTACTAC（SEQ?ID?No:6）
Amplify the IL1A gene, the Genbank accession number is: NM_000575, expanding fragment length are 131bp.
(4) MYBL2 gene, promptly v-myb avian myeloblastosis virus oncogene homologue sample 2 uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
ATCGCCAAGATGTTGCCAGG（SEQ?ID?No:7）
GGACTCGCTCAAGAAGCCT（SEQ?ID?No:8）
Amplify the MYBL2 gene, the Genbank accession number is: NM_002466, expanding fragment length are 102bp.
(5) PEA15 gene, promptly astroglia cell enriches phosphorprotein 15, uses a pair of polymerase chain reaction primer of artificial design, increases, and its nucleotide sequence is as follows:
CCTGACCTACTCACTATGGTGG（SEQ?ID?No:9）
GCTGCCGGATAATGTCTTTGTA（SEQ?ID?No:10）
Amplify the PEA15 gene, the Genbank accession number is: NM_003768, expanding fragment length are 127bp.
(6) PRKAA1 gene, promptly AMP activated protein kinase alpha 1 catalytic subunit uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
GCGACAAGCCCACCTGATT（SEQ?ID?No:11）
TGTTTCAGCAACCAAGAATGGTA（SEQ?ID?No:12）
Amplify the PRKAA1 gene, the Genbank accession number is: NM_006251, expanding fragment length are 87bp.
2, one group of real-time fluorescence quantitative PCR detects the nucleotide sequence of halfcystine and aspartase activity gene
(1) BIRC5 gene, promptly baculovirus IAP repeat region 5 uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
AGGACCACCGCATCTCTACAT（SEQ?ID?No:13）
AAGTCTGGCTCGTTCTCAGTG（SEQ?ID?No:14）
Amplify the BIRC5 gene, the Genbank accession number is: NM_001012270, expanding fragment length are 118bp.
(2) CASP1 gene, promptly cysteine aspartase 1, uses a pair of polymerase chain reaction primer of artificial design, increases, and its nucleotide sequence is as follows:
TCCAATAATGGACAAGTCAAGCC（SEQ?ID?No:15）
GCTGTACCCCAGATTTTGTAGCA（SEQ?ID?No:16）
Amplify the CASP1 gene, the Genbank accession number is: NM_001223, expanding fragment length are 139bp.
3, the nucleotide sequence of one group of real-time fluorescence quantitative PCR reaction detection cell death inducing gene
(1) DAPK3 gene, promptly dead related protein kinase 3 uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
TCACTACCTGCACTCTAAGCG（SEQ?ID?No:17）
TTCCCCGCCTCGATCTTGT（SEQ?ID?No:18）
Amplify the DAPK3 gene, the Genbank accession number is: NM_001348, expanding fragment length are 135bp.
(2) NUDT2 gene, i.e. the X composition type primitive 2 of nucleoside diphosphate connection uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
GCCTTGAGAGCATGTGGCTT（SEQ?ID?No:19）
ATGAATGCCATCTGATGCCTG（SEQ?ID?No:20）
Amplify the NUDT2 gene, the Genbank accession number is: NM_147173, expanding fragment length are 105bp.
4, the nucleotide sequence of one group of real-time fluorescence quantitative PCR reaction detection confidential reference items GAPDH controlling gene (glyceraldehyde-3-phosphate dehydrogenase)
TCATGGGTGTGAACCATGAGAA（SEQ?ID?No:21）
GGCATGGACTGTGGTCATGAG（SEQ?ID?No:22）
Amplify confidential reference items GAPDH controlling gene, the Genbank accession number is: NM_002046, expanding fragment length are 146bp.
Carry out the real time fluorescent quantitative poly chain reaction with above-mentioned primer, its reaction system is as follows: 2 * SYBR Premix Ex Taq polymeric enzyme reaction mixed solution, 20 μ l, upstream primer 0.2 μ mol, downstream primer 0.2 μ mol, cDNA template 50ng, sterile purified water supply 40 μ l.
Carry out following response procedures behind the mixing: 95 ℃, 5 minutes, a circulation; 98 ℃, 10 seconds, 55 ℃, 20 seconds, 72 ℃, 15 seconds, 40 circulations.The solubility curve routine analyzer: 95 ℃, 0 second, 65 ℃, 15 seconds.This polymerase chain reaction is in the operation of real time fluorescent quantitative poly chain reaction instrument.
The expression amount of range gene is made Fig. 1, wherein be higher than 2 the high expression level that is, be lower than 0.5 the low expression that is, shown among Fig. 1 that BAX gene, ANGPTL4 gene and MYBL2 gene are high expression level, IL1A gene, PEA15 gene, PRKAA1 gene, BIRC5 gene, CASP1 gene and NUDT2 gene are middle expression, and the DAPK3 gene is expressed for low.
The present invention obtains carrier with expression vector pAd5-Track-CMV after with SalI and HindIII double digestion, the pGEMT/TRAIL plasmid that has goal gene TRAIL reclaims the purpose fragment behind SalI and HindIII double digestion, connect to transform and obtain positive colony called after pAd5-Track-CMV-TRAIL, pAd5-Track-CMV-TRAIL is after the PmeI enzyme is cut, electricity changes among the BJ5183, filter out positive plasmid through blocking that, called after pAd5.TRAIL.With the linearizing pAd5.TRAIL transfection of PacI HEK293 cell, karyon increases after 7-10 days, cell rounding, prolongation along with the time, a large amount of green fluorescences appear because of expressing eGFP, and (Cytopathic effect CPE), illustrates the homologous recombination success and has had infectious adenovirion CP to occur.Continuation to adenovirus increase, purifying obtains virus stock solution used Ad5.TRAIL, record virus titer (pt/mL) by OD260 nm and be divided into 5.5 * 1012.Control plasmid called after Ad5.eGFP.Behind Ad5.TRAIL and Ad5.eGFP infection A549 cell, extract total RNA and reverse transcription reaction, the reagent that utilizes detection apoptosis pathway provided by the invention can increase by quantitative fluorescent PCR and obtain the collection of illustrative plates of special signal path gene, for the apoptotic signal path of research purpose gene provides the most direct evidence.
Above embodiment is only in order to illustrating technical scheme of the present invention, but not limits it; Although the present invention is had been described in detail with reference to previous embodiment, for the person of ordinary skill of the art, still can make amendment to the technical scheme that previous embodiment is put down in writing, perhaps part technical characterictic wherein is equal to replacement; And these modifications or replacement do not make the essence of appropriate technical solution break away from the spirit and scope of the present invention's technical scheme required for protection.
SEQUENCE?LISTING
＜110〉Hospital Attached to Medical College, Qingdao Univ.
＜120〉a kind of reagent and PCR detection method that detects apoptosis pathway
<160> 22
<170> PatentIn?version?3.3
<210> 1
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 1
gggtggttgg?gtgagactc 19
<210> 2
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 2
agacacgtaa?ggaaaacgca?tta 23
<210> 3
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 3
gtccaccgac?ctcccgtta 19
<210> 4
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 4
cctcatggtc?taggtgcttg?t 21
<210> 5
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 5
atcatgtaag?ctatggccca?ct 22
<210> 6
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 6
cttcccgttg?gttgctacta?c 21
<210> 7
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 7
atcgccaaga?tgttgccagg 20
<210> 8
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 8
gactcgctca?agaagcct 18
<210> 9
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 9
cctgacctact?cactatggtg?g 21
<210> 10
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 10
gctgccggata?atgtctttgt?a 21
<210> 11
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 11
gcgacaagcc?cacctgatt 19
<210> 12
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 12
tgtttcagca?accaagaatg?gta 23
<210> 13
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 13
aggaccaccgc?atctctacat 20
<210> 14
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 14
aagtctggctc?gttctcagtg 20
<210> 15
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 15
tccaataatgg?acaagtcaag?cc 22
<210> 16
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 16
gctgtacccc?agattttgta?gca 23
<210> 17
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 17
tcactacctg?cactctaagc?g 21
<210> 18
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 18
ttccccgcct?cgatcttgt 19
<210> 19
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 19
gccttgagag?catgtggctt 20
<210> 20
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 20
atgaatgcca?tctgatgcct?g 21
<210> 21
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 21
tcatgggtgt?gaaccatgag?aa 22
<210> 22
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 22
ggcatggact?gtggtcatga?g 21
SEQUENCE?LISTING
＜110〉Hospital Attached to Medical College, Qingdao Univ.
＜120〉a kind of reagent and PCR detection method that detects apoptosis pathway
<160> 22
<170> PatentIn?version?3.3
<210> 1
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 1
gggtggttgg?gtgagactc 19
<210> 2
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 2
agacacgtaa?ggaaaacgca?tta 23
<210> 3
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 3
gtccaccgac?ctcccgtta 19
<210> 4
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 4
cctcatggtc?taggtgcttg?t 21
<210> 5
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 5
atcatgtaag?ctatggccca?ct 22
<210> 6
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 6
cttcccgttg?gttgctacta?c 21
<210> 7
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 7
atcgccaaga?tgttgccagg 20
<210> 8
<211> 18
<212> DNA
＜213〉artificial sequence
<400> 8
gactcgctca?agaagcct 18
<210> 9
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 9
cctgacctact?cactatggtg?g 21
<210> 10
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 10
gctgccggata?atgtctttgt?a 21
<210> 11
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 11
gcgacaagcc?cacctgatt 19
<210> 12
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 12
tgtttcagca?accaagaatg?gta 23
<210> 13
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 13
aggaccaccgc?atctctacat 20
<210> 14
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 14
aagtctggctc?gttctcagtg 20
<210> 15
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 15
tccaataatgg?acaagtcaag?cc 22
<210> 16
<211> 23
<212> DNA
＜213〉artificial sequence
<400> 16
gctgtacccc?agattttgta?gca 23
<210> 17
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 17
tcactacctg?cactctaagc?g 21
<210> 18
<211> 19
<212> DNA
＜213〉artificial sequence
<400> 18
ttccccgcct?cgatcttgt 19
<210> 19
<211> 20
<212> DNA
＜213〉artificial sequence
<400> 19
gccttgagag?catgtggctt 20
<210> 20
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 20
atgaatgcca?tctgatgcct?g 21
<210> 21
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 21
tcatgggtgt?gaaccatgag?aa 22
<210> 22
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 22
ggcatggact?gtggtcatga?g 21
Claims (5)
1. reagent that detects apoptosis pathway is characterized in that it comprises following primer:
(1) PCR that detects the BAX gene reacts primer, and its primer sequence is as follows:
5'-GGGTGGTTGGGTGAGACTC-3'；
5'-AGACACGTAAGGAAAACGCATTA-3'；
(2) PCR that detects the ANGPTL4 gene reacts primer, and its primer sequence is as follows:
5'-GTCCACCGACCTCCCGTTA-3'；
5'-CCTCATGGTCTAGGTGCTTGT-3'；
(3) detect the IL1A gene PCR reaction primer, its primer sequence is as follows:
5'-ATCATGTAAGCTATGGCCCACT-3'；
5'-CTTCCCGTTGGTTGCTACTAC-3'；
(4) detect the MYBL2 gene PCR reaction primer, its primer sequence is as follows:
5'-ATCGCCAAGATGTTGCCAGG-3'；
5'-GGACTCGCTCAAGAAGCCT-3'；
(5) detect the PEA15 gene PCR reaction primer, its primer sequence is as follows:
5'-CCTGACCTACTCACTATGGTGG-3'；
5'-GCTGCCGGATAATGTCTTTGTA-3'；
(6) detect the PRKAA1 gene PCR reaction primer, its primer sequence is as follows:
5'-GCGACAAGCCCACCTGATT-3'；
5'-TGTTTCAGCAACCAAGAATGGTA-3'；
(7) PCR that detects the BIRC5 gene reacts primer, and its primer sequence is as follows:
5'-AGGACCACCGCATCTCTACAT-3'；
5'-AAGTCTGGCTCGTTCTCAGTG-3'；
(8) PCR that detects the CASP1 gene reacts primer, and its primer sequence is as follows:
5'-TCCAATAATGGACAAGTCAAGCC-3'；
5'-GCTGTACCCCAGATTTTGTAGCA-3'；
(9) PCR that detects the DAPK3 gene reacts primer, and its primer sequence is as follows:
5'-TCACTACCTGCACTCTAAGCG-3'；
5'-TTCCCCGCCTCGATCTTGT-3'；
(10) PCR that detects the NUDT2 gene reacts primer, and its primer sequence is as follows:
5'-GCCTTGAGAGCATGTGGCTT-3'；
5'-ATGAATGCCATCTGATGCCTG-3'；
(11) PCR that detects confidential reference items GAPDH controlling gene reacts primer, and its primer sequence is as follows:
5'-TCATGGGTGTGAACCATGAGAA-3'；
5'-GGCATGGACTGTGGTCATGAG-3'。
2. the PCR detection method with claims 1 described reagent detection apoptosis pathway is characterized in that described PCR detection method is a real time fluorescence quantifying PCR method.
3. according to claims 2 described a kind of PCR detection methods that detect apoptosis pathway, it is characterized in that, the reaction system of described real-time fluorescence quantitative PCR is: Taq polymeric enzyme reaction mixed solution 20 μ l, upstream primer 0.1-0.5 μ mol, downstream primer 0.1-0.5 μ mol, cDNA template 50-200ng, sterile purified water supply 40 μ l.
4. according to claims 3 described a kind of PCR detection methods that detect apoptosis pathway, it is characterized in that described Taq polysaccharase is 2 * SYBR Premix Ex Taq polysaccharase.
5. according to claims 3 described a kind of PCR detection methods that detect apoptosis pathway, it is characterized in that the response procedures of described real-time fluorescence quantitative PCR is: 95 ℃ of pre-sex change, 5 minutes; 98 ℃ of sex change 10 seconds, 55 ℃, 20 seconds, 72 ℃, 15 seconds, are carried out 40 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110228207 CN102251050B (en) | 2011-08-10 | 2011-08-10 | Reagent for detecting cell apoptosis signal path and PCR method using same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110228207 CN102251050B (en) | 2011-08-10 | 2011-08-10 | Reagent for detecting cell apoptosis signal path and PCR method using same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102251050A true CN102251050A (en) | 2011-11-23 |
| CN102251050B CN102251050B (en) | 2013-03-20 |
Family
ID=44978618
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110228207 Expired - Fee Related CN102251050B (en) | 2011-08-10 | 2011-08-10 | Reagent for detecting cell apoptosis signal path and PCR method using same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102251050B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106167819A (en) * | 2016-04-23 | 2016-11-30 | 同济大学苏州研究院 | A kind of primer for detecting humanized's BAX gene expression dose combines and application |
| CN111690750A (en) * | 2020-07-13 | 2020-09-22 | 青岛市市立医院 | PCR reagent for detecting molecular expression of cell P53 signal path and application thereof |
| CN111690751A (en) * | 2020-07-13 | 2020-09-22 | 青岛大学附属医院 | PCR reagent for detecting tumor drug target and application thereof |
| CN111808958A (en) * | 2020-07-13 | 2020-10-23 | 青岛市市立医院 | PCR reagent for detecting apoptosis signal path and application thereof |
-
2011
- 2011-08-10 CN CN 201110228207 patent/CN102251050B/en not_active Expired - Fee Related
Non-Patent Citations (14)
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106167819A (en) * | 2016-04-23 | 2016-11-30 | 同济大学苏州研究院 | A kind of primer for detecting humanized's BAX gene expression dose combines and application |
| CN111690750A (en) * | 2020-07-13 | 2020-09-22 | 青岛市市立医院 | PCR reagent for detecting molecular expression of cell P53 signal path and application thereof |
| CN111690751A (en) * | 2020-07-13 | 2020-09-22 | 青岛大学附属医院 | PCR reagent for detecting tumor drug target and application thereof |
| CN111808958A (en) * | 2020-07-13 | 2020-10-23 | 青岛市市立医院 | PCR reagent for detecting apoptosis signal path and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102251050B (en) | 2013-03-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7441245B2 (en) | Recombinant oncolytic viruses and their preparation methods, uses and medicines | |
| CN102251050B (en) | Reagent for detecting cell apoptosis signal path and PCR method using same | |
| US20210363529A1 (en) | RNAi nano-preparation, preparation method thereof and application thereof in TMV prevention and control | |
| CN103981155A (en) | Construction method and application of targeting hepatoma oncolytic adenovirus | |
| CN101921769B (en) | Recombinant adenovirus, preparation method and application thereof | |
| CN113416768B (en) | Application of PRKRA gene as target in inhibiting replication of peste des petits ruminants virus | |
| CN106282132A (en) | The low virulent strain of Pseudorabies virus variant and application thereof | |
| CN101654685B (en) | Human Bcl-2 and human VEGF165 double-gene co-expression recombinant vector and building method thereof | |
| CN105624162B (en) | For the siRNA of mammal R-Spondin2 gene targets, ShorthairpinRNA and carrier and application | |
| CN105039342A (en) | siRNA capable of inhibiting MAT2A genetic expression and application of siRNA | |
| CN102453757B (en) | Application of micro RNA and antisense nucleic acid thereof in diagnosis, prevention, treatment and/or prognosis evaluation of myocardial ischemic injury | |
| CN111041001B (en) | Safe coxsackie virus for treating KRAS mutant tumor and pharmaceutical composition thereof | |
| CN106978418A (en) | The shRNA interference sequences of people's PYCR1 genes and its application | |
| CN110577934A (en) | Construction method and application of TLR4 gene knocked-down porcine alveolar macrophage cell line | |
| CN100392084C (en) | Recombinant adenovirus containing codon optimized type IIPV16L1 gene | |
| CN101921757B (en) | Standard positive reference material for rana grylio virus (RGV) detection | |
| CN101906417B (en) | shRNA for hepatitis B virus and recombinant adeno-associated virus vector treating vector carrying same | |
| CN101787374A (en) | Recombinant adenovirus vector capable of specifically proliferating in tumor cells based on micro RNA regulation and control, and construction method and application thereof | |
| CN114917325A (en) | Application of human soluble TIM-4 protein in preparation of antitumor drugs | |
| CN111471715A (en) | Adenovirus vector and construction method and application thereof | |
| CN106811484A (en) | A kind of ox PDHB gene adenovirus interference carrier builds and its authentication method | |
| CN102229928B (en) | Small-interfering RNA (Ribonucleic Acid) of human RBBP6 (Retinoblastoma-binding Proteingene) and application thereof | |
| CN111500632A (en) | Construction and application of oncolytic adenovirus expressing ST13 and TRAI L | |
| CN110904056A (en) | Infectious bronchitis virus rH120-YZS1 delta 5a and construction method and application thereof | |
| CN107828819B (en) | Method for constructing recombinant adenovirus by using ANP or IgANP gene, recombinant adenovirus and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130320 Termination date: 20130810 |