CN102251050B - Reagent for detecting cell apoptosis signal path and PCR method using same - Google Patents
Reagent for detecting cell apoptosis signal path and PCR method using same Download PDFInfo
- Publication number
- CN102251050B CN102251050B CN 201110228207 CN201110228207A CN102251050B CN 102251050 B CN102251050 B CN 102251050B CN 201110228207 CN201110228207 CN 201110228207 CN 201110228207 A CN201110228207 A CN 201110228207A CN 102251050 B CN102251050 B CN 102251050B
- Authority
- CN
- China
- Prior art keywords
- gene
- primer
- pcr
- detects
- follows
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a reagent for detecting a cell apoptosis signal path and a PCR (polymerase chain reaction) method using the same. The detection reagent comprises PCR primers for detecting expression of BAX gene, ANGPTL4 gene, IL1A gene, MYBL2 gene, PEA15 gene, PRKAA1 gene, BIRC5 gene, CASP1 gene, DAPK3 gene, NUDT2 gene and reference GAPDH control gene. In the invention, cell apoptosis related signal molecules are concentrated on a plate, real-time fluorescent quantitative PCR is carried out once to reflect the survival conditions of the cells and discuss the possible ways for causing cell apoptosis, thereby providing the most direct evidence for researching the apoptosis signal path of the key protein. The invention quickly and accurately finds out the related apoptosis signal path on the transcription level, thereby providing a powerful tool for screening anticancer drugs, discussing new targeting drug mechanisms and the like.
Description
Technical field
The invention belongs to biology field, relate in particular to a kind of reagent and PCR detection method thereof that detects apoptosis pathway.
Background technology
Apoptosis is a kind of modulated programmed cell death process of being brought out by dead signal in essence, is the common form of cell physiological death.Be body under physiology or pathological conditions, start self internal mechanism, through multipath signal transmission, finish the process of himself life.Apoptosis has distinctive morphology and biological chemistry changes.The early stage main manifestations of apoptosis is the kytoplasm cavity, and Chromatin condensation is also arranged along nuclear membrane; Apoptotic cell separates with extracellular matrix or peripheral cell.Along with the progress of apoptotic process, kytoplasm cavity and after birth merge, and cause the film foaming, and cavity and cellular segregation cause loss of moist subsequently, cell shrinkage, and simultaneously carrying out property of chromatin pyknosis, and be fragmented into lumphy structure, last cell also is fragmented into apoptotic body.The apoptosis of inducing tumor cell has become a kind of key means for the treatment of tumour at present.But apoptosis has complicated signal pathway, how can be from numerous and jumbled apoptosis signal pathway, thereby find out clear and definite apoptotic signal approach exploitation Tumor-assaciated medicine, so that the apoptosis of further inducing tumor cell has become tumour medicine now and has researched and developed the major issue that the urgent need in field solves.
Summary of the invention
The present invention is directed to the difficulty that inducing apoptosis of tumour cell runs in the prior art, a kind of reagent and PCR detection method thereof that detects apoptosis pathway is provided, the present invention will be referred to apoptotic signaling molecule and concentrates on the flat board, by doing a real-time fluorescence quantitative PCR reaction, the survival condition of reacting cells, discussion causes apoptotic possible approaches, for the apoptotic signal path of studying key protein provides the most direct evidence.
For achieving the above object, the present invention adopts following technical proposals to be achieved:
A kind of reagent that detects apoptosis pathway, it comprises following primer:
(1) PCR that detects the BAX gene reacts primer, and its primer sequence is as follows:
5'-GGGTGGTTGGGTGAGACTC-3';
5'-AGACACGTAAGGAAAACGCATTA-3';
(2) PCR that detects the ANGPTL4 gene reacts primer, and its primer sequence is as follows:
5'-GTCCACCGACCTCCCGTTA-3';
5'-CCTCATGGTCTAGGTGCTTGT-3';
(3) detect the IL1A gene PCR reaction primer, its primer sequence is as follows:
5'-ATCATGTAAGCTATGGCCCACT-3';
5'-CTTCCCGTTGGTTGCTACTAC-3';
(4) detect the MYBL2 gene PCR reaction primer, its primer sequence is as follows:
5'-ATCGCCAAGATGTTGCCAGG-3';
5'-GGACTCGCTCAAGAAGCCT-3';
(5) detect the PEA15 gene PCR reaction primer, its primer sequence is as follows:
5'-CCTGACCTACTCACTATGGTGG-3';
5'-GCTGCCGGATAATGTCTTTGTA-3';
(6) detect the PRKAA1 gene PCR reaction primer, its primer sequence is as follows:
5'-GCGACAAGCCCACCTGATT-3';
5'-TGTTTCAGCAACCAAGAATGGTA-3';
(7) PCR that detects the BIRC5 gene reacts primer, and its primer sequence is as follows:
5'-AGGACCACCGCATCTCTACAT-3';
5'-AAGTCTGGCTCGTTCTCAGTG-3';
(8) PCR that detects the CASP1 gene reacts primer, and its primer sequence is as follows:
5'-TCCAATAATGGACAAGTCAAGCC-3';
5'-GCTGTACCCCAGATTTTGTAGCA-3';
(9) PCR that detects the DAPK3 gene reacts primer, and its primer sequence is as follows:
5'-TCACTACCTGCACTCTAAGCG-3';
5'-TTCCCCGCCTCGATCTTGT-3';
(10) PCR that detects the NUDT2 gene reacts primer, and its primer sequence is as follows:
5'-GCCTTGAGAGCATGTGGCTT-3';
5'-ATGAATGCCATCTGATGCCTG-3';
(11) PCR that detects confidential reference items GAPDH controlling gene reacts primer, and its primer sequence is as follows:
5'-TCATGGGTGTGAACCATGAGAA-3';
5'-GGCATGGACTGTGGTCATGAG-3'。
The present invention also provides the PCR detection method that detects apoptosis pathway with described detection reagent, and described PCR detection method is real time fluorescence quantifying PCR method.
To further improvement in the technical proposal: the reaction system of described real-time fluorescence quantitative PCR is: Taq polymeric enzyme reaction mixed solution 20 μ l, upstream primer 0.1-0.5 μ mol, downstream primer 0.1-0.5 μ mol, cDNA template 50-200ng, sterile purified water supply 40 μ l.
To further improvement in the technical proposal: described Taq polysaccharase is 2 * SYBR Premix Ex Taq polysaccharase.
To further improvement in the technical proposal: the response procedures of described real-time fluorescence quantitative PCR is: 95 ℃ of denaturations, 5 minutes; 98 ℃ of sex change 10 seconds, 55 ℃, 20 seconds, 72 ℃, 15 seconds, are carried out 40 circulations.
Compared with prior art, advantage of the present invention and positively effect are: the invention provides the reagent that detects apoptosis pathway, can go out the gene relevant with apoptosis in the transcriptional level rapid detection by real-time fluorescence quantitative PCR by means of described detection reagent, analyze and research the on this basis mechanism of action process of Tumor-assaciated medicine, thereby find fast and accurately the apoptotic signal path of Tumor-assaciated medicine, for the Mechanism Discussion of screening anticancer medicine, new targeted drug etc. provides strong instrument.
Simultaneously the present invention also provides the PCR method that detects, described experimental system can carry out at any real-time fluorescence quantitative PCR instrument, experimental implementation is easy, expense is cheap, good reproducibility as a result, being conducive to reduce the unnecessary detection in downstream, is a kind of important means of research Tumor-assaciated drug mechanism.
After reading the specific embodiment of the present invention by reference to the accompanying drawings, other characteristics of the present invention and advantage will become clearer.
Description of drawings
Fig. 1 has shown that the present invention utilizes Ad5.TRAIL adenovirus research purpose gene TRAIL to cause the variation of expression level of the genes involved of lung cancer cell line A549 apoptosis.
Embodiment
Below in conjunction with the drawings and specific embodiments technical scheme of the present invention is described in further detail.
The present invention sets forth by the apoptosis of inducing nonsmall-cell lung cancer with trail dna and detects apoptotic reagent, and the TRAIL Chinese is the relevant apoptosis-induced part of tumour necrosis factor, and it is a kind of apoptosis-inducing ligand.
Used restriction enzyme is purchased from precious biotechnology (Dalian) company limited and NEB company among the present invention, and adenovirus shuttle vector pAd5-Track-CMV, skeleton carrier pAdEasy-1 are available from U.S. Agilent company.The T4 dna ligase is available from U.S. promega company.HEK293 cell, A549 cell and BJ5183 bacterial strain are all bought in Chinese Academy of Sciences's Shanghai cell bank (http://www.cellbank.org.cn/mulu.asp).Plasmid extraction kit is available from Shanghai Hua Shun company.Agarose gel reclaims test kit available from the vast Imtech in Beijing.
Utilize reagent of the present invention to detect apoptosis pathway and comprise following concrete steps:
One, makes up the adenovirus shuttle vector that contains goal gene TRAIL
1, enzyme is cut
Adenovirus shuttle vector pAd5-Track-CMV and plasmid vector pGEMT/TRAIL are carried out double digestion according to following system:
Composition pAd5-Track-CMV pGEMT/TRAIL
10×buffer K 7.5 μL 7.5 μL
HindIII 2 μL 2 μL
Deionized water complements to 50 μ L, 50 μ L
Gently behind the mixing in 37 ℃ of incubation 2 h.
2, reclaim
Sample full dose after enzyme cut is splined on 1.0% agarose gel electrophoresis, reclaims test kit according to the sepharose of the vast Imtech in Beijing and reclaims, and concrete steps are as follows:
A gets the Eppendorf pipe, weighs mark;
B extracts the little Agarose plug that contains target DNA of trying one's best, and puts into pipe, again weighs, and tries to achieve the agarose quality;
The per 100 mg agaroses of c add 300 μ L sol solutionses;
50 ℃ of water-bath 7 min of d, per 2 min put upside down mixing once, and agarose is dissolved fully;
E will dissolve rear mixed solution and move into adsorption column, and centrifugal 30 s of 12,000 g outwell the liquid in the collection tube, adsorption column are put into same collection tube again;
F adds 650 μ L washingss in adsorption column, leave standstill 2 min after, centrifugal 30 s of 12,000 g outwell the liquid in the collection tube;
G puts into adsorption column same collection tube again, repeats previous step;
H is reentered into adsorption column in the collection tube, centrifugal 2 min;
I puts into a clean Eppendorf pipe with adsorption column, and central authorities add 30 μ L elutriants at adsorption film, after room temperature leaves standstill 2 min, and centrifugal 1 min of 12,000 g;
The fragment that j 1.0% agarose gel electrophoresis detect to reclaim, the DNA that recovery is obtained is in-20 ℃ of preservations.
3, connect
Use the T4 dna ligase and carry out ligation, system is as follows:
2 * Rapid connects damping fluid 5 μ L
pAd5-Track-CMV vector (50 ng) 1 μL
Trail dna (300 ng) 2 μ L
————————————————————
Cumulative volume to 10 μ L
4, transform
To transform DH5 α competence step as follows for the product that is connected of pAd5-Track-CMV and trail dna:
(1) the DH5 α competent cell of getting 100 μ L places on the ice bath and melts;
(2) 10 μ L are connected product and add in the DH5 α competent cell of 100 μ L, rotate gently the mixing content, place 40 min at ice bath;
(3) place 42 ℃ of water-bath 90 s, do not shake;
(4) rapidly centrifuge tube is transferred in the ice bath, placed 2 min;
(5) the liquid LB substratum of adding 400 μ L places 37 ℃ of shaking tables, and 100 rpm cultivate 45 min;
(6) bacterium liquid is drawn onto on that the LB solid medium plate of card that contains 30 mgL-1, lightly bacterium liquid evenly is coated with out with aseptic elbow glass stick;
(7) sealed membrane seals plate, be inverted, and 37 ℃, baking oven incubated overnight 16 h.
5, the extraction of the single bacterium colony cultivation of the DH5 α behind the conversion recombinant vectors and plasmid
From transforming on the plate the at random single bacterium colony of picking white, be inoculated in the triangular pyramidal bottle of the 10 mL LB liquid nutrient mediums that contain that microbiotic of card (30 mg/L), every pipe is numbered, place 37 ℃ of shaking tables, 180 rpm cultivate 10 h; To being muddy bacterium liquid plasmid extraction (in a small amount) test kit (Shanghai Hua Shun) extracting plasmid, residue bacterium liquid is got 800 μ L and is added 15% glycerine, 200 μ L, is stored in-70 ℃ of refrigerators.
Plasmid after extracting carried out enzyme is cut and sequence verification, prove that goal gene TRAIL has changed in the plasmid, with the correct plasmid called after pAd5-Track-CMV-TRAIL that checks order.
Two, pAd5.TRAIL Vector construction
1, pAd5-Track-CMV-TRAIL carrier PmeI linearizing
The pAd5-Track-CMV-TRAIL carrier carries out single endonuclease digestion according to following system:
10×buffer 4 5 μL
——————————————
Deionized water complements to 50 μ L
Gently behind the mixing in 37 ℃ of incubation 2 h, every pipe full dose is splined on 1.0% agarose gel electrophoresis, reclaims according to above-mentioned recycling step.
2, electric shock changes over to
A with the linearizing pAd5-Track-CMV-TRAIL of PmeI with the deionized water dissolving of 15 μ L and mix;
B starts electroporation apparatus, and the working order of establishing prokaryotic cell prokaryocyte, and setting program is U=1650 V, T=4 ms, and prepares 1 mL nutrient agar in centrifuge tube;
C changes adenovirus skeleton carrier pAdEasy-1 in the BJ5183 bacterial strain over to, and the BJ5183 that will contain again pAdEasy-1 makes competent cell, gets BJ5183 competent cell 50 μ L, melts approximately 4-5 min in ice;
D draws the linearizing pAd5-Track-CMV-TRAIL of PmeI of 1 μ L, adds among the BJ5183 that has melted, and in the mixing adding electroporation cup, after electroporation cup periphery wiped clean, puts into electroporation apparatus, presses the START key, the electroporation reaction of beginning cell;
The LB substratum that e draws 1 mL adds the electroporation reaction system of rinse step d in the electroporation cup, sucks back mixed solution in the centrifuge tube again;
F in 37 ℃, shakes bacterium 1-1.5 h with this bacterium liquid under the 225 rpm conditions;
The above-mentioned bacterium liquid that g draws respectively 100 μ L, 200 μ L is coated with LB flat board (this LB flat board contains kantlex 30 mg/L), 37 ℃ of overnight incubation;
The h second day is observed the bacterial plaque upgrowth situation, picking mono-clonal bacterium colony.
Filter out positive bacterium colony through kantlex, extract positive plasmid, this plasmid is cut evaluation through the EcoRI enzyme, and sample presentation order-checking correct after called after pAd5.TRAIL, pAd5.TRAIL is linearizing pAd5-Track-CMV-TRAIL and the adenovirus carrier of skeleton carrier pAdEasy-1 through homologous recombination formation.
Three, preparation adenovirus Ad5.TRAIL and Ad5.eGFP
1, with PacI linearizing pAd5.TRAIL
PacI is carried out linearizing according to following system:
10×buffer 4 5 μL
DNA 10 μg
———————————————
Deionized water complements to 50 μ L
Carry out according to the method described above electrophoresis and recovery that the DNA enzyme is cut product.
2, with linearizing pAd5.TRAIL transfected HEK 293
The linearizing pAd5.TRAIL that reclaims is according to the adherent HEK293 cell (buying from Chinese Academy of Sciences's Shanghai cell bank) of liposome 2000 step transfections 70% of invitrogen company, be replaced by the DMEM substratum that contains 10% FBS after the transfection, changed one time nutrient solution every 2-3 days, continue to cultivate 10-14 days, the 3rd ~ 5 day at fluorescence microscopy Microscopic observation fluorescence.Treat that cell has plaque pathology (Cytopathic effect, CPE) collecting cell suspension the time, centrifugal 5 min of 2000 r/min, after cell precipitation washs 2 ~ 3 times with aseptic PBS, with cell suspension multigelation 3 times between-80 ℃-37 ℃, discharge virus, the centrifugal 5min of 2000r/min, get supernatant, after infecting, many wheels obtain high titre recombinant adenovirus Ad5.TRAIL, this virus contains eGFP gene and trail dna simultaneously (because pAd5-Track-CMV carrier itself wherein contains the expression of eGFP, after so the adenovirus carrier that forms after the homologous recombination adds goal gene, also can express simultaneously eGFP and goal gene), recording virus titer (pt/mL) by OD260 nm is 5.5 * 10
12The viral nomenclature that contrast virus namely only contains the eGFP gene is Ad5.eGFP, and eGFP is the abbreviation of enhanced green fluorescence protein, in-80 ℃ frozen should virus.
Four, Ad5.TRAIL and Ad5.eGFP infect the A549 cell
1, the cultivation of A549 cell: the A549 cell is placed the DMEM nutrient solution of 10% foetal calf serum, in 37 ℃ of CO
2Cultivate in the incubator; When treating that cell density grows to 70-80%, the cultivation of going down to posterity.
2, inoculating cell: the Non-small cell lung carcinoma cell (A549) in the vegetative period of taking the logarithm is inoculated in 25cm after 0.1% trysinization
2Culturing bottle in, 37 ℃, 5% CO2 incubator was hatched 24 hours.Cell count is about 1 * 10
3
3, virus treated: Ad5.TRAIL and Ad5.eGFP are infected respectively the A549 cell, and after 48 hours, collecting cell carries out detected downstream.
Five, total RNA extracts and reverse transcription reaction
1, extracts total RNA
A gets CO
2Be in cell one dish of logarithmic phase 60 mm plates in the incubator, sop up nutrient solution after, clean 2 times with aseptic 1 * PBS after, add 1 mL Trizol at cell surface, repeatedly aspirate evenly with the rifle head, change in the sterile tube.
The b room temperature is cultivated 5 min, with dissolving nucleoprotein.Add 0.2 mL phenol/chloroform (1:1), thermal agitation 15 sec, incubated at room 2-3 min.
4 ℃ of c, centrifugal 15 min of 12000 g, cell can produce layering.
D goes to supernatant liquid in the centrifuge tube without RNase, adds 0.5 mL Virahol, puts upside down mixing 3 times, and room temperature is cultivated 10 min.
4 ℃ of e, centrifugal 10 min of 12000 g, RNA forms bottom settlings.
F abandons supernatant, uses 75% ethanol, the 1 mL washing precipitation without RNase.4 ℃, centrifugal 5 min of 7000 g.
The about 5-10 min of g air drying RNA.Should not be too dried.
H 30-50 μ L DEPC water dissolution RNA.
2, cDNA's is synthetic
A adds following reaction mixture in the test tube of precooling:
Total RNA 1-5 μ g
oligo(dT)(0.5 μg/μl) 1 μL
Be settled to 12 μ L with RNase-free water.
The b mixing, centrifugal 3-5 sec.
Ice bath 30 sec behind 70 ℃ of effects of c, 5 min, centrifugal 3-5 sec.
D adds following component again with the test tube ice bath:
5 * reaction buffer, 4 μ L
Rnase Inhibiter (20 U/μL) 1 μL
dNTP mix (10 mM) 2 μL
E is mixing gently, centrifugal 3-5 sec.
37 ℃ of water-bath 5 min of f add the M-MuLV Reverse Transcriptase (20 U/ μ L) of 1 μ L, mixing.
37 ℃ of effects of g, 60 min.Hatch 10 min for 70 ℃ and finish reaction, put and carry out downstream tests on ice.
Six, real-time fluorescence quantitative PCR reaction detection apoptosis pathway
The present invention is by detecting in conjunction with real-time fluorescence quantitative PCR with the reagent that detects apoptosis pathway, and described detection reagent comprises that one group is detected the nucleotide sequence of anti-apoptotic gene, one group of nucleotide sequence that detects halfcystine and aspartase activity gene, one group of nucleotide sequence and nucleotide sequence that detects confidential reference items GAPDH controlling gene that detects the cell death inducing gene.The nucleotide sequence of described anti-apoptotic gene can detect the expression of the gene of anti-apoptotic; Halfcystine enzyme and L-Aspartase are the last expression products of apoptosis, and the nucleotide sequence of described halfcystine and aspartase activity gene can detect the expression of apoptosis downstream gene; The nucleotide sequence of described cell death inducing gene can detect the expression of activating cells apoptosis-related genes.
This experiment is divided into two groups, i.e. Ad5.TRAIL and Ad5.eGFP group.Every group arranges respectively 36 holes, and wherein 12 holes are independent sample, and each sample respectively has 3 repetitions.Add respectively the primer of BAX gene, ANGPTL4 gene, IL1A gene, MYBL2 gene, PEA15 gene, PRKAA1 gene, BIRC5 gene, CASP1 gene, DAPK3 gene, NUDT2 gene and confidential reference items GAPDH controlling gene in every group of 11 hole, another hole adds entry in contrast.
1, one group is used for the nucleotide sequence that real-time fluorescence quantitative PCR detects anti-apoptotic gene:
(1) BAX gene, namely relevant X protein (the BCL2-associated X protein) gene of BCL2 family uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
BAX forward primer 5'-GGGTGGTTGGGTGAGACTC-3'(SEQ ID No:1)
BAX reverse primer 5'-AGACACGTAAGGAAAACGCATTA-3'(SEQ ID No:2)
Amplify the BAX gene, the Genbank accession number is: NM_004324, fragment length are 191bp.
(2) ANGPTL4 gene, i.e. angiogenin similar protein 4(angiopoietin-like4) gene,
Use a pair of polymerase chain reaction primer of artificial design, increase, its nucleotide sequence is as follows:
ANGPTL4 forward primer 5'-GTCCACCGACCTCCCGTTA(SEQ ID No:3)
ANGPTL4 reverse primer 5'-CCTCATGGTCTAGGTGCTTGT(SEQ ID No:4)
Amplify the ANGPTL4 gene, the Genbank accession number is: NM_001039667, expanding fragment length are 212bp.
(3) IL1A gene, namely interleukin-11 A uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
ATCATGTAAGCTATGGCCCACT(SEQ ID No:5)
CTTCCCGTTGGTTGCTACTAC(SEQ ID No:6)
Amplify the IL1A gene, the Genbank accession number is: NM_000575, expanding fragment length are 131bp.
(4) MYBL2 gene, namely v-myb avian myeloblastosis virus oncogene homologue sample 2 uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
ATCGCCAAGATGTTGCCAGG(SEQ ID No:7)
GGACTCGCTCAAGAAGCCT(SEQ ID No:8)
Amplify the MYBL2 gene, the Genbank accession number is: NM_002466, expanding fragment length are 102bp.
(5) PEA15 gene, namely astroglia cell enriches phosphorprotein 15, uses a pair of polymerase chain reaction primer of artificial design, increases, and its nucleotide sequence is as follows:
CCTGACCTACTCACTATGGTGG(SEQ ID No:9)
GCTGCCGGATAATGTCTTTGTA(SEQ ID No:10)
Amplify the PEA15 gene, the Genbank accession number is: NM_003768, expanding fragment length are 127bp.
(6) PRKAA1 gene, i.e. protein kinase alpha 1 catalytic subunit of AMP activation uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
GCGACAAGCCCACCTGATT(SEQ ID No:11)
TGTTTCAGCAACCAAGAATGGTA(SEQ ID No:12)
Amplify the PRKAA1 gene, the Genbank accession number is: NM_006251, expanding fragment length are 87bp.
2, one group of real-time fluorescence quantitative PCR detects the nucleotide sequence of halfcystine and aspartase activity gene
(1) BIRC5 gene, namely baculovirus IAP repeat region 5 uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
AGGACCACCGCATCTCTACAT(SEQ ID No:13)
AAGTCTGGCTCGTTCTCAGTG(SEQ ID No:14)
Amplify the BIRC5 gene, the Genbank accession number is: NM_001012270, expanding fragment length are 118bp.
(2) CASP1 gene, namely cysteine aspartase 1, uses a pair of polymerase chain reaction primer of artificial design, increases, and its nucleotide sequence is as follows:
TCCAATAATGGACAAGTCAAGCC(SEQ ID No:15)
GCTGTACCCCAGATTTTGTAGCA(SEQ ID No:16)
Amplify the CASP1 gene, the Genbank accession number is: NM_001223, expanding fragment length are 139bp.
3, the nucleotide sequence of one group of real-time fluorescence quantitative PCR reaction detection cell death inducing gene
(1) DAPK3 gene, namely death-associated protein kinase 3, use a pair of polymerase chain reaction primer of artificial design, increase, and its nucleotide sequence is as follows:
TCACTACCTGCACTCTAAGCG(SEQ ID No:17)
TTCCCCGCCTCGATCTTGT(SEQ ID No:18)
Amplify the DAPK3 gene, the Genbank accession number is: NM_001348, expanding fragment length are 135bp.
(2) NUDT2 gene, i.e. the X composition type primitive 2 of nucleoside diphosphate connection uses the artificial a pair of polymerase chain reaction primer that designs, and increases, and its nucleotide sequence is as follows:
GCCTTGAGAGCATGTGGCTT(SEQ ID No:19)
ATGAATGCCATCTGATGCCTG(SEQ ID No:20)
Amplify the NUDT2 gene, the Genbank accession number is: NM_147173, expanding fragment length are 105bp.
4, the nucleotide sequence of one group of real-time fluorescence quantitative PCR reaction detection confidential reference items GAPDH controlling gene (glyceraldehyde-3-phosphate dehydrogenase)
TCATGGGTGTGAACCATGAGAA(SEQ ID No:21)
GGCATGGACTGTGGTCATGAG(SEQ ID No:22)
Amplify confidential reference items GAPDH controlling gene, the Genbank accession number is: NM_002046, expanding fragment length are 146bp.
Carry out the real time fluorescent quantitative poly chain reaction with above-mentioned primer, its reaction system is as follows: 2 * SYBR Premix Ex Taq polymeric enzyme reaction mixed solution, 20 μ l, upstream primer 0.2 μ mol, downstream primer 0.2 μ mol, cDNA template 50ng, sterile purified water supply 40 μ l.
Carry out following response procedures behind the mixing: 95 ℃, 5 minutes, a circulation; 98 ℃, 10 seconds, 55 ℃, 20 seconds, 72 ℃, 15 seconds, 40 circulations.The solubility curve routine analyzer: 95 ℃, 0 second, 65 ℃, 15 seconds.This polymerase chain reaction is in the operation of real time fluorescent quantitative poly chain reaction instrument.
The expression amount of range gene is made Fig. 1, wherein be higher than 2 the high expression level that is, be lower than 0.5 the low expression that is, shown among Fig. 1 that BAX gene, ANGPTL4 gene and MYBL2 gene are high expression level, IL1A gene, PEA15 gene, PRKAA1 gene, BIRC5 gene, CASP1 gene and NUDT2 gene are middle expression, and the DAPK3 gene is expressed for low.
The present invention obtains carrier with expression vector pAd5-Track-CMV after with SalI and HindIII double digestion, pGEMT/TRAIL plasmid with goal gene TRAIL reclaims the purpose fragment behind SalI and HindIII double digestion, connect to transform and obtain positive colony called after pAd5-Track-CMV-TRAIL, pAd5-Track-CMV-TRAIL is after the PmeI enzyme is cut, electricity changes among the BJ5183, filter out positive plasmid through blocking that, called after pAd5.TRAIL.With the linearizing pAd5.TRAIL transfected HEK 293 of PacI, karyon increases after 7-10 days, cell rounding, prolongation along with the time, a large amount of green fluorescences appear because expressing eGFP, and CP (Cytopathic effect, CPE) appears, the homologous recombination success is described and had infectious adenovirion.Continuation to adenovirus increase, purifying obtains virus stock solution used Ad5.TRAIL, record virus titer (pt/mL) by OD260 nm and be divided into 5.5 * 1012.Control plasmid called after Ad5.eGFP.Behind Ad5.TRAIL and Ad5.eGFP infection A549 cell, extract total RNA and reverse transcription reaction, the reagent that utilizes detection apoptosis pathway provided by the invention can increase by quantitative fluorescent PCR and obtain the collection of illustrative plates of special signal path gene, for the apoptotic signal path of research purpose gene provides the most direct evidence.
Above embodiment is only in order to illustrating technical scheme of the present invention, but not limits it; Although with reference to previous embodiment the present invention is had been described in detail, for the person of ordinary skill of the art, still can make amendment to the technical scheme that previous embodiment is put down in writing, perhaps part technical characterictic wherein is equal to replacement; And these modifications or replacement do not make the essence of appropriate technical solution break away from the spirit and scope of the present invention's technical scheme required for protection.
SEQUENCE LISTING
<110〉Hospital Attached to Medical College, Qingdao Univ.
<120〉a kind of reagent and PCR detection method that detects apoptosis pathway
<160> 22
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213〉artificial sequence
<400> 1
gggtggttgg gtgagactc 19
<210> 2
<211> 23
<212> DNA
<213〉artificial sequence
<400> 2
agacacgtaa ggaaaacgca tta 23
<210> 3
<211> 19
<212> DNA
<213〉artificial sequence
<400> 3
gtccaccgac ctcccgtta 19
<210> 4
<211> 21
<212> DNA
<213〉artificial sequence
<400> 4
cctcatggtc taggtgcttg t 21
<210> 5
<211> 22
<212> DNA
<213〉artificial sequence
<400> 5
atcatgtaag ctatggccca ct 22
<210> 6
<211> 21
<212> DNA
<213〉artificial sequence
<400> 6
cttcccgttg gttgctacta c 21
<210> 7
<211> 20
<212> DNA
<213〉artificial sequence
<400> 7
atcgccaaga tgttgccagg 20
<210> 8
<211> 18
<212> DNA
<213〉artificial sequence
<400> 8
gactcgctca agaagcct 18
<210> 9
<211> 21
<212> DNA
<213〉artificial sequence
<400> 9
cctgacctact cactatggtg g 21
<210> 10
<211> 21
<212> DNA
<213〉artificial sequence
<400> 10
gctgccggata atgtctttgt a 21
<210> 11
<211> 19
<212> DNA
<213〉artificial sequence
<400> 11
gcgacaagcc cacctgatt 19
<210> 12
<211> 23
<212> DNA
<213〉artificial sequence
<400> 12
tgtttcagca accaagaatg gta 23
<210> 13
<211> 20
<212> DNA
<213〉artificial sequence
<400> 13
aggaccaccgc atctctacat 20
<210> 14
<211> 20
<212> DNA
<213〉artificial sequence
<400> 14
aagtctggctc gttctcagtg 20
<210> 15
<211> 22
<212> DNA
<213〉artificial sequence
<400> 15
tccaataatgg acaagtcaag cc 22
<210> 16
<211> 23
<212> DNA
<213〉artificial sequence
<400> 16
gctgtacccc agattttgta gca 23
<210> 17
<211> 21
<212> DNA
<213〉artificial sequence
<400> 17
tcactacctg cactctaagc g 21
<210> 18
<211> 19
<212> DNA
<213〉artificial sequence
<400> 18
ttccccgcct cgatcttgt 19
<210> 19
<211> 20
<212> DNA
<213〉artificial sequence
<400> 19
gccttgagag catgtggctt 20
<210> 20
<211> 21
<212> DNA
<213〉artificial sequence
<400> 20
atgaatgcca tctgatgcct g 21
<210> 21
<211> 22
<212> DNA
<213〉artificial sequence
<400> 21
tcatgggtgt gaaccatgag aa 22
<210> 22
<211> 21
<212> DNA
<213〉artificial sequence
<400> 22
ggcatggact gtggtcatga g 21
Claims (1)
1. a real-time fluorescence quantitative PCR detects the reagent of apoptosis pathway, it is characterized in that it comprises following primer:
(1) PCR that detects the BAX gene reacts primer, and its primer sequence is as follows:
5'-GGGTGGTTGGGTGAGACTC-3';
5'-AGACACGTAAGGAAAACGCATTA-3';
(2) PCR that detects the ANGPTL4 gene reacts primer, and its primer sequence is as follows:
5'-GTCCACCGACCTCCCGTTA-3';
5'-CCTCATGGTCTAGGTGCTTGT-3';
(3) PCR that detects the IL1A gene reacts primer, and its primer sequence is as follows:
5'-ATCATGTAAGCTATGGCCCACT-3';
5'-CTTCCCGTTGGTTGCTACTAC-3';
(4) PCR that detects the MYBL2 gene reacts primer, and its primer sequence is as follows:
5'-ATCGCCAAGATGTTGCCAGG-3';
5'-GGACTCGCTCAAGAAGCCT-3';
(5) PCR that detects the PEA15 gene reacts primer, and its primer sequence is as follows:
5'-CCTGACCTACTCACTATGGTGG-3';
5'-GCTGCCGGATAATGTCTTTGTA-3';
(6) PCR that detects the PRKAA1 gene reacts primer, and its primer sequence is as follows:
5'-GCGACAAGCCCACCTGATT-3';
5'-TGTTTCAGCAACCAAGAATGGTA-3';
(7) PCR that detects the BIRC5 gene reacts primer, and its primer sequence is as follows:
5'-AGGACCACCGCATCTCTACAT-3';
5'-AAGTCTGGCTCGTTCTCAGTG-3';
(8) PCR that detects the CASP1 gene reacts primer, and its primer sequence is as follows:
5'-TCCAATAATGGACAAGTCAAGCC-3';
5'-GCTGTACCCCAGATTTTGTAGCA-3';
(9) PCR that detects the DAPK3 gene reacts primer, and its primer sequence is as follows:
5'-TCACTACCTGCACTCTAAGCG-3';
5'-TTCCCCGCCTCGATCTTGT-3';
(10) PCR that detects the NUDT2 gene reacts primer, and its primer sequence is as follows:
5'-GCCTTGAGAGCATGTGGCTT-3';
5'-ATGAATGCCATCTGATGCCTG-3';
(11) PCR that detects confidential reference items GAPDH controlling gene reacts primer, and its primer sequence is as follows:
5'-TCATGGGTGTGAACCATGAGAA-3';
5'-GGCATGGACTGTGGTCATGAG-3';
The reaction system of described real-time fluorescence quantitative PCR is: Taq polymeric enzyme reaction mixed solution 20 μ l, and upstream primer 0.1-0.5 μ mol, downstream primer 0.1-0.5 μ mol, cDNA template 50-200ng, sterile purified water supply 40 μ l;
Described Taq polysaccharase is 2 * SYBR Premix Ex Taq polysaccharase;
The response procedures of described real-time fluorescence quantitative PCR is: 95 ℃ of denaturations, 5 minutes; 98 ℃ of sex change 10 seconds, 55 ℃, 20 seconds, 72 ℃, 15 seconds, are carried out 40 circulations.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110228207 CN102251050B (en) | 2011-08-10 | 2011-08-10 | Reagent for detecting cell apoptosis signal path and PCR method using same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110228207 CN102251050B (en) | 2011-08-10 | 2011-08-10 | Reagent for detecting cell apoptosis signal path and PCR method using same |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102251050A CN102251050A (en) | 2011-11-23 |
CN102251050B true CN102251050B (en) | 2013-03-20 |
Family
ID=44978618
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201110228207 Expired - Fee Related CN102251050B (en) | 2011-08-10 | 2011-08-10 | Reagent for detecting cell apoptosis signal path and PCR method using same |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102251050B (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106167819A (en) * | 2016-04-23 | 2016-11-30 | 同济大学苏州研究院 | A kind of primer for detecting humanized's BAX gene expression dose combines and application |
CN111808958A (en) * | 2020-07-13 | 2020-10-23 | 青岛市市立医院 | PCR reagent for detecting apoptosis signal path and application thereof |
CN111690750A (en) * | 2020-07-13 | 2020-09-22 | 青岛市市立医院 | PCR reagent for detecting molecular expression of cell P53 signal path and application thereof |
CN111690751A (en) * | 2020-07-13 | 2020-09-22 | 青岛大学附属医院 | PCR reagent for detecting tumor drug target and application thereof |
-
2011
- 2011-08-10 CN CN 201110228207 patent/CN102251050B/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN102251050A (en) | 2011-11-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102251050B (en) | Reagent for detecting cell apoptosis signal path and PCR method using same | |
US20210363529A1 (en) | RNAi nano-preparation, preparation method thereof and application thereof in TMV prevention and control | |
JP2022535039A (en) | RECOMBINANT ONCOLYTIC VIRUSES AND THEIR PREPARATION, USE AND MEDICINES | |
CN103981155A (en) | Construction method and application of targeting hepatoma oncolytic adenovirus | |
CN101921769B (en) | Recombinant adenovirus, preparation method and application thereof | |
CN101654685B (en) | Human Bcl-2 and human VEGF165 double-gene co-expression recombinant vector and building method thereof | |
CN113416768B (en) | Application of PRKRA gene as target in inhibiting replication of peste des petits ruminants virus | |
JP2019517471A (en) | Compositions and methods using MIR-302 precursor as an anti-cancer drug to treat human lung cancer | |
CN102453757B (en) | Application of micro RNA and antisense nucleic acid thereof in diagnosis, prevention, treatment and/or prognosis evaluation of myocardial ischemic injury | |
CN110577934B (en) | Construction method and application of TLR4 gene knocked-down porcine alveolar macrophage cell line | |
CN105039342A (en) | siRNA capable of inhibiting MAT2A genetic expression and application of siRNA | |
CN100392084C (en) | Recombinant adenovirus containing codon optimized type IIPV16L1 gene | |
Zheng et al. | Pathology, viremia, apoptosis during MDV latency in vaccinated chickens | |
CN101906417B (en) | shRNA for hepatitis B virus and recombinant adeno-associated virus vector treating vector carrying same | |
CN101921757B (en) | Standard positive reference material for rana grylio virus (RGV) detection | |
CN111041001A (en) | Safe coxsackie virus for treating KRAS mutant tumors and pharmaceutical composition thereof | |
CN114917325A (en) | Application of human soluble TIM-4 protein in preparation of antitumor drugs | |
CN111500632B (en) | Oncolytic adenovirus construction for expressing ST13 and TRAIL and application thereof | |
CN111471715A (en) | Adenovirus vector and construction method and application thereof | |
CN106811484A (en) | A kind of ox PDHB gene adenovirus interference carrier builds and its authentication method | |
CN102229928B (en) | Small-interfering RNA (Ribonucleic Acid) of human RBBP6 (Retinoblastoma-binding Proteingene) and application thereof | |
CN101864400A (en) | Specific recombinant adenoviruses, preparation thereof and use thereof | |
CN105561340A (en) | Application of Bombyx mori apoptosis related miRNA in anti-viral infection | |
CN101219222B (en) | Application of PDCD4 recombined expression vector in preparing medicament for treating gonad cancer | |
CN110904056A (en) | Infectious bronchitis virus rH120-YZS1 delta 5a and construction method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130320 Termination date: 20130810 |