CN102250951A - Method for cultivating zebrafish with fluorescence conversion function in cardiovascular system by using artificial chromosome recombinant technology - Google Patents

Abstract

The invention discloses a method for cultivating zebrafish with a fluorescence conversion function in a cardiovascular system by using an artificial chromosome recombinant technology. By the technology provided by the invention, cardiovascular system transgenic lines capable of converting blue fluorescence into yellow fluorescence are built. The method comprises the steps: 1) acquiring specific artificial chromosome and building a target gene; 2) recombining and inserting the artificial chromosome to the target gene; 3) introducing the artificial chromosome recombinant into fertilized eggs of zebra fish; and 4) screening positive transgenic lines. The technology provided by the invention is an internationally leading bacterial artificial chromosome recombinant engineering technology, greatly improves the efficiency of the transgenic construction, and potentially provides a powerful tool for the biomedical basic research and drug research in China.

Description

A kind of method of using the artificial chromosome recombinant technology to cultivate cardiovascular systems fluorescence conversion zebra fish

Technical field

The invention belongs to bioengineering field, relate to a kind of recombined engineering technology of bacterial artificial chromosome, and use the method that its structure cardiovascular systems has blue-fluorescence and can be exchanged into the transgenic zebrafish model of yellow fluorescence.

Background technology

Heart is the organ of first growth of human body, is that the energy of all vital movements is supplied with the power center (PC).It is by great vessels, and the compressing blood flow of the recycle system pulsed that capillary blood vessel and blood make up is taken away meta-bolites simultaneously with oxygen and nutrition supply tissue and organ.Cardiovascular disorder is the highest disease of mortality ratio, and annual nearly 30% death is relevant with it.Endotheliocyte is the cell of cardiovascular innermost layer, has multiple synthetic and metabolic function, comprise and regulate thrombus and dissolving thereof, and platelet adhesion reaction, the modulating vascular rhythm and pace of moving things and blood flow, by the control white corpuscle, monocyte and lymphocyte are regulated immunity and inflammatory reaction.The damage of endotheliocyte can cause multiple fatal cardiovascular disordeies such as atherosclerosis and myocardial infarction.Vascular endothelial growth factor (VEGF) acceptor FlkExtensively be distributed in whole cardiovascular endothelial system, for model animal zebra fish cardiovascular systems FlkGene carries out fluorescent mark, easily observational study cardiovascular pathology process. Cre-LoxPRecombinase system obtains widespread use in novel gene is practiced shooting, be the technological core of conditional gene target practice, inducibility gene targeting, space-time specific gene target practice strategy.Based on Cre-loxPThe fluorescence transition function of system can be monitored in cardiovascular expression genes involved, discloses the relation of gene and disease.

Bacterial artificial chromosome (Bacterial artificial chromosome, BAC) be a kind of system based on bacterial plasmid, be widely used in gene order-checking and collection of illustrative plates and draw, the position cloning of disease gene begins to be used to the foundation of transgenic animal recently.For other cloning systems, there are very strong operability and application advantage in the BAC system.BAC has carried complete genetic expression promotor and corresponding controlling element, to making up high precision transgenic zebrafish system and other transgenic animal extremely important meaning is arranged.The BAC system can be counted as a bigger plasmid, with the routine techniques compatibility of all molecular genetics.Carry out the BAC reorganization by recombinant bacterial strain SW105, the convenient BAC that modifies accurately.This engineering bacteria provides Exo, BetaWith Gam3 kinds of functions, GamThe linear DNA that protection imports exempts from RecBCDEnzyme is cut, Exo5 ' to 3 ' exonucleolytic activity is provided, BetaWith combined by the single stranded DNA after circumscribed, protection is provided.

The artificial chromosome reorganization has been merged in the present invention, Cre-loxPMultiple technologies such as system by technical optimization, have improved efficient, have made up high-precision cardiovascular systems fluorescence conversion zebra fish, for genome times afterwards comprehensively cardiovascular disorder and gene functional research and application provide effective tool.

Summary of the invention

Goal of the invention

The invention provides a kind of method that cardiovascular systems has blue-fluorescence and can be exchanged into the transgenic zebrafish model of yellow fluorescence that makes up.

Technical scheme

A kind of method of using the artificial chromosome recombinant technology to cultivate cardiovascular systems fluorescence conversion zebra fish, its feature realizes in following steps:

A, FlkBAC imports engineering bacteria SW105, wherein FlkBAC is CH211-231B5;

B, adopt purpose fragment 5 ' primer: 5 '-CATACGAGTATCATTCGGGGTTATTTTAACAG ACAAAATTAATTCAGACGCGCAAGTTTGTACAAAAAAGAGGCT-3 ' and

Purpose fragment 3 ' primer: the fluorescence transformer element among 5 '-ATAACACAAAAAGCGACACTTACCATGTGAAA TACAACGGCTAGTCTTTCCAGAGTAGTGAGGAG-3 ' amplification pPCRBloxYkanFrt;

The electric shock of C, fluorescence transformer element imports and contains the flk-BAC competent cell, and a large amount of the cultivation;

D, removing are inserted gene fragment and are with the screening resistance;

Integration efficiency is improved in E, introducing Tol/ISceI swivel base site: wherein Tol/ISceIInsert site 1 primer:

Upstream primer: 5 ' ACCCAATTCACCTGTAGCGCATGGACTAGAGATGAAGCTTGG TACCGAGCTCGGATCCACTAGTACGGC-3 '

Downstream primer: 5 ' GATCTGCAGCATATCATGCGTGTAATATGAGAGACGAGCTC GGATCCGAACAAACGACCC-3 '

Tol/ISceI inserts site 2 primers:

Upstream primer: 5 ' GGGCATCGGTGAGCTTGACATTGTAGGACTATATTGCTCG AGCGGCCG CCAGTGTGATGG-3 '

Downstream primer: 5 ' CTGTTCCTGCGCCCGAAGAGTCTTGTGGTAAGTTTGTGCAGG CGGCCGCATTCCC-3 ';

The injection of F, zebrafish embryo;

G, the screening of potential success genetically engineered fish.

Beneficial effect

1) for vascular endothelial growth factor (VEGF) acceptor of cardiovascular systems wide expression FlkCarry out fluorescent mark.

2) employing is complete FlkGenetic expression promotor and corresponding controlling element reach to regulate the fluorescence report sublist, but not the short segmental plasmid construction of simple parts.

3) the major technique details comprises FlkHandle the early stage of BAC, design of primers, and the preparation of competence engineering bacteria, temperature-induced reorganization, FlkIdentify and a large amount of extractive technique after the reorganization of BAC.

4) need not to separate promotor,, improved the popularity that transgenic lines makes up to a great extent, for preclinical medicine and applied science research provide freedom with respect to being subject to the technology that promotor makes up the transgenic lines of mark.

5) the art of this patent has merged the swivel base technology of recent appearance when using the BAC recombined engineering, uses Tol2With IsceITransposon has improved artificial chromosome and has been incorporated into the genomic efficient of zebra fish, has improved the success ratio that makes up.

6) after will recombinating FlkBAC imports zebrafish embryo.Comprise micro-injection method, dosage step, the Fo mating screening scheme of optimization.

Description of drawings

Fig. 1 vascular system marker gene FlkBAC clone: CH211-231B5 structural representation;

Fig. 2 is inserted into the blue flavescence look fluorogene sequence plasmid among the BAC;

Fig. 3 is inserted into the swivel base gene order plasmid among the BAC, comprises Tol2And IsceIThe site;

Fig. 4 cre-lox principle schematic: the gene that does not add cre is only expressed blue-fluorescence, does not express fragment after the termination signal.Can recombinate in the cutting of lox site after adding cre, therefore gene expresses yellow fluorescence;

Fig. 5 bacterial artificial chromosome reorganization principle schematic;

The BAC enzyme was cut the evaluation agarose gel electrophoresis after Fig. 6 recombinated;

The transgenic zebrafish cardiovascular systems that Fig. 7 builds is blue-fluorescence, CreBe converted into yellow fluorescence under the effect of mRNA;

Fig. 8 is inserted into the blue flavescence look fluorogene sequence plasmid among the BAC, and its electrophoresis detection is determined PCR result's electrophorogram.

Embodiment

Embodiment 1: the zebra fish transgenic lines of cultivating cardiovascular system regiment commander's fluorescence and can carry out the fluorescence color conversion.

Contain FlkThe preparation of BAC engineering bacteria

1) FlkThe source of BAC

FlkGene is distributed widely in cardiovascular systems, and its BAC clone is: CH211-231B5(Fig. 1), this information can be directly to the zfin.org inquiry.Use among the present invention FlkBAC is available from CHORI-211 library (Children's Hospital Oakland Research Institute in Oakland, California, USA. http://bacpac.chori.org), FlkThe size of BAC is 156.559kb, and sequence sees GenBank:BX24796.6 for details.

2) FlkBAC imports engineering bacteria SW105

A. will contain Flk(Children's Hospital Oakland Research Institute in Oakland, California USA) are containing the LB culture medium flat plate line of 12.5 μ g/ml chlorampenicol resistants, 37 to BAC clone's bacterial strain ^oThe C overnight incubation.

B. 4 clones of picking are containing the 5ml LB liquid state substratum 37 of 12.5 μ g/ml chlorampenicol resistants ^oThe C overnight incubation.

C. carry out a small amount of of BAC and extract, referring to following step 5.

D. use SpeI 37 ^oThe C enzyme is cut and is spent the night, and whether electrophoresis detection BAC size is correct on 0.7% sepharose.

E. with the SW105 bacterial strain (SW105, available from National Cancer Institute at Frederick, USA) in the LB of 5ml antibiotic-free nutrient solution, 30 ^oThe C jolting is spent the night.Next day, 1:100 is diluted in the 25ml nutrient solution, in 30 ^oC jolting 4-5 hour is 0.6 up to the OD600 value.

F. bacterium liquid is cooled off 2min, 5000g, 0 in ice ^oThe centrifugal 3min of C.

G. remove supernatant, add the 1ml frozen water, resuspended 15min in ice.Add the 9ml frozen water then, resuspended.

H.5000g, 0 ^oThe centrifugal 3min of C removes supernatant.Be resuspended in the 1ml frozen water.Shift the resuspended bacterium liquid of 1mL to the Eppendorf pipe of precooling.Desk-top little whizzer 2min changes for 4 ℃ centrifugal 14000, after 2min is centrifugal, removes 900 μ L supernatants, the resuspended 100 μ L that are deposited in.

I. 100 μ L bacterium liquid are changed over to electricity and transform in the ware, setup parameter is 25 μ F, and 1.75 kV and 200 ohms. electric shock back add 1mL room temperature SOC to sulculus at once.Shift bacterium liquid to new eppendorf pipe, 32 ℃ of shaking tables are cultivated 1h.Beginning preheating culture plate.After the 1h rejuvenation, room temperature 14000 leaves heart 1min.Remove 850 μ L supernatants, be resuspended in the 150 μ L supernatants.With all 150 μ L coated plates.32 ℃ of incubated overnight.Bacterium is poor growth under this temperature, just can see the clone so wait for the long period.

J. 4 clones of picking are containing the 5ml LB liquid state substratum 37 of 12.5 μ g/ml chlorampenicol resistants ^oThe C overnight incubation.Carry out a small amount of of BAC and extract, referring to following step 5.Use SpeI 37 ^oThe C enzyme is cut and is spent the night, and electrophoresis identifies whether BAC is correct on 0.7% sepharose.

K. will identify that correct bacterial strain preservation is stand-by.Add 330 μ L60% glycerine in 1mL bacterium liquid, subzero 80 ℃ frozen.

. be used to insert the preparation of the fluorescence transformer element of BAC

1) fluorescence report gene plasmid template and design of primers

The fluorescence report gene is included among the plasmid pPCRBloxYkanFrt (seeing Seq NO.1), uses following primer with this purpose fragment amplification (plasmid template such as Fig. 2).This plasmid contains Cre-loxpAction site, principle of work such as Fig. 4.

Purpose fragment 5 ' primer: 5 '-CATACGAGTATCATTCGGGGTTATTTTAACAG ACAAAATTAATTCAGACGCGCAAGTTTGTACAAAAAAGAGGCT-3 ' (seeing Seq NO.3)

Purpose fragment 3 ' primer: 5 '-ATAACACAAAAAGCGACACTTACCATGTGAAA TACAACGGCTAGTCTTTCCAGAGTAGTGAGGAG-3 ' (seeing Seq NO.4)

2) amplification of order gene fragment and purifying

The PCR reaction is set, and use Failsafe test kit (FailSafe PCR System, available from Epicentre biotechnologies, USA) amplification long segment, the template amount is 1 ng DNA.Electrophoresis detection is determined the correct back of PCR result (as Fig. 8), uses the QIAquick purifying, and every post is lower than 400 milligrams of agaroses, is eluted to 40 μ L deionized waters.Per 40 μ L elution samples add 2-3 μ l DpnI enzyme and cut 60 min, remove template.Reaction conditions is as follows:

160 μ l PCR products

20 μl 10x buffer 4

10 μl H ₂O

10 μl DpnI

200 μ l cumulative volumes

Enzyme is cut the back in 1% agarose gel electrophoresis separated product, uses the Minelute purifying.The PCR product equally also uses the Minelute post to carry out purifying.200 μ L samples add 600 μ l QG solution and 200 μ L Virahols, go up sample behind the mixing.Use PE solution to clean twice, 750 μ L, 250 μ L for the second time for the first time, at least 5 times 30 seconds centrifugal all PE that remove more renew pipe at every turn; Be eluted to behind the complete drying in the 12 μ L water.Obtain fluorescence transformer element, measure its concentration, normal concentration is not less than 100 μ g/mL.

Contain Flk-BAC The preparation of competent cell

Be ready to culture dish, it is correct that resistance is wanted, preparation 5mL incubated overnight Flk(from step 1), 32 ℃ of culture temperature add chlorampenicol resistant and LB substratum to BAC bacterium liquid.Overnight incubation, the bacterium liquid of dilution 2mL incubated overnight causes 25mL, adds paraxin.600 nanometers are measured the OD value, are approximately 0.015 to 0.02.Open refrigerated centrifuge, fast cooling mode.Be ready to 42 ℃ of shaking baths.Be ready to the 100mL aqua sterilisa, 2 electricity transform little cylinders, 2 eppendorf pipes, 2 15mL test tubes and ice.Be ready to culture dish, it is correct that resistance is wanted.When the 25mL nutrient solution reaches the about 0.055-0.066 of light absorption value, shift the 12.5mL nutrient solution to another Erlenmeyer flask.15min is induced in 42 ℃ of water-baths, puts into 32 ℃ of conducts and does not induce group for other one bottle.Behind the 5min, two bottles are placed on ice rapidly, cool off about 10min.Shift 10 mL cultivation bacterium liquid and place the 14mL pipe of precooling, subzero 4 ℃ 5000 leaves heart 3min.Remove supernatant after centrifugal.Add the ice-cold sterilized water of 1mL, in frozen water, shake resuspended precipitation 5 to 10min.Subzero 4 ℃ 5000 leaves heart 3min.After repeating 3 times, resuspended on ice fast bacterium liquid.Shift the resuspended bacterium liquid of 1mL to the Eppendorf pipe of precooling.Desk-top little whizzer 2min4 ℃ centrifugal 14000 is changeed, and after 2min is centrifugal, removes 900 μ L supernatants, and the resuspended 100 μ L that are deposited in obtain to contain Flk-BAC competent cell bacterium liquid.

. the electric shock of fluorescence transformer element imports

Join 5 μ L fluorescence transformer elements resuspended FlkIn-BAC cell bacterium the liquid, twice of mixing.Transitional cell-DNA mixture confirms that cell is positioned between metal sheet to the sulculus of precooling.Use 1.7 kV fax hole devices.The electric shock back adds 1mL room temperature SOC to sulculus at once.Shift bacterium liquid to new eppendorf pipe, 32 ℃ of shaking tables are cultivated 1h.Beginning preheating culture plate.After the 1h rejuvenation, room temperature 14000 leaves heart 1min.Remove 850 μ L supernatants, be resuspended in the 150 μ L supernatants.With all 150 μ L coated plates.32 ℃ of incubated overnight.Bacterium is poor growth under this temperature, just can see the clone so wait for the long period.For the reorganization of success, can see having greater than 1000 being cloned on the inductive plate, but not have on the inductive plate.Choose 6 clones from ductor, be inoculated in the LB pipe of 5mL, add corresponding microbiotic, 32 ℃ are shaken bacterium and spend the night.Obtain bacterium liquid and be used for ensuing extraction and evaluation.Reaction principle as shown in Figure 5;

5.BAC a small amount of extract and identify

Shake the 5mL that spends the night from 32 ℃ and obtain to get 4mL the bacterium liquid, 4500 leave heart 15min.Remove supernatant, add 250 μ LP1 solution (50 mM TrisCl, pH 8.0; 10 mM EDTA, 100 μ g/ml RNase A), resuspended bacterium liquid is transferred in the eppendorf pipe.Add 250 μ LP2 (200 mM NaOH, 1% SDS), the static 5min of room temperature.Add 250 μ LN1 (1.6 M NaCl; 50 mM MOPS, pH 7.0; 15% isopropanol), little whizzer 14000 centrifugal 5min, supernatant is transferred in the new eppendorf pipe.Repeated centrifugation is collected supernatant.Add 750 μ L Virahols, subzero 20 ℃ leave standstill more than the 10min.High speed centrifugation 10min removes supernatant, and 70% ethanol cleans, and drying obtains BAC in a small amount.Resuspendedly put in the 40 μ L endonuclease reaction liquid 34 μ L water, 4 μ L10x damping fluids, 2 μ L enzymes.Qualification result as shown in Figure 6.

6.BAC a large amount of the extraction

The bacterial strain that above-mentioned evaluation is correct, 32 ℃ of incubated overnight.5500 leave heart 20min.In 50mLP1, add 200 μ L RNA enzyme solution, resuspended bacterium liquid.Add 50mL P2 solution, overturn 4-6 time, room temperature leaves standstill 5min.Add 50mLP3 solution (3.0 M potassium acetate, pH 5.5), overturn 4-6 time, filter with the filter paper funnel.That uses Qia carries column greatly, and in conjunction with DNA, the 60mL scavenging solution cleans.The elute soln of 5 each 3mL65 ℃ preheatings carries out wash-out and reclaims.Add the 10.5mL Virahol, mixing is placed in the autoclaved corex glass centrifuge tube.Behind 4 ℃ of high speed centrifugation 30min of 12,500 commentaries on classics, use 70% ethanol to clean.Allow drying precipitate, and observe.Resuspended being deposited in the 200-400 μ L water.Centrifugal 1min shifts supernatant and can obtain a large amount of BAC to the 1mL pipe Add 330 μ L60% glycerine in 1mL bacterium liquid, subzero 80 ℃ frozen.

Remove the insertion gene fragment and be with the screening resistance

Because the fluorescence transformer element that inserts contains Flp/FrtReaction site (as shown in Figure 2), and the SW105 bacterial strain contains the control of pectinose inductive promotor FlpExpress.

Identify good clone for step 5, cultivate mono-clonal in 5mL LB substratum, 32 ℃ are spent the night.Get this SW105 bacterial strain of 1mL in second day and be diluted to 10mL solution.It is 0.5 that 32 ℃ of 2-3h vibrations are cultured to 600 nanometer absorbancys.Add the 100 left-handed L of μ L10% (+) pectinoses (Sigma A-3256), make and induce Flp1 hour.Be coated onto on the plate then and identify 10 ^-4To 10 ^-6Dilution.Contain paraxin and kalamycin resistance dull and stereotyped the branch.Correct knocks out and see the clone at the paraxin flat board, and kantlex is the clone not.Choose bacterium colony and propose evaluation for a short time, to remove insert gene fragment institute with the succinct BAC fragment of screening resistance.

Introduce Tol/ISceIIntegration efficiency is improved in the swivel base site

1) contains Tol/ISceIThe plasmid template of sequence (seeing Seq NO.2) uses Auele Specific Primer to incite somebody to action as shown in Figure 3 Tol/ISceIThe transposable element amplification.

2) design of primers:

Tol/ISceIInsert site 1 primer:

Upstream primer: 5 ' ACCCAATTCACCTGTAGCGCATGGACTAGAGATGAAGCTTGG TACCGAGCTCGGATCCACTAGTACGGC-3 ' (seeing Seq NO.5)

Downstream primer: 5 ' GATCTGCAGCATATCATGCGTGTAATATGAGAGACGAGCTC GGATCCGAACAAACGACCC-3 ' (seeing Seq NO.6)

Tol/ISceI inserts site 2 primers:

Upstream primer: 5 ' GGGCATCGGTGAGCTTGACATTGTAGGACTATATTGCTCG AGCGGCCG CCAGTGTGATGG-3 ' (seeing Seq NO.7)

Downstream primer: 5 ' CTGTTCCTGCGCCCGAAGAGTCTTGTGGTAAGTTTGTGCAGG CGGCCGCATTCCC-3 ' (seeing Seq NO.8)

3) the PCR reaction is set, uses Failsafe test kit amplification long segment, the template amount is 1 ng DNA.Electrophoresis detection is used the QIAquick purifying after determining that PCR result is correct.

4) with 5 μ L Tol/ISceIElement PCR product joins step 7 gained FlkIn-BAC cell bacterium the liquid, twice of mixing.Transitional cell-DNA mixture confirms that cell is positioned between metal sheet to the sulculus of precooling.Use 1.7 kV fax hole devices.The electric shock back adds 1mL room temperature SOC to sulculus at once.Shift bacterium liquid to new eppendorf pipe, 32 ℃ of shaking tables are cultivated 1h.Beginning preheating culture plate.After the 1h rejuvenation, room temperature 14000 leaves heart 1min.Remove 850 μ L supernatants, be resuspended in the 150 μ L supernatants.With all 150 μ L coated plates.32 ℃ of incubated overnight.Choose 6 clones, be inoculated in the LB pipe of 5mL, add corresponding microbiotic, 32 ℃ are shaken bacterium and spend the night.Obtain bacterium liquid and carry out BAC extraction and evaluation.Introduce the success ratio that the meaning that improves integration efficiency in the swivel base site is significantly to improve gene recombination, shorten construction schedule.

The injection of zebrafish embryo

Wild-type AB zebra fish is disposed in the little mating cylinder, and the centre is inserted with dividing plate and spends the night, and take out dividing plate morning next day, and small fish begins mate and oviposit.Collect fish-egg, use E3 solution to clean.Remove unfertilized fish-egg.As early as possible fish-egg is arranged in injection plate, set syringe.The injection solution prescription is: (10 μ L) final concentration 80 nanograms/microlitre is introduced the BAC of transposon, 1xDanio damping fluid, 1x phenol red solution, 1 microlitre transposase, the water of respective amount.Injection 1 is received and is risen in the embryonic cell of a cell stage.The embryo that injection is good is put in 28.5 ℃ of incubators, observes fluorescence behind the 48h.Choose expressing correct mosaic fish, change small fish nurse district in the time of the 5th day over to and bring up.

The screening of potential success genetically engineered fish

After zebra fish grows to 2.5-3 month, begin screening.At first use mating in the group, good embryo of mark and corresponding parental generation fish.The fish of parental generation is preferably supported in each cylinder separately, carries out mark.Every pair of fish has been seen 100 embryos, if all be negative, the parental generation feminine gender can be described.Use form to carry out record, constantly get rid of negative fish.Usually BAC has the probability of 1-2% to find a genetically engineered fish.Insert Tol/ISceIIt is about 8% that this probability of the BAC of transposon improves a lot, and have stronger promoter expression, sees Fig. 6, Fig. 7.

SEQUENCE LISTING

＜110〉Nanjing Medical University

＜120〉a kind of method of using the artificial chromosome recombinant technology to cultivate cardiovascular systems fluorescence conversion zebra fish

<130>

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 7128

<212> DNA

＜213〉artificial sequence

<400> 1

ccattaattc agacgcgcaa gtttgtacaa aaaagcaggc tataacttcg tatagcatac 60

attatacgaa gttatattaa gggttccgga tcctcgagac cggtcgccac catggccctg 120

tccaacaagt tcatcggcga cgacatgaag atgacctacc acatggacgg ctgcgtgaac 180

ggccactact tcaccgtgaa gggcgagggc agcggcaagc cctacgaggg cacccagacc 240

tccaccttca aggtgaccat ggccaacggc ggccccctgg ccttctcctt cgacatcctg 300

tccaccgtgt tcatgtacgg caaccgctgc ttcaccgcct accccaccag catgcccgac 360

tacttcaagc aggccttccc cgacggcatg tcctacgaga gaaccttcac ctacgaggac 420

ggcggcgtgg ccaccgccag ctgggagatc agcctgaagg gcaactgctt cgagcacaag 480

tccaccttcc acggcgtgaa cttccccgcc gacggccccg tgatggccaa gaagaccacc 540

ggctgggacc cctccttcga gaagatgacc gtgtgcgacg gcatcttgaa gggcgacgtg 600

accgccttcc tgatgctgca gggcggcggc aactacagat gccagttcca cacctcctac 660

aagaccaaga agcccgtgac catgcccccc aaccacgtgg tggagcaccg catcgccaga 720

accgacctgg acaagggcgg caacagcgtg cagctgaccg agcacgccgt ggcccacatc 780

acctccgtgg tgcccttctg aagctcgagg gatctttgtg aaggaacctt acttctgtgg 840

tgtgacataa ttggacaaac tacctacaga gatttaaagc tctaaggtaa atataaaatt 900

tttaagtgta taatgtgtta aactactgat tctaattgtt tgtgtatttt agattccaac 960

ctatggaact gatgaatggg agcagtggtg gaatgccttt aatgaggaaa acctgttttg 1020

ctcagaagaa atgccatcta gtgatgatga ggctactgct gactctcaac attctactcc 1080

tccaaaaaag aagagaaagg tagaagaccc caaggacttt ccttcagaat tgctaagttt 1140

tttgagtcat gctgtgttta gtaatagaac tcttgcttgc tttgctattt acaccacaaa 1200

ggaaaaagct gcactgctat acaagaaaat tatggaaaaa tattctgtaa cctttataag 1260

taggcataac agttataatc ataacatact gttttttctt actccacaca ggcatagagt 1320

gtctgctatt aataactatg ctcaaaaatt gtgtaccttt agctttttaa tttgtaaagg 1380

ggttaataag gaatatttga tgtatagtgc cttgactaga gatcataatc agccatacca 1440

catttgtaga ggttttactt gctttaaaaa acctcccaca cctccccctg aacctgaaac 1500

ataaaatgaa tgcaattgtt gttgttaact tgtttattgc agcttataat ggttacaaat 1560

aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat tctagttgtg 1620

gtttgtccaa actcatcaat gtatcttatc atgtctggat ctgacatggt aagtaagctt 1680

atccccggag cttgggctgc aggtcgaggg acctaataac ttcgtatagc atacattata 1740

cgaagttata cccagctttc ttgtacaaag tgggtcgcca ccatggccca cagcaagcac 1800

ggcctgaagg aggagatgac catgaagtac cacatggagg gctgcgtgaa cggccacaag 1860

ttcgtgatca ccggcgaggg catcggctac cccttcaagg gcaagcagac catcaacctg 1920

tgcgtgatcg agggcggccc cctgcccttc agcgaggaca tcctgagcgc cggcttcaag 1980

tacggcgacc ggatcttcac cgagtacccc caggacatcg tggactactt caagaacagc 2040

tgccccgccg gctacacctg gggccggagc ttcctgttcg aggacggcgc cgtgtgcatc 2100

tgtaacgtgg acatcaccgt gagcgtgaag gagaactgca tctaccacaa gagcatcttc 2160

aacggcgtga acttccccgc cgacggcccc gtgatgaaga agatgaccac caactgggag 2220

gccagctgcg agaagatcat gcccgtgcct aagcagggca tcctgaaggg cgacgtgagc 2280

atgtacctgc tgctgaagga cggcggccgg taccggtgcc agttcgacac cgtgtacaag 2340

gccaagagcg tgcccagcaa gatgcccgag tggcacttca tccagcacaa gctgctgcgg 2400

gaggaccgga gcgacgccaa gaaccagaag tggcagctga ccgagcacgc catcgccttc 2460

cccagcgccc tggcctgaag cggccgcgac tctagggcct ctagaactat agtgagtcgt 2520

attacgtaga tccagacatg ataagataca ttgatgagtt tggacaaacc acaactagaa 2580

tgcagtgaaa aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta tttgtaacca 2640

ttataagctg caataaacaa gttaacaaca acaattgcat tcattttatg tttcaggttc 2700

agggggaggt gtgggaggtt ttttaattcg cggccgggcg gatcctgatc gcggccagct 2760

tgaagttcct atactttcta gagaatagga acttcggaat aggaacttca agatccccct 2820

ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt tttcgtcagg 2880

tggcactttt cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc 2940

aaatatgtat ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag 3000

gaagagtcct gaggcggaaa gaaccagctg tggaatgtgt gtcagttagg gtgtggaaag 3060

tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc 3120

aggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat 3180

tagtcagcaa ccatagtccg caaagatcga tcaagagaca ggatgaggat cgtttcgcat 3240

gattgaacaa gatggattgc acgcaggttc tccggccgct tgggtggaga ggctattcgg 3300

ctatgactgg gcacaacaga caatcggctg ctctgatgcc gccgtgttcc ggctgtcagc 3360

gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc ggtgccctga atgaactgca 3420

agacgaggca gcgcggctat cgtggctggc cacgacgggc gttccttgcg cagctgtgct 3480

cgacgttgtc actgaagcgg gaagggactg gctgctattg ggcgaagtgc cggggcagga 3540

tctcctgtca tctcaccttg ctcctgccga gaaagtatcc atcatggctg atgcaatgcg 3600

gcggctgcat acgcttgatc cggctacctg cccattcgac caccaagcga aacatcgcat 3660

cgagcgagca cgtactcgga tggaagccgg tcttgtcgat caggatgatc tggacgaaga 3720

gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc aaggcgagca tgcccgacgg 3780

cgaggatctc gtcgtgaccc atggcgatgc ctgcttgccg aatatcatgg tggaaaatgg 3840

ccgcttttct ggattcatcg actgtggccg gctgggtgtg gcggaccgct atcaggacat 3900

agcgttggct acccgtgata ttgctgaaga gcttggcggc gaatgggctg accgcttcct 3960

cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc gccttctatc gccttcttga 4020

cgagttcttc tgaggggatc ggcaataaaa agacagaata aaacgcacgg gtgttgggtc 4080

gtttgttcgg atccgagctt caaaagcgct ctgaagttcc tatactttct agagaatagg 4140

aacttcggaa tagtaacttc tccatggtag cctccaaaaa agcctcctca ctacttctgg 4200

aaagactagt ccgggggggg atccgcccgg gctagagcgg ccgccaccgc ggtggagctc 4260

cagcttttgt tccctttagt gagggttaat tgcgcgcttg gcgtaatcat ggtcatagct 4320

gtttcctgtg tgaaattgtt atccgctcac aattccacac aacatacgag ccggaagcat 4380

aaagtgtaaa gcctggggtg cctaatgagt gagctaactc acattaattg cgttgcgctc 4440

actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg 4500

cgcggggaga ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct 4560

gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt 4620

atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc 4680

caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga 4740

gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata 4800

ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac 4860

cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg 4920

taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc 4980

cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag 5040

acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt 5100

aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt 5160

atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg 5220

atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac 5280

gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca 5340

gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac 5400

ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac 5460

ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt 5520

tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt 5580

accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt 5640

atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc 5700

cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa 5760

tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg 5820

tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt 5880

gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc 5940

agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt 6000

aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg 6060

gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac 6120

tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc 6180

gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt 6240

tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg 6300

aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat attattgaag 6360

catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa 6420

acaaataggg gttccgcgca catttccccg aaaagtgcca cctaaattgt aagcgttaat 6480

attttgttaa aattcgcgtt aaatttttgt taaatcagct cattttttaa ccaataggcc 6540

gaaatcggca aaatccctta taaatcaaaa gaatagaccg agatagggtt gagtgttgtt 6600

ccagtttgga acaagagtcc actattaaag aacgtggact ccaacgtcaa agggcgaaaa 6660

accgtctatc agggcgatgg cccactacgt gaaccatcac cctaatcaag ttttttgggg 6720

tcgaggtgcc gtaaagcact aaatcggaac cctaaaggga gcccccgatt tagagcttga 6780

cggggaaagc cggcgaacgt ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct 6840

agggcgctgg caagtgtagc ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat 6900

gcgccgctac agggcgcgtc ccattcgcca ttcaggctgc gcaactgttg ggaagggcga 6960

tcggtgcggg cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga 7020

ttaagttggg taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgag 7080

cgcgcgtaat acgactcact atagggcgaa ttgggtaccg ggcccccc 7128

<210> 2

<211> 5992

<212> DNA

＜213〉artificial sequence

<400> 2

agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60

acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120

tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 180

ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctat 240

ttaggtgaca ctatagaata ctcaagctat gcatcaagct tggtaccgag ctcggatcca 300

ctagtaacgg ccgccagtgt gctggaattc gcccttgggg ttcgcgtcag cgggtgttgg 360

cgggtgtcgg ggctgggctc gagcggccgc cagtgtgatg gatatctgca gaattcgccc 420

ttggtaccgg cggccttaag ggcctcgtga tacgcctatt tttataggtt aatgtcatga 480

taataatggt ttcttagacg tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta 540

tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat 600

aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc 660

ttattccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa acgctggtga 720

aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa ctggatctca 780

acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg atgagcactt 840

ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa gagcaactcg 900

gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc acagaaaagc 960

atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc atgagtgata 1020

acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta accgcttttt 1080

tgcacaacat gggggatcat gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag 1140

ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca acgttgcgca 1200

aactattaac tggcgaacta cttactctag cttcccggca acaattaata gactggatgg 1260

aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc tggtttattg 1320

ctgataaatc tggagccggt gagcgtgggt ctcgcggtat cattgcagca ctggggccag 1380

atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca actatggatg 1440

aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg taactgtcag 1500

accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa tttaaaagga 1560

tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt gagttttcgt 1620

tccactgagc gtcagacccc atctgcagaa ttcgcccttc tcgaggatct gctgggcttg 1680

ctgaaggtag ggggtcaaga accagaggtg taaagtactt gagtaatttt acttgattac 1740

tgtacttaag tattattttt ggggattttt actttacttg agtacaatta aaaatcaata 1800

cttttacttt tacttaatta cattttttta gaaaaaaaag tactttttac tccttacaat 1860

tttatttaca gtcaaaaagt acttattttt tggagatcac ttcattctat tttcccttgc 1920

tattaccaaa ccaattgaat tgcgctgatg cccagtttaa tttaaatgtt atttattctg 1980

cctatgaaaa tcgttttcac attatatgaa attggtcaga catgttcatt ggtcctttgg 2040

aagtgacgtc atgtcacatc tattaccaca atgcacagca ccttgacctg gaaattaggg 2100

aaattataac agtcaatcag tggaagaaaa tggaggaagt atgtgattca tcagcagctg 2160

cgagcagcac agtccaaaat cagccacagg atcaagagca cccgtggccg tatcttcgca 2220

gatcacgcgt attaccctgt tatccctact cgagaagggc gaattccagc acactggcgg 2280

ccgttactag tggatccgag ctcggtacca agcttaaacg acggccagtg aattgtaata 2340

cgactcacta tagggaaggg cgaattctgc agatatccat cacactggcg gccgctcgag 2400

catgcatcta gagggcccaa ttcgccctat agtgagtcgt attacaattc actggccgtc 2460

gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca 2520

catccccctt tcgccagctg gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa 2580

cagttgcgca gcctgaatgg cgaatggacg cgccctgtag cggcgcatta agcgcggcgg 2640

gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt 2700

tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc 2760

gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg 2820

attagggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga 2880

cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc 2940

ctatctcggt ctattctttt gatttataag ggattttgcc gatttcggcc tattggttaa 3000

aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaattcag ggcgcaaggg 3060

ctgctaaagg aagcggaaca cgtagaaagc cagtccgcag aaacggtgct gaccccggat 3120

gaatgtcagc tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt 3180

agcttgcagt gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga 3240

accggaattg ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg 3300

gatggctttc ttgccgccaa ggatctgatg gcgcagggga tcaagatctg atcaagagac 3360

aggatgagga tcgtttcgca tgattgaaca agatggattg cacgcaggtt ctccggccgc 3420

ttgggtggag aggctattcg gctatgactg ggcacaacag acaatcggct gctctgatgc 3480

cgccgtgttc cggctgtcag cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc 3540

cggtgccctg aatgaactgc aggacgaggc agcgcggcta tcgtggctgg ccacgacggg 3600

cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt 3660

gggcgaagtg ccggggcagg atctcctgtc atcccacctt gctcctgccg agaaagtatc 3720

catcatggct gatgcaatgc ggcggctgca tacgcttgat ccggctacct gcccattcga 3780

ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg atggaagccg gtcttgtcga 3840

tcaggatgat ctggacgaag agcatcaggg gctcgcgcca gccgaactgt tcgccaggct 3900

caaggcgcgc atgcccgacg gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc 3960

gaatatcatg gtggaaaatg gccgcttttc tggattcatc gactgtggcc ggctgggtgt 4020

ggcggaccgc tatcaggaca tagcgttggc tacccgtgat attgctgaag agcttggcgg 4080

cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat 4140

cgccttctat cgccttcttg acgagttctt ctgaattgaa aaaggaagag tatgagtatt 4200

caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct 4260

cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt 4320

tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt 4380

tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtattgac 4440

gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac 4500

tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct 4560

gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg 4620

aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg 4680

gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca 4740

atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa 4800

caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt 4860

ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc 4920

attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg 4980

agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt 5040

aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga tttaaaactt 5100

catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc 5160

ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct 5220

tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta 5280

ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc 5340

ttcagcagag cgcagatacc aaatactgtt cttctagtgt agccgtagtt aggccaccac 5400

ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct 5460

gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat 5520

aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg 5580

acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa 5640

gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg 5700

gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga 5760

cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc 5820

aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat gttctttcct 5880

gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct 5940

cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga ag 5992

<210> 3

<211> 75

<212> DNA

＜213〉artificial sequence

<400> 3

catacgagta tcattcgggg ttattttaac agacaaaatt aattcagacg cgcaagtttg 60

tacaaaaaag aggct 75

<210> 4

<211> 65

<212> DNA

＜213〉artificial sequence

<400> 4

ataacacaaa aagcgacact taccatgtga aatacaacgg ctagtctttc cagagtagtg 60

aggag 65

<210> 5

<211> 69

<212> DNA

＜213〉artificial sequence

<400> 5

acccaattca cctgtagcgc atggactaga gatgaagctt ggtaccgagc tcggatccac 60

tagtacggc 69

<210> 6

<211> 60

<212> DNA

＜213〉artificial sequence

<400> 6

gatctgcagc atatcatgcg tgtaatatga gagacgagct cggatccgaa caaacgaccc 60

<210> 7

<211> 60

<212> DNA

＜213〉artificial sequence

<400> 7

gggcatcggt gagcttgaca ttgtaggact atattgctcg agcggccgcc agtgtgatgg 60

<210> 8

<211> 55

<212> DNA

＜213〉artificial sequence

<400> 8

ctgttcctgc gcccgaagag tcttgtggta agtttgtgca ggcggccgca ttccc 55

Claims (1)

1. one kind is used the artificial chromosome recombinant technology to cultivate the method that cardiovascular systems fluorescence is changed zebra fish, and its feature realizes in following steps:

A, FlkBAC imports engineering bacteria SW105, wherein FlkBAC is CH211-231B5;

B, adopt purpose fragment 5 ' primer: 5 '-CATACGAGTATCATTCGGGGTTATTTTAACAG ACAAAATTAATTCAGACGCGCAAGTTTGTACAAAAAAGAGGCT-3 ' and

Purpose fragment 3 ' primer: the fluorescence transformer element among 5 '-ATAACACAAAAAGCGACACTTACCATGTGAAA TACAACGGCTAGTCTTTCCAGAGTAGTGAGGAG-3 ' amplification pPCRBloxYkanFrt;

The electric shock of C, fluorescence transformer element imports and contains the flk-BAC competent cell, and a large amount of the cultivation;

D, removing are inserted gene fragment and are with the screening resistance;

Integration efficiency is improved in E, introducing Tol/ISceI swivel base site: wherein Tol/ISceIInsert site 1 primer:

Upstream primer: 5 ' ACCCAATTCACCTGTAGCGCATGGACTAGAGATGAAGCTTGG TACCGAGCTCGGATCCACTAGTACGGC-3 '

Downstream primer: 5 ' GATCTGCAGCATATCATGCGTGTAATATGAGAGACGAGCTC GGATCCGAACAAACGACCC-3 '

Tol/ISceI inserts site 2 primers:

Upstream primer: 5 ' GGGCATCGGTGAGCTTGACATTGTAGGACTATATTGCTCG AGCGGCCG CCAGTGTGATGG-3 '

Downstream primer: 5 ' CTGTTCCTGCGCCCGAAGAGTCTTGTGGTAAGTTTGTGCAGG CGGCCGCATTCCC-3 ';

The injection of F, zebrafish embryo;

G, the screening of potential success genetically engineered fish.

Images