CN114875067B - Construction method of Bestrophin3 vascular smooth muscle specific gene knockout mice and aortic dissection mice models - Google Patents

Abstract

The invention discloses a construction method of a Bestrophin3 vascular smooth muscle specific gene knockout mouse and an aortic dissection mouse model, and relates to the field of mouse model construction. The aortic dissection mouse model comprises the following construction steps: bestrophin3 vascular smooth muscle specific gene knockout mice, called Best3 for short ^SMKO Mice, rearing Best3 ^SMKO Aortic dissection or aortic aneurysm spontaneously formed in mice 24 weeks. The purpose of the application is that the Bestrophin3 deletion in vascular smooth muscle cells can induce aortic dissection, and the constructed Bestrophin3 smooth muscle specific knockout mouse is an aortic dissection/aneurysm mouse model with high morbidity and high quality similar to the incidence age of human aortic dissection, and Best3 ^SMKO The incidence rate of AD of mice reaches 63%, the incidence rate is high, and the modeling is simple.

Description

Construction method of Bestrophin3 vascular smooth muscle specific gene knockout mice and aortic dissection mice models

Technical Field

The invention relates to the field of mouse model establishment, in particular to a construction method of a Bestrophin3 vascular smooth muscle specific gene knockout mouse and an aortic dissection mouse model.

Background

Aortic dissection (Aortic Dissection, AD) is a common vascular acute disease, with the concomitant younger cardiovascular diseases such as hypertension, and the incidence of the disease increases year by year. The aortic dissection is extremely dangerous in disease development, and once the disease is developed, if the disease cannot be treated in time, the blood vessel is ruptured, so that the heart is tamponade, the trachea is caused to bleed acutely, and shock death is caused. Once the blood vessel of the aortic dissection patient is ruptured, the artificial blood vessel replacement can be carried out only through operation, the replacement faces huge operation risks, the blood vessel after operation can be further degenerated, and the risk of secondary operation and rupture is faced to prevent aortic rupture. At present, no medicine can treat and repair aortic dissection through repairing an aortic structure, and after a slight aortic dissection and critical aortic dissection operation, the occurrence and development of aortic dissection can be controlled only through maintaining blood pressure, blood fat and the like, so that the research on the pathogenesis of aortic dissection and the search of prevention and treatment targets become particularly important.

The animal model is a key tool for researching aortic dissection pathogenesis and drug research, and the current common aortic dissection mouse model is mainly constructed by the following 3 modes: (1) The apo lipoprotein E (ApolipoproteinE, apoE) knockout mice are added with angiotensin II to induce hypertension for 28 days, and the molding rate is about 40-60%; (2) Low density lipoprotein receptor (Low-Density Lipoprotein Receptor, LDLR) knockout mice plus angiotensin II induce hypertension for 28 days with a molding rate of about 40-50%; (3) Beta-aminopropionitrile was administered to 3 week old wild type C57LB mice for 4 weeks, followed by induction of hypertension with angiotensin II for 3 days with aortic dissection rates up to 90%. Although the above 3 methods are widely used, the method has certain defects that the (1) and (2) knockout mice have low molding rate, the pathogenesis is mainly in abdominal aorta, the pathological manifestation is more similar to that of abdominal aortic aneurysm, and the pathological manifestation of aortic dissection is different; the method (3) has high molding rate, but has strict limitation on the week age requirement of molding mice, and the mice with the age of 3 weeks are required to be used, which is inconsistent with the morbidity population of clinical aortic dissection, and has high death rate and large experimental loss during molding.

Therefore, development of a brand new mouse aortic dissection model which is simple in modeling method, consistent with human morbidity progress and characterization and high in modeling rate is urgently needed.

Disclosure of Invention

The invention provides a construction method of a Bestrophin3 vascular smooth muscle specific gene knockout mouse and an aortic dissection mouse model, and provides a brand-new mouse aortic dissection model which is simple in modeling method, consistent with human morbidity progress and high in morbidity.

In order to solve the technical problems, one of the purposes of the present invention is to provide a targeting vector of a Bestrophin3 vascular smooth muscle specific gene knockout mouse model, wherein the targeting gene comprises a Bestrophin3 gene and two Loxp sites, wherein the two Loxp sites comprise loxP inserted into an intron2 of the Bestrophin3 gene and FRT-Neo expression frame-FRT-loxP inserted into an intron4 of the Bestrophin3 gene.

Preferably, the sequence of the targeting vector is shown as SEQ ID NO. 1.

In order to solve the technical problems, the second object of the present invention is to provide a construction method of a bestophin 3 vascular smooth muscle specific gene knockout mouse, comprising the following steps:

(1) Adopting a Cre/LoxP recombination system, selecting exon 3 and exon4 of a Bestrobin 3 gene as knockout regions, deleting the regions to cause the loss of functions of the Bestrobin 3 gene of a mouse, using a C57BL/6 mouse genome as a template to amplify an upstream homology arm, a downstream homology arm and a flox region, inserting LoxP in an intron2 of the Bestrobin 3 gene, inserting FRT-Neo expression frame-FRT-LoxP in the intron4, and connecting the regions to a framework to form a targeting vector;

(2) The targeting vector is linearized and transfected into embryo stem cells of a C57BL/6 mouse, successfully homologous recombination embryo stem cells are identified and screened through PCR, and then the embryo stem cells with positive expression are microinjected into blastula and transplanted into pseudopregnant mice;

(3) Obtaining F1 generation hybrid mice through passage, and identifying the obtained Bestrophin3-flox heterozygote mice by utilizing PCR;

(4) Selfing and PCR screening the Bestrophin3-flox heterozygote mice to obtain Bestrophin3-flox homozygous mice, then hybridizing and breeding the Bestrophin3-flox homozygous mice with vascular smooth muscle Cre tool mice to obtain F1 generation hybrid mice, separating milk at 3 weeks and identifying the genotype of the F1 generation hybrid mice by using a rat tail method, hybridizing the Bestrophin3 chimeric flox heterozygote and Tagln-Cre positive mice with the Bestrophin3-flox homozygous mice again, and screening the Best3 homozygous and Tagln-Cre positive Best3 by PCR identification ^SMKO And (3) a mouse.

Preferably, the sequence of the targeting vector is shown as SEQ ID NO. 1.

Preferably, the Best3 ^SMKO Mice were initially aortic dissection modelling 4 weeks old.

As a preferred embodiment, the primers for identifying the Bestrophin3 vascular smooth muscle-specific knockout mice comprise:

Tagln-Cre-F：5’GCGGTCTGGCAGTAAAAACTATC 3’；

Tagln-Cre-R：5’GTGAAACAGCATTGCTGTCACTT 3’；

Best3_LoxP_F：5’GTGGCTGAGGCAGGAGAATTACA 3’；

Best3_LoxP_R：5’AACCTGTGGGAAAACCTCTATCTCC 3’；

Best3_Neo_Del_F：5’CAGAAGTAGCCGAAAGCCAAGATGCC 3’；

Best3_Neo_Del_R：5’TTACCTGGACGAAAACCGACAGCA 3’。

in order to solve the technical problems, the invention provides an application of a Bestrophin3 vascular smooth muscle specific gene knockout mouse in screening medicines for treating or preventing aortic dissection or aortic aneurysm.

In order to solve the above technical problems, a fourth object of the present invention is to provide a method for constructing an aortic dissection mouse model, comprising the following steps: best3 with Bestrophin3 Gene loss of function ^SMKO Mice, rearing Best3 ^SMKO Mice reached 8 weeks of age and beyond spontaneously developed aortic dissection or aortic aneurysm.

Preferably, the Best3 ^SMKO The sequence of the mouse targeting vector is shown as SEQ ID NO.1,

as a preferred embodiment, in Best3 ^SMKO The mice were kept at 4 weeks of age and induction of angiotensin II was performed for 28 days or more.

As a preferred embodiment, the induction concentration of angiotensin II is 1-2 mg.kg ^-1 ·d ^-1 。

Compared with the prior art, the embodiment of the invention has the following beneficial effects:

the purpose of the application is to confirm that the deletion of the Bestrophin3 in vascular smooth muscle cells can induce aortic dissection, and the constructed Bestrophin3 smooth muscle specific knockout mouse is an aortic dissection/aneurysm mouse model which has high morbidity and high quality and has similar morbidity and age with human aortic dissection, and the self-base of the mouse model can spontaneously form AD; if synchronous induction is carried out by adopting angiotensin II, the main body can be acceleratedArterial dissection or aneurysm formation, best3 ^SMKO The incidence rate of AD of mice reaches 63%, the incidence rate is high, and the modeling is simple.

Drawings

Fig. 1: the invention relates to a construction method of a Bestrophin3 vascular smooth muscle specific knockout mouse in the first embodiment;

fig. 2: schematic diagram of LoxP insertion site of bestophin 3 vascular smooth muscle specific knockout mice in the first embodiment of the present invention;

fig. 3: in the second embodiment of the present invention, the vascular smooth muscle-specific knockout mouse of Bestrophin3 (Best 3) ^SMKO ) And control mice (Best 3) ^FL/FL ) Survival curves within 72 weeks of age;

fig. 4: best3 in the second embodiment of the invention ^FL/FL Mice and accidental death Best3 ^SMKO Thoracic anatomy of mice;

fig. 5: best3 in the second embodiment of the invention ^FL/FL Mice and Best3 ^SMKO Ultrasound images of mice with respect to aortic arch and abdominal aorta (left) and statistics with respect to the inner diameters of ascending aorta (Ascending Aortic Diameter) and abdominal aorta (Abdominal Aortic Diameter) as a function of age of week (right);

fig. 6: best3 in the second embodiment of the invention ^FL/FL Mice and Best3 ^SMKO The vascular in vitro dissection results of the ascending aorta (Arch) and the abdominal aorta (Abao) of the mice at different ages;

fig. 7: best3 in the second embodiment of the invention ^SMKO Schematic representation of the pattern of aortic dissection development and progression in mice;

fig. 8: induction of Best3 by angiotensin II in embodiment three of the present invention ^SMKO Schematic flow chart of hypertension of mice;

fig. 9: in the third embodiment of the invention, the angiotensin II induces the Best3 within 4 weeks of hypertension ^FL/FL Mice and Best3 ^SMKO Counting survival curves in mice;

fig. 10: in-vivo ultrasonic detection of Best3 after 4 weeks of hypertension induced by angiotensin II in embodiment III of the present invention ^{FL /FL} And Best3 ^SMKO Aortic Arch of mouse (Arch)And abdominal aorta (AbAo) structural images and vessel inside diameter statistics;

fig. 11: post 3 after 4 weeks induction of angiotensin II in example III of the present invention ^FL/FL Mice and Best3 ^SMKO Isolated vascular anatomy of mice;

fig. 12: post 3 after 4 weeks induction of angiotensin II in example III of the present invention ^FL/FL Mice and Best3 ^SMKO Counting the incidence rate of aortic dissection of the mice;

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Bestrobin is a class of proteins having a molecular weight of about 68 kD. Up to now, the bestophin family has found 4 subtypes bestophin 1, bestophin 2, bestophin 3 and bestophin 4. The distribution of these 4 subtypes is tissue specific, with bestophin 1 being distributed predominantly in the basal membrane of retinal pigment epithelial cells, as well as in the lung epithelium and intestinal tract; the distribution of bestophin 2 is more limited to the olfactory epithelium and the eye; bestrophin4 is very rare in major tissues of the human body and is difficult to detect in many organs, while Bestrophin3 is widely distributed in tissues and its expression can be detected in many tissues.

As an important subtype of the Bestrophin family, bestrophin3 is currently known as 12 transcripts, 10 of which can encode proteins, and therefore, bestrophin3 exists in several spliceosomes, which exist in different forms in different tissues. In recent years, the study of Bestrophin3 has focused on structure and functionality. Wang X et al have shown that vitamin C is effective in inhibiting hydrocortisone-induced damage to microvascular endothelial cells, and is probably due to the promotion of Bestrophin3 expression; after neonatal brain injury in mice, bestophin 3 protein expression is up-regulated and co-expressed with Nestin. mRNA splice variants of Bestrophin3 differ in different damaged tissues, indicating that they function differently in damaged tissues; bestrophin3 can act on NF- κB to reduce inflammation induced by TNFα in endothelial cells by inhibiting its activation; meanwhile, the Bestrophin3 can inhibit the expression of CHOP, so that the cell death of kidney epithelial cells caused by endoplasmic reticulum stress is reduced; furthermore, researchers have found that Bestrobin 3 can also be used as a biomarker for breast cancer screening by proteomic analysis, wu et al have found that the C-terminal cleavage of mouse Bestrobin 3 can affect lysosomal-endosome complexes while promoting lysosomal swelling, calcium ion release in the endoplasmic reticulum, and the like. Demonstrating that bestophin 3 plays a role in regulating calcium ion release in myoblasts; in addition, golubinskaya et al found that Bestrophin3 has a higher molecular weight in podocytes and renal cortex than in the heart. The differences between predicted and observed protein weights in different tissues may be due to posttranslational modification of bestophin 3, but require further investigation to elucidate its underlying mechanism. While bestophin 3 is involved in a variety of physiological processes such as tumor, cell proliferation, inflammation, etc., its pathophysiological significance in cardiovascular system, especially vascular smooth muscle cells, is still unclear.

The application shows that the Bestrophin3 deletion in vascular smooth muscle cells can induce aortic dissection, and the Bestrophin3 smooth muscle specific knockout mouse is a high-quality aortic dissection/aneurysm mouse model with high morbidity and similar morbidity and age of human aortic dissection.

Example 1

The construction method of the Bestrobin 3-fLoxP mouse model specifically comprises the following steps:

(1) Materials: construction of Bestrobin 3-flox mice (C57 BL/6 mice) entrusted with Sai-Boc Biotech Co., ltd; B6.Cg-Tg (Tagln-cre) 1Her/J mice used for the experiments were derived from The Jackson Laboratory; c57BL/6 mice were derived from Siro Biotech Co; PCR identification kits were purchased from sigma company, USA; .

(2) Construction of plasmid vector:

as shown in FIG. 1, a Cre/LoxP recombination system is adopted to construct a conditional knockout mouse, a Bestrobin 3 conditional knockout vector is firstly constructed, the Bestrobin 3 gene has 10 exons, ATG is on exon 2, TAA is on exon10, exon 3 and exon4 of the Bestrobin 3 gene are selected as knockout regions, and deletion of the regions should lead to the loss of function of the Bestrobin 3 gene of the mouse. The C57BL/6 mouse genome is used as a template to amplify an upstream homology arm, a downstream homology arm and a flox region, loxP is inserted into an intron2 of a Bestrophin3 gene, FRT-Neo expression frame-FRT-loxP is inserted into an intron4 and is connected to a framework, a LoxP insertion site is schematically shown in FIG. 2, a targeting vector (with Neo marker genes) is formed, and the nucleotide sequence of the targeting vector is shown as SEQ ID NO: 1.

(2) The targeting vector is linearized and transfected into embryo stem cells of a C57BL/6 mouse, successfully homologous recombination embryo stem cells are identified and selected through PCR, primer sequences used for PCR are shown in table 1, and then positive embryo stem cells are microinjected into blastula and transplanted into a pseudopregnant mouse.

(3) F1 generation mice were obtained by passaging, and the obtained Bestrophin3-flox heterozygote mice were identified by PCR using the primer sequences shown in Table 1.

(4) Reproduction and screening of bestophin 3 vascular smooth muscle specific knockout mice:

the Bestrobin 3-flox heterozygous mice are subjected to selfing propagation and PCR screening to obtain the Bestrobin 3-flox homozygous mice, and then the Bestrobin 3-flox homozygous mice are subjected to hybridization propagation with vascular smooth muscle Cre tool mice, namely B6.Cg-Tg (Tagln-Cre) 1Her/J mice, which are abbreviated as Tagln-Cre mice. The F1-generation hybrid mice obtained were weaned at 3 weeks and their genotypes were identified by the rat tail method, and Bestrophin3 chimeric flox heterozygous and Tagln-Cre positive mice were again crossed with Bestrophin3-flox homozygous mice.

(5) The mice obtained were identified by PCR, the primer sequences used for PCR are shown in Table 1, and a control group (Bestrophin 3-flox homozygote and Tagln-Cre negative, i.e., best 3) was obtained by screening ^FL/FL Mice) and experimental groups (Bestraphin 3-flox homozygous and Tagln-Cre positive, i.e., best 3) ^SMKO Mice) that were allowed to aortic clamp at 4 weeks of ageAnd (5) layer molding.

TABLE 1 primer sequences for PCR identification in example one

Example two

Verification Best3 ^SMKO AD spontaneously forms in the basal state of mice: to clarify the role of Bestrophin3 in AD formation, a Cre/LoxP conditional gene targeting technique was used to construct and obtain a Bestrophin3 vascular smooth muscle specific gene knockout mouse (Best 3) ^SMKO ) Using Best3 ^flox+/+ As a control group (Best 3) ^FL/FL )。

The test steps are as follows: recording Best3 under natural growth state ^SMKO And Best3 ^FL/FL Drawing a survival curve according to death conditions of mice within 4-72 weeks of age; the internal diameter of the aorta is detected by adopting the ultrasonic Doppler of a living animal, and the blood vessel of the mouse is peeled off by using an anatomical means to further define the structural change of the blood vessel of the mouse, so as to jointly evaluate the influence of the smooth muscle knockout of Bestrophin3 on aortic dissection/aortic aneurysm of the mouse.

Test results: as shown in FIG. 3, best3 increased with age during raising of mice ^SMKO Mice show slow movement and unexpected death, and the death conditions of the mice with different ages are recorded and counted, so that the Best3 knockout can cause the survival time of the mice to be shortened and the death rate to be obviously increased. Best3 with unexpected death ^SMKO The mice were dissected in the presence of a standing horse, as shown in fig. 4, and severe hematocele was found in the chest, and the dissected aorta was seen to form a clear aortic dissection and to appear as an abdominal aortic rupture. As shown in fig. 5, the abdominal aorta (AbAo) and the ascending aorta (Arch) were observed and the vessel inner diameter was measured by performing in vivo ultrasound monitoring of the aortic structures in two groups of 4-week, 8-week, 12-week, 16-week, 20-week, 24-week, 48-week, 72-Zhou Zhouling mice, respectively; as shown in fig. 6-7, and performs an anatomic viewAnd (5) inspecting. As a result, after the Bestrobin 3 is knocked out, the aorta of the mice forms aortic blood clamping at an early stage, namely, the aortic dissection is early-stage and is light, the vessel wall hematoma occurs, the inner diameter of the vessel is obviously increased along with the age, and the vessel wall structure is further destroyed to form the dissection aneurysm.

Example III

Angiotensin II (Ang II) induced Best3 ^SMKO Test of hypertension and aortic dissection in mice:

the elevation of blood pressure is an important cause of occurrence and development of aortic dissection, and is characterized in that an Ang II slow-release pump is buried subcutaneously on the back of a 4-week-old mouse to induce hypertension for 4 weeks in order to simulate the pathological condition of hypertension during clinical aortic dissection, and the induction flow is shown in figure 8, and comprises the following steps:

(1) To Best3 ^FL/FL Mice and Best3 ^SMKO At 4 weeks of age, two groups of mice in the same litter were anesthetized by intraperitoneal injection of pentobarbital sodium (100 mg/kg) ^BW ) Micro-osmotic slow release pump with Ang II solution (1.75 mg/kg) was subcutaneously implanted in the back, the rate of releasing Ang II was 1.44mg/kg/d, and the systolic pressure (Systolic blood Pressure, SBP) and diastolic pressure (Diastolic blood Pressure, DBP) of the mice were tracked and examined with a noninvasive sphygmomanometer 7 days, 14 days, 21 days, 28 days after the implantation of the pump, respectively, and the survival curve of the statistical mice was shown in FIG. 9, and the survival rate after 28 days was 78%.

(2) The ultrasonic detection of mice is carried out by using a VEVO 3100 ultrasonic device (Visual sonic Canada Toronto), firstly placing the mice to be detected in an anesthesia box, carrying out anesthesia to coma by using 2% isoflurane, then fixing the mice to be detected on a carrier plate, continuously carrying out anesthesia by using 1% isoflurane, respectively collecting images of an ascending aorta, an aortic arch, a thoracic aorta and an abdominal aorta by selecting proper positions, observing the structure of the whole aorta and whether an aortic aneurysm is formed or not, and simultaneously measuring the maximum inner diameter of the whole aorta, wherein the image result is shown in figure 10. The sample was simultaneously dissected and the results are shown in fig. 11.

Test results: as shown in FIG. 10, at day 28 after induction of hypertension, the wall structure of the aorta of the mice was observed by scanning with ultrasound, and Best3 was seen ^SMKO The aorta of the mice risesAortic and abdominal aortic and the like form arterial distension and generate a dissection aneurysm, best3 ^SMKO The diameter of the aorta of the mice is obviously increased. Further anatomical observations were made, as shown in FIG. 11, the anatomical map can be seen in Best3 ^SMKO Aortic dissection occurs in the abdominal aorta and forms a tumor-like enlargement. As shown in FIG. 12, best3 ^SMKO The AD incidence rate of the mice is 63% and is far higher than that of Best3 ^FL/FL A group.

The foregoing embodiments have been provided for the purpose of illustrating the general principles of the present invention, and are not to be construed as limiting the scope of the invention. It should be noted that any modifications, equivalent substitutions, improvements, etc. made by those skilled in the art without departing from the spirit and principles of the present invention are intended to be included in the scope of the present invention.

Sequence listing

<110> university of Zhongshan

<120> construction method of Bestrophin3 vascular smooth muscle specific gene knockout mice and aortic dissection mouse models

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 15721

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> targeting vector

<400> 1

ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60

attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120

gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc 180

caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc 240

ctaatcaagt tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag 300

cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa 360

agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac 420

cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg 480

caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg 540

gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg 600

taaaacgacg gccagtgaat tgtaatacga ctcactatag ggcgaattgg gtacgcggcc 660

gcaccctgga ctcactacac gctggatcgc cacagcagca ggagaactag gaggaaaccc 720

agctggtcac cagtgagggt ggaagccggc acctcttcag ggacggcaga tcgtttgaag 780

atttctcttc ccttgagaga ctccaaagaa ataggttagt gcgcgagccg gcttctgcac 840

ttgaacgtga ccttatgctt ggtgggcgtc gggtttcgga cagagcctga actgagggtg 900

aaggagtgaa tggaagaaaa ggggattggt tagaggctgt cccttgacgg ggcctgcctg 960

gagaagagct taggacattg ctgttctgtt ctcccctgtc gctgagttct cccgaggcag 1020

agagacaagg tggcgatctc aaagcgaagc ctgttttagg gcaggcaccc cacccttctg 1080

tggtgtcacc tactgactta ggcaaagggc cctggtttgt ttaattaaaa tcaacaacca 1140

tggaggacaa atcagcactt tgctgttgtt gctgtggata cagctgccag ctcttacgtc 1200

cttagagaaa ctggataaat cacagttgga tatttgcctg tctaaatgaa acattctctt 1260

atttgtgata gaatgtgtga tataaatcgc tctacggggg gaaaaaaata tgctctaggg 1320

tttgtttggt tgggtttttg tgtgggtgtg tgtattataa ttttgaccta aaatctatca 1380

gcctgtgttg ctctgtgaga agttctttgt agttcctttg gagaaaagtt aacattttaa 1440

agagatctcc ttttgtttgc atgtgaccta tactacccag ttagctgagt aaggtttcca 1500

aacaaaggtc ggctttgagc catctattcg aagtccgatg gcacatctca gtgagaagcc 1560

gaggcatgcc agggagctca aagaaaactg ggattaggcc ccattctcat cctgcccacg 1620

tccacgaaat gaatccagaa caaggtgttc taaattacag acacactagg gatgtagcac 1680

acatgagaca gtgcctgccc agcacacaca agactcggtg ccaagcaaaa cgctaagtaa 1740

atactacata cagtggcggt ggtacagtcc cacaattcca gcgctcactg gaaatggagc 1800

aaaagttcaa ggccaggttc aaggtcaatg tgggatgacc ctgtcttcca aaataagaaa 1860

gaaaagactc agtttgtttg tctctgatta tttcattgag actttccaag gggaaagtgt 1920

agccttttta atatcaagtt tacggctccc tttgaaaggt acagaattcc gactgtacac 1980

cctgagagct gctgagagac tcacatctca ggaagatacc cccacccccc gacacaccca 2040

agtagcccat ctgttaaact gctctggggg ccgggcttcc tcctgacaat cgctcctggt 2100

tcctaagaag ggatcaataa ctttttcctc ttaggaagtt taaaggtgaa atcaatattt 2160

ctttaaggat tttagcagac actggcccaa acaacgagta tagccactgc tttttaaaaa 2220

catcatcagt ttagcaaacc aatttcctaa atcctcctgc gactaagaag tggctagtat 2280

gcctcatgtg ctaatgttga ttatgtattg ggcaaaagct acagactcta aaataatgct 2340

tatcgaatgc agaaatgtca gggcttctaa aaacagtctt tctagggacc atcttcttct 2400

ccttctgtgt cagatttagt gccgagatgc tagatggtga tacggtatta tctacaagtt 2460

ctaaactatg agaggagtgc gtgatgcatg gagggtgggt cagctgatta gtttttggct 2520

ttagtttcct ttggttaaga aagaaaggga aagtgtatgc ctgtgttgac atccaacttt 2580

gcttttcact cgtgttttgt cttcttgctc ttctagaaca aaaccaccca cgatgactgt 2640

cacttactcc agtaaagtag caaatgcaac attttttgga tttcataggt tgcttctcaa 2700

gtggagaggt agtatctaca agctgctgta cagggaattt attgtttttg ctgttcttta 2760

cacagcaatc agtctggtgt acaggtacct tcgttttgca tgtctcctta aatggccccc 2820

ccaggcatta tgtaagaata cagtctcaaa aactggatcc ccttggttgc cgctagcctc 2880

tgcattatgt aacaatctcc ccacccctcc ccaccccccg catgaacctc tctggcgtcc 2940

tctcttcagg atagggtatt ttaatccaca cctaaccacg tatttggagc aattgacagc 3000

caccgttcag acaatgggct ctaattccag ccccacagag atggatcccg atgaggtatc 3060

agcctagctg ctttaagtgt caactgaaag ttttatgctg acatcctcat cggtgtgccg 3120

attaacggcc aaagcccaca gacaaatgct tttgtgtttc tctcagtgat gtcatgtgga 3180

gtttgaacat gtgatctgac agcttactgc aactctacgt ggagttaaca tatgggtgaa 3240

tagaatttac cagacagctt tccttcctgt agtctggatg gtaagctctg acctgggatg 3300

atgtcctcca acctcaccaa agaactaagg cctgaggaat aatttgttct ctttatgtct 3360

tctgatttca ggatgtcaca tttgcaagag aaggtatcta ttctttataa cacgggtacc 3420

tgtcaggttc atactttgag ggctagcata tccacctctc ccaactgaaa agtattgtct 3480

tagtaacatt tcatcactgt gattaaaaaa aaatgaagct ttaggagtta ataaactaaa 3540

actgaattac attggaggaa gctaaaagga aagcctaaga ttttcaaggc tgtatttcca 3600

ccttagctag gtataaaatt ttttcttcca tcgaaggtga actaactgtg agtcacagtc 3660

tcacctacat ccttctttga aactatgaga ctccacttgg agaggagagg tattcattta 3720

gttggctgat catttccaaa agcaaactgt gaacaactat cttgttcaca acaacccatc 3780

agtacttcca gcccaaagat gaggatgtag ctcagttggt acaatgcctg cctagcaagc 3840

acaaaaccct gaactcaatc cccaggcact gatagcacac acctgtaatc ccagtattga 3900

ggcaatggag acaggaggat cctgttcaag ataacttgct gcttgagtta taagaaactc 3960

tgtcaaaaaa aaaaaagaca gaacactatc attccatacc agtatacata ttagaacaga 4020

ttttgtggga ctaaggaatt agctcagtgg tagaatgctt tgcctagcaa ctggcaggct 4080

ctgggttcag tccccagttc aaaaataatc agaacaaaaa acaccaaggc aaaaatcgca 4140

agaatagatt tttgtcaaat attcttagag acgtctgata tctttcagat atctcctata 4200

ttaccttaac agttcactta tctgttcctt gaaccttcag agtatgacat ggtggcagat 4260

tagtggtgtt ccagtatcac tatctcatca gttcattctt cactaatgtg agtttactgc 4320

tgctactgct gtttagaaga gagaagcccc aagagcaact gctatatccc tggaaatgct 4380

ccaatatcaa acttacaccc caaaactcta cacagatttt tgtctttcca aagatcaaag 4440

agtacaaaca ttcgcagcaa tcactttaac ttgctttttt cttctttttt aaaaaagtct 4500

cattgtaaat tcttataaaa gcagatcctt tttatcttaa atatttacca agaactgttg 4560

gattcatagg tctccaaaat caagcagacc tgaaaatata accatagttt gtgctttgcc 4620

tggtattgac tttgagttta actcttccag tttggaggaa tttgacataa tactctctgt 4680

ggtattttct agataagaat atccacatat atctgtccaa ttagcatcaa taccacccat 4740

tttggtgcta cgtttgaaga tatacagttg ccttacagtt atttatgtaa ttgatatttc 4800

tggtctttac aacaccataa actaaaaaga accctgagac tcctagagct ttgacaatat 4860

ccccaagtct aaatctatga caaacctgtt ctataccttg gcctggccca gctgatccca 4920

ggagctgtgc tttctacact gaatacttta atgtgcataa ttaaatactt tatgtatcag 4980

aaagccgctc tgtgacttgt tatcaacagg accctccctg attccacgaa cttgatcgcc 5040

tcacccaaag ctgacacaag aactccccac aacccctata cctcaaattc tttattcacc 5100

aagaccagcc tgacagtcct ctgcctgcag cccccgtggc tggacactgc tcctcttcta 5160

tcagcattcc actcacgggc gggaactttt gagacttgtt ccgataggtt ttttcttaga 5220

tttcttgttc tttagatgaa ctgaactatt aatctatgca aattcatatg tagcctctct 5280

ttccacatcc tggtaattat tattaatgtg tctttagatt ccttctggct ctgaattccc 5340

tccctgaaac ataataacgg tctcattatg ggcaggtgtg tttagcaatc tcagaaaata 5400

agtttgggga ggtaaagtca gatctacagg aaaggttttg atatttgagc ccatggccaa 5460

atataacagt gaaagtttct gcctttcagg ttaaatcagc tttatttata tcccaagcat 5520

tgcgaatatt aaagtaaaca atcacaatat ttcctgacag gtagtatatg cacaatctag 5580

aatgcattaa ttggcttggt taaattagta cgttctggat taaaggtcaa gatgttgaat 5640

gttactcaat aatgacttaa taactcttac ccaccaaatc aatagtctct ttcttttaag 5700

tattcctaat gaataattga aaaatggaaa ccaagcctgg tggtgaaggc ctataacctc 5760

agctaattga gtggctgagg caggagaatt acaaggacag gtaggtcgtc gcacgtataa 5820

cttcgtataa tgtatgctat acgaagttat tactgcgtac gagcatcgat ttcagggtct 5880

gcttggtcaa cagcagcagt tctcaacctt cctgatgctg tagtccttta atacagtccc 5940

tcatgttgtg gtgaccccca ccccccaccc cgaaccataa cactattctg ctttctactt 6000

cacaactgta atcttgctac tgttatgaat tgtaatttaa atatttttgg agatagaggt 6060

tttcccacag gttgagaacc actagtctat aacatgagct caagccaatg gggcgacccc 6120

tgtctcaaaa cagaaaagag tgacctgccg gtggtattca gtgattgtct gtctgacacg 6180

ccccggccct ggctttaatt ctcagaaaga aaaacaaaag actcttttgt aacatgtctt 6240

tctccaaaat ccaatgaacc agttatataa aactttaaaa ctacaaagct ttaagaaacg 6300

aagtggttaa caattccatt acttaatggt tatcagattt atgtgctaaa aacctttaat 6360

accggaagca caaagcattt ttttttttta aattttagag gcacaccagt tcaagggaaa 6420

acaaaaaaca aaaacaaaac aaaaaacaac aacaacaaca acaacaaaaa accaagccaa 6480

ctgagattaa gatttgtggt taactgtttg cacttgctgt ctcctgcaga gcaggggcag 6540

gagttccgcg tcataaaggg ctgtgcgttt tatttttgct ccagattgtt acttacagga 6600

gcccaaaaac gttactttga aaaattatca atttactgtg acagatatgc tgaacaaatt 6660

ccagtaacct ttgtgcttgg taagtatagg tcacacgcag aatgcagcca cacagctgtc 6720

tccgttagat gacacagatg accgcatgag agtgcttccg ggctgtgagg cttgccggga 6780

aagccgctgc ttgcaatcgt gcacagccga ccctaaagtt cgccttcagg gctgcttctg 6840

ctaagttagc atgggacagt ttgaggtcgt aatctgctgt tggaccttta agctttctct 6900

tcactaaccg tccatttttg cagtcagtat ttgagttcta atacccactt accgggtgcc 6960

ctgaccttgt caggcatata tggcatttcc tcccctccag gagggcagaa atcctaaggt 7020

ctggaggata acatattttc atagctcgaa cccctaagaa agctaaaatt ctgctacacg 7080

tgtgtccgct gagatgtctg ctgtaagaaa ctgcatgatg gcgtctggtt atcccaacag 7140

ggttttacgt cactctggta gtgaaccgat ggtggaacca gtttgtgaat ctgccttggc 7200

cagacaggct gatgctcctc atttccagca gtgtccacgg gagcgaccag catgggcgcc 7260

tgctcagaag gacgctgatg cgctacgtca acctgacgtc cctgctcatc ttccgctcgg 7320

tgagcaccgc ggtgtacaag aggtttccca ccatggacca cgtggtcgaa gcaggtacgg 7380

ggtgtgcgct tggtaggagc caccaaaatg cttttgaaag cacccgggtg tatttattca 7440

agaaatgtgg cagaagcatt cttaaagggc aaagataagt aggtaagata ggactcctgc 7500

cctcaagaag tttccttggc aggtagaaga cagaagtagc cgaaagccaa gatgccttaa 7560

gataaataat acagtgatgg tgatcggtca ttaaaagcaa tttattttgt ttattttgtt 7620

ctgtttttca cttgtttttt gctttgttgg tggtgtttgt ttgtttgttt gttttacttg 7680

gtttggcttt ggctttggat atcgaattcc gaagttccta ttctctagaa agtataggaa 7740

cttcaggtct gaagaggagt ttacgtccag ccaagctagc ttggctgcag gtcgtcgaaa 7800

ttctaccggg taggggaggc gcttttccca aggcagtctg gagcatgcgc tttagcagcc 7860

ccgctgggca cttggcgcta cacaagtggc ctctggcctc gcacacattc cacatccacc 7920

ggtaggcgcc aaccggctcc gttctttggt ggccccttcg cgccaccttc tactcctccc 7980

ctagtcagga agttcccccc cgccccgcag ctcgcgtcgt gcaggacgtg acaaatggaa 8040

gtagcacgtc tcactagtct cgtgcagatg gacagcaccg ctgagcaatg gaagcgggta 8100

ggcctttggg gcagcggcca atagcagctt tgctccttcg ctttctgggc tcagaggctg 8160

ggaaggggtg ggtccggggg cgggctcagg ggcgggctca ggggcggggc gggcgcccga 8220

aggtcctccg gaggcccggc attctgcacg cttcaaaagc gcacgtctgc cgcgctgttc 8280

tcctcttcct catctccggg cctttcgacc tgcagcctgt tgacaattaa tcatcggcat 8340

agtatatcgg catagtataa tacgacaagg tgaggaacta aaccatggga tcggccattg 8400

aacaagatgg attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg 8460

actgggcaca acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg 8520

ggcgcccggt tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaggacg 8580

aggcagcgcg gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg 8640

ttgtcactga agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc 8700

tgtcatctca ccttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc 8760

tgcatacgct tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc 8820

gagcacgtac tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc 8880

aggggctcgc gccagccgaa ctgttcgcca ggctcaaggc gcgcatgccc gacggcgatg 8940

atctcgtcgt gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct 9000

tttctggatt catcgactgt ggccggctgg gtgtggcgga ccgctatcag gacatagcgt 9060

tggctacccg tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc 9120

tttacggtat cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt 9180

tcttctgagg ggatcaattc tctagagctc gctgatcagc ctcgactgtg ccttctagtt 9240

gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa ggtgccactc 9300

ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt 9360

ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa gacaatagca 9420

ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc agctggggct 9480

cgactagagc ttgcggaacc cttcgaagtt cctattctct agaaagtata ggaacttcat 9540

cagtcaggta cataatataa cttcgtataa tgtatgctat acgaagttat taggtggatc 9600

cactaggcgc gccgatatcc tttggctttg gttttggttt gtgagacagg ttatcactgt 9660

gtagcccagg ctggccttga actcactgca atcctcctgc cttagcctcc ctggtggtgg 9720

gattacagat gtgagccacc gagcctagtt tatagctatt ccagttaggt ctcaggatgt 9780

cctgaaaaca gtagaaggtg gattttagag attgcaagcc gtcctgagtc acatagctgc 9840

agagcggaag gaagagaatt aatattcagg ctcagaaacg ctataataaa atgtgtcttg 9900

aagcaaagtt gaaggctggt ttgctgtcgg ttttcgtcca ggtaaattgg gtgaaaccct 9960

cctccccgga tgtggtagtg aaaggctctc tcagggtgga cctgttgtct ctcttgtgtt 10020

tcatgagacg gtagatgtag ctattctatg taggttcctg ggtcgttcct gggcctagca 10080

tgctgaaaac gagtcacgtg tgaggtatgg tgctctctgg tatgtaaatg tttagtgaag 10140

aagctgttca gccagcaagg gcggagtgag gtcattcctg gcccacagtg atgatccggg 10200

tgctcgattc tgccttcatt taggctgcaa agtaagaaaa cgaaagtgta ctctccagtg 10260

tccattttcc tccaagaaga aaactggagg gttttgtttg tttgggtttg tttttgtttt 10320

tactttgatg tctttctcct tgttttgagg tttttttatt ttatgttttt attatttttt 10380

tatttgatgg gtagcacaga taatatctaa gagcacatag cacaagggtt ggaattctga 10440

ctccaccgct cactagtcac atgacagtgc ttaggtactt agccttcctg tgcctctatc 10500

ttcacatcta taaaatgggc ttatgctagc gcaaataggt tgtacatctt gtaggttcag 10560

tgtgagaact aagtaagttg atattcctag cacctggaaa ggactgtgta ctttcttgct 10620

acattaaagg agccatccag accggctagt acaagatttt ggtcacttct gaggaatcct 10680

cgtgcccatg acagcccaga tattccagat ctattttcac cacaagattc agaaagtcgg 10740

ggcagggaaa gaaagcaagg gtatatgtac gtgataggcc atttctccac cagtgaaatg 10800

agccgattca aggcagatta gagtatatta cggcaggttt gttgggaagt tgctctaagg 10860

aaagttcact ggccccctag actgagatca aggaagttac catggagagg gggtggggga 10920

gagaaagaga gaaagggtgt gtacagggag agaagacaga gagagagaga aggggggaga 10980

gagagggggc gtggaaaatg cctggattat atcatgaaga acctctaaag gaagggcagc 11040

ccagccccta ggctggaaag ttcagaactg ggggcagggt ttgtcaggta gggactgagg 11100

gatgctggga gaatctggag gccagatctg atttgatatg taaactatgc acctcagttc 11160

cttgtccctg ggtcctaaat caaaccgtaa gaaagttgtg gggtgcaagg aactagtgga 11220

ggatccaggc agaaggttga gtagcctggc aaacacacag gggtattgtg tgaaatgcca 11280

ggatccaaaa ccgaagtaac cgcctgctgt ccccccagtg tatatgtagg ataacttcag 11340

aataactagc ctgaaccgct cctgggcagc ttcagtttct taccctacca ctgactgacc 11400

tcttgtgcat ctaaagtgca ttgccctggg ccccactttg aacttactga ccataaccaa 11460

cttgaacctt tagatgtcat gcttagaccc ctcagttaga cacgctgcca tgtctctccc 11520

tctgtctctg tattttaaga caatcttgtc acctagccca gacttgtctc tcatgggatc 11580

aaaaatgtac atcctcattc ttgactccat gtcactttcc tgcacagagg ttgacaagca 11640

cttagtcttt aaggggacgc ttcaaaagca aacaacaaca gaactctttc tgattcctgg 11700

caaaaaagga agagggagag gataagagcc atcaccacta acaaataccc acaaagaaga 11760

cgtagattta gaccatagcc ttcctgggga ctgaggaatt ctagggcatg ccctcgggca 11820

gtgagtctga gtaacttgtt tatacatagc tagcatagtt cttggtttaa aagtcttagt 11880

ttcttaggac tggatgaagg agacaaaaaa aaacaaaaaa caaaaaaaac aaaaaaaaaa 11940

aaaaaacaag agattagatg gagccaaatc tttcttagag ctcatgaacc tgtgactcat 12000

accaaccata aaagggcccc attgatcctg ggacaatggc agatagtggg ggctcctagg 12060

atcgcccggg ttgattcgag gctgctaaca aatcgagcag tgtggttttc aagaggaagc 12120

aaaaagcctc tccacccagg cctggaatgt ttccacccaa tgtcgagcag tgtggttttg 12180

caagaggaag caaaaagcct ctccacccag gcctggaatg tttccaccca atgtcgagca 12240

aaccccgccc agcgtcttgt cattggcgaa ttcgaacacg cagatgcagt cggggcggcg 12300

cggtcccagg tccacttcgc atattaaggt gacgcgtgtg gcctcgaaca ccgagcgacc 12360

ctgcagcgac ccgcttaaca gcgtcaacag cgtgccgcag atcttggtgg cgtgaaactc 12420

ccgcacctct tcggccagcg ccttgtagaa gcgcgtgcca tggatcctga tgatgttgtt 12480

gattcttcta aatcttttgt gatggaaaac ttttcttcgt accacgggac taaacctggt 12540

tatgtagatt ccattcaaaa aggtatacaa aagccaaaat ctggtacaca aggaaattat 12600

gacgatgatt ggaaagggtt ttatagtacc gacaataaat acgacgctgc gggatactct 12660

gtagataatg aaaacccgct ctctggaaaa gctggaggcg tggtcaaagt gacgtatcca 12720

ggactgacga aggttctcgc actaaaagtg gataatgccg aaactattaa gaaagagtta 12780

ggtttaagtc tcactgaacc gttgatggag caagtcggaa cggaagagtt tatcaaaagg 12840

ttcggtgatg gtgcttcgcg tgtagtgctc agccttccct tcgctgaggg gagttctagc 12900

gttgaatata ttaataactg ggaacaggcg aaagcgttaa gcgtagaact tgagattaat 12960

tttgaaaccc gtggaaaacg tggccaagat gcgatgtatg agtatatggc tcaagcctgt 13020

gcaggaaatc gtgtcaggcg atctctttgt gaaggaacct tacttctgtg gtgtgacata 13080

attggacaaa ctacctacag agatttaaag ctctaaggta aatataaaat ttttaagtgt 13140

ataatgtgtt aaactactga ttctaattgt ttgtgtattt tagattccaa cctatggaac 13200

tgatgaatgg gagcagtggt ggaatgcaga tcctagagct cgctgatcag cctcgactgt 13260

gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct tgaccctgga 13320

aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc attgtctgag 13380

taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg aggattggga 13440

agacaatagc aggcatgctg gggatgcggt gggctctatg gcttctgagg cggaaagaac 13500

cagcccgggc ggtggagctc cagcttttgt tccctttagt gagggttaat ttcgagcttg 13560

gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac 13620

aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gagctaactc 13680

acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg 13740

cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgct 13800

tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 13860

tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 13920

gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 13980

aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 14040

ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 14100

gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 14160

ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 14220

ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 14280

cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 14340

attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 14400

ggctacacta gaagaacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 14460

aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt 14520

gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt 14580

tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga 14640

ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc 14700

taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct 14760

atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata 14820

actacgatac gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca 14880

cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga 14940

agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga 15000

gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg 15060

gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga 15120

gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt 15180

gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct 15240

cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca 15300

ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat 15360

accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga 15420

aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc 15480

aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg 15540

caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc 15600

ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt 15660

gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca 15720

c 15721

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Tagln -Cre -F

<400> 2

gcggtctggc agtaaaaact atc 23

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Tagln -Cre-R

<400> 4

gtgaaacagc attgctgtca ctt 23

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Best3_LoxP_F

<400> 4

gtggctgagg caggagaatt aca 23

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Best3_LoxP_R

<400> 5

aacctgtggg aaaacctcta tctcc 25

<210> 6

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Best3_Neo_Del_F

<400> 6

cagaagtagc cgaaagccaa gatgcc 26

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<223> Best3_Neo_Del_R

<400> 7

ttacctggac gaaaaccgac agca 24

Claims (3)

1. The method for constructing the aortic dissection mouse model is characterized by comprising the following steps of: best3 with Bestrophin3 Gene loss of function ^SMKO Mice, rearing Best3 ^SMKO Mice reached 8 weeks of age or more spontaneously developed aortic dissection or aortic aneurysm; the Best3 ^SMKO The mice are Bestrophin3-flox homozygous and Tagln-Cre positive mice obtained by hybridization of Bestrophin3 chimeric flox heterozygous and Tagln-Cre positive mice with Bestrophin3-flox homozygous mice;

the Best3 ^SMKO The construction method of the mice comprises the following steps:

(1) Adopting a Cre/LoxP recombination system, selecting exon 3 and exon4 of a Bestrobin 3 gene as knockout regions, deleting the regions to cause the loss of functions of the Bestrobin 3 gene of a mouse, using a C57BL/6 mouse genome as a template to amplify an upstream homology arm, a downstream homology arm and a flox region, inserting LoxP in an intron2 of the Bestrobin 3 gene, inserting FRT-Neo expression frame-FRT-LoxP in the intron4, and connecting the regions to a framework to form a targeting vector;

(2) The targeting vector is linearized and transfected into embryo stem cells of a C57BL/6 mouse, successfully homologous recombination embryo stem cells are identified and screened through PCR, and then the embryo stem cells with positive expression are microinjected into blastula and transplanted into pseudopregnant mice;

(3) Obtaining F1 generation hybrid mice through passage, and identifying the obtained Bestrophin3-flox heterozygote mice by utilizing PCR;

(4) Selfing and PCR screening the Bestrophin3-flox heterozygote mice to obtain Bestrophin3-flox homozygous mice, then hybridizing and breeding the Bestrophin3-flox homozygous mice with vascular smooth muscle cre tool mice to obtain F1 generation hybrid mice, separating milk at 3 weeks and identifying the genotype of the mice by using a rat tail method, and hybridizing the Bestrophin3 chimeric flox heterozygotesAnd the Tagln-Cre positive mice are hybridized with the Bestrophin3-flox homozygous mice again, and the Best3 which is homozygous for the Bestrophin3-flox and positive for the Tagln-Cre is obtained through PCR identification and screening ^SMKO A mouse;

the Best3 ^SMKO The sequence of the mouse targeting vector is shown as SEQ ID NO. 1.

2. The method of constructing an aortic dissection mouse model according to claim 1, wherein in Best3 ^SMKO Starting the 4 th week of raising, and simultaneously inducing angiotensin II into mice for 28 days or more, wherein the induction concentration of angiotensin II is 1-2 mg.kg ^-1 ·d ^-1 。

3. The use of an aortic dissection mouse model constructed by the construction method of the aortic dissection mouse model according to any one of claims 1-2 in screening a drug for treating aortic dissection or aortic aneurysm.

Images