CN102229662B

CN102229662B - Lotus annexin and expression vector and application thereof

Info

Publication number: CN102229662B
Application number: CN201110158933XA
Authority: CN
Inventors: 黄上志; 楚璞; 陈虎辉; 黎茵; 周玉亮
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2011-06-14
Filing date: 2011-06-14
Publication date: 2013-02-20
Anticipated expiration: 2031-06-14
Also published as: CN102229662A

Abstract

The invention discloses a lotus annexin and an expression vector and application thereof, and belongs to the technical field of plant gene engineering. The lotus annexin has an amino acid sequence shown as SEQ ID NO.1, and the nucleotide sequence of the coded gene of the lotus annexin is shown as SEQ ID NO.2. The invention also discloses the expression vector of the lotus annexin. The expression vector is formed by inserting the coded gene of the lotus annexin into a prokaryotic or eukaryotic expression vector. The lotus annexin can effectively improve the heat resistance of plant seeds and enhance the germinating activity of the seeds, and has wide application prospect in the fields of plant variety breeding and agricultural production.

Description

A kind of lotus annexin and expression vector and application

Technical field

The present invention relates to molecular biology and plant gene engineering technology field, be specifically related to a kind of lotus annexin and application thereof that improves plant seed thermotolerance and seed vitality.

Background technology

High temperature is one of important environmental factors that affects plant-growth, development and fecundity.Because the impact of Greenhouse effect, the trend of global warming is day by day obvious, the harm that crop quality and output are caused that descends of the seed vitality that high temperature causes and survival rate also increasingly sharpens, therefore, the heat-resisting mechanism of research seed, seek the key gene that improves seed thermotolerance and vigor, have important scientific meaning and economic worth.

Lotus ( Nelumbo nuciferaGaertn.) seed be up to now confirmed the most long-lived and one of the most resistant to elevated temperatures seed (; Shen-Miller, et al., 1995, Exceptional seed longevity and robust growth:ancient sacred lotus from China. Am J Bot 82:1367-1380; ), show that the lotus seed has very efficiently defence and repair system, provides splendid material for we excavate the seed thermotolerance new gene relevant with seed vitality.

Annexin (Annexins) is a class Ca ²⁺And phospholipids incorporate albumen, at the organic sphere ubiquity (Mortimer except yeast, et al., 2008, Annexins:multifunctional components of growth and adaptation. J Exp Bot 59:533-544).Plant annexins participates in exocytosis, cell elongation, Cell wall synthesis, the physiological processs such as nodule formation and fruit maturation.Studies show that more and more plant annexins has Peroxidase activity, various Stress response reactions in the involved in plant, comprise low temperature stress, drought stress, the salt stress, (Breton such as heavy metal stress and oxidative stress, G., et al., 2000, Two novel intrinsic annexins accumulate in wheat membranes in response to low temperature. Plant Cell Physiol 41:177-184; Lee, S., et al., 2004, Proteomic identification of annexins, calcium-dependent membrane binding proteins that mediate osmotic stress and abscisic acid signal transduction in Arabidopsis. Plant Cell 16:1378-1391; Jami, S.K., et al., 2008, Ectopic expression of an annexin from Brassica juncea confers tolerance to abiotic and biotic stress treatments in transgenic tobacco. Plant Physiol Bioch 46:1019-1030; Konopka-Postupolska, D., et al., 2009, The role of annexin, 1 in drought stress in Arabidopsis. Plant Physiol 150:1394-1410).Because the oxidative stress that a large amount of generations of active oxygen (ROS) cause is considered to one of topmost composition of heat injury (Kim, K.H., et al., 2010, Enhanced tolerance of transgenic tall fescue plants overexpressing 2-Cys peroxiredoxin against methyl viologen and heat stresses. Biotechnol Lett 32:571-576), the effect of annexin in acclimation to heat can not be ignored.(the Rhee such as Rhee, H.J., et al., 2000, Annexin I is a stress protein induced by heat, oxidative stress and a sulfhydryl-reactive agent. Eur J Biochem 267:3220-3225) finds the expression that high temperature has improved annexin I when zooblast is heat-treated, show that it may be the heat stress response protein, but in plant, there is no the annexin report relevant with the seed thermotolerance at present.

Summary of the invention

The object of the invention is to according to above-mentioned deficiency of the prior art, a kind of albumen lotus annexin relevant with vigor with the plant seed thermotolerance is provided.

Another object of the present invention provides the expression vector of above-mentioned lotus annexin.

Another purpose of the present invention provides the application of above-mentioned lotus annexin.

The present invention is achieved through the following technical solutions above-mentioned purpose:

A kind of lotus annexin, called after NnANN1( Nelumbo nuciferaAnnexin1), derive from Chinese lotus ( Nelumbo nuciferaGaertn.), be the protein of following (1) or (2):

(1) aminoacid sequence of this albumen is shown in SEQ ID NO:1;

(2) the derivative protein by replacement, disappearance or the interpolation of sequence SEQ ID NO:1 being passed through one or several amino-acid residue, and this albumen has identical biological activity with the albumen of (1).

The encoding gene of above-mentioned lotus annexin ( NnANN1Gene), NnANN1Opening code-reading frame is 948 bp, 5 '-UTR is 63 bp, 3 '-UTR is 312 bp, 315 amino acid of encoding.The nucleotide sequence of this encoding gene is shown in SEQ ID NO:2.Perhaps with sequence shown in the SEQ ID NO:2 90% above homology is arranged, and the albumen of this dna molecule encode has identical biological activity with the albumen of (1).

A kind of lotus annexin expression vector comprises the encoding gene of lotus annexin.Soon encoding gene is inserted in the carrier that sets out and obtains, and the carrier that sets out can be selected various carriers known in the art.

The above-mentioned carrier that sets out is preferably prokaryotic expression carrier pET14b, pET32a or carrier for expression of eukaryon pBI121 etc.

A kind of preparation method of lotus annexin expression vector, step is as follows:

(1) take the lotus cDNA library as template, carry out PCR take SEQ ID NO:3 ~ 4 as primer, obtain the encoding gene of lotus annexin;

(2) the PCR product with step (1) is connected with the pGEMT-Easy carrier, obtains intermediate carrier;

(3) intermediate carrier transforms the bacillus coli DH 5 alpha competence, cultivates laggard performing PCR, enzyme is cut and check order evaluation;

(4) identify that correct thalline carries out being connected with the carrier that sets out behind the double digestion, the connection product transforms the bacillus coli DH 5 alpha competence again, cultivates laggard performing PCR, enzyme is cut and the evaluation of checking order, and identifies the correct lotus annexin expression vector that is.

A kind of agrobacterium tumefaciens contains above-mentioned expression vector, and preferred starting strain is agrobacterium tumefaciens EHA105.

Above-mentioned lotus annexin or its encoding gene are improving the seed resistance toheat or/and the application in the promotion seed germination activity.

Compared with prior art, the present invention has following beneficial effect:

By plant expression vector lotus annexin of the present invention is changed in the plant, can improve the sprouting vigor of plant seed under heat stress and temper(ing) condition.Sprout experiment with changing the seed of expression plasmid and wild type seeds over to after with 50 ℃ of pyroprocessing 6h, the seed germination speed crossed of display process and final germination rate show all apparently higher than the wild type seeds of contrast as a result NnANN1Can improve the sprouting vigor of plant seed under heat stress.Sprout Seed germination speed that the experimental result display process crosses and final germination rate behind the Artificial ageing all far above wild type seeds, show that the wild type seeds major part all lost vigor, and the seed of processing still keeps higher vigor.The above results shows that NnANN1 has the ability that improves plant seed thermotolerance and vigor.This albumen is for the research of the heat-resisting molecular mechanism of seed, and the seed selection of high vigor and stable on heating kind has important theory significance and economic worth, and the present invention has wide application space and market outlook at agriculture field.

Description of drawings

Fig. 1. plant expression vector pBI121- NnANN1Diagram, RB is right margin, LB is left margin.

Fig. 2. the Q-PCR of transgenic arabidopsis seed and Western Blot detected result, A is the expression analysis result of Q-PCR, and WT represents wild-type, and OE1, OE2, OE3 are respectively 3 different transgenic lines; B is the detected result of Western Blot, and 35kD is molecular size range, CBB: Xylene Brilliant Cyanine G.

Fig. 3. the sprouting interpretation of result figure after wild-type and the thermal treatment of transgenic arabidopsis seed, WT represents wild-type, OE1, OE2, OE3 represent three different transgenic lines.

Fig. 4. the growth of seedling figure after wild-type and the thermal treatment of transgenic arabidopsis seed, WT represents wild-type, OE1, OE2, OE3 represent three different transgenic lines.

Fig. 5. the sprouting interpretation of result figure behind wild-type and the transgenic arabidopsis seed Artificial ageing, WT represents wild-type, OE1, OE2, OE3 represent three different transgenic lines.

Fig. 6. the growth of seedling figure behind Artificial ageing wild-type and the transgenic arabidopsis seed, WT represents wild-type, OE1, OE2, OE3 represent three different transgenic lines.

Embodiment

The present invention will be further described below in conjunction with specific embodiment.In following examples, all unreceipted concrete experiment conditions, be according to normal condition well known to those skilled in the art and carry out.

Embodiment 1 lotus annexin gene NnANN1The clone

(1) preparation of lotus seed plumular axis: gather in the crops the lotus seed in the later stage of reaching maturity, strip plumular axis;

(2) extraction of total RNA: adopt the Trizol product of Invitrogen company to extract total RNA;

(3) cDNA library makes up: adopt the SMART cDNA library construction kit of Clontech company to make up the library;

(4) EST order-checking: take the positive monoclonal bacterium liquid that obtains as the order-checking sample, entrust Shanghai Bo Ya biotech company, the positive monoclonal after with 3730 sequenators PCR being verified carries out sequencing;

(5) homology retrieval: use the homologous gene of BLAST instrument search gained est sequence in GenBank, confirm that the gene that obtains is lotus annexin gene.

The structure of embodiment 2 plant expression vectors

(1) gene fragment clone: take embodiment 1 described lotus cDNA library as template, obtain having added restriction enzyme site by the PCR clone SmaI and SacThe PCR fragment of I.The PCR primer is as follows, and underscore partly is restriction enzyme site:

Forward primer: SEQ ID NO:3:5 '-TCC CCCGGGATGGCTACCATCACAGTCCCTG-3 ';

Reverse primer: SEQ ID NO:4:5 '-CTG GAGCTCTCACAGCTCTTCGCACCCCAGT-3 ';

The PCR reaction system is: 2 μ l lotus cDNA libraries, 6 μ l dNTP(2.5 mM), 1.5 μ l forward primer (10 μ M), 1.5 μ l reverse primer (10 μ M), 5 μ l, 10 * PCR damping fluid, 1 μ l EX Taq enzyme (Takara company product) replenishes deionized water at last, and making totally is 50 μ l.The reaction conditions of PCR is: 94 ℃ 3 minutes; Then enter following circulation: 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 30 seconds, totally 30 circulations; Last 72 ℃ were extended 7 minutes.

(2) the T carrier connects: get 2 μ l PCR products and be connected with the pGEMT-Easy carrier, operate structure intermediate carrier pGEMT-MT2a according to the specification sheets step of Promega company.

(3) intestinal bacteria transform: intermediate carrier pGEMT-MT2a is transformed bacillus coli DH 5 alpha competence (day root company product), operate according to the product description of sky root company.Coated plate on the LB solid medium that contains IPTG, X-gal and penbritin (100mg/l), after 37 ℃ of incubated overnight, the single bacterium colony of picking white is grown in the LB liquid nutrient medium that contains penbritin (100mg/l), and the bacterium liquid that takes a morsel carries out PCR to be identified.

(4) preparation of bacteria plasmid DNA: collect the thalline in the above-mentioned LB liquid nutrient medium, prepare bacteria plasmid DNA according to the little extraction reagent kit specification sheets of plasmid of sky root company, the enzyme evaluation of cutting and check order.Order-checking is finished by Guangzhou Invitrogen company.

(5) structure of expression vector: extract the correct clone's of order-checking plasmid, according to the product description of Takara company, use SmaI and SacI carries out double digestion, then reclaims small segment, connects among the expression vector pBI121 with same enzymic digestion, makes up plant expression vector pBI121- NnANN1, diagram as shown in Figure 1.Then will connect product and transform the bacillus coli DH 5 alpha competence, carry out PCR, enzyme is cut and check order evaluation.

(6) conversion of agrobacterium tumefaciens: extract the correct clone's of order-checking plasmid, transform agrobacterium tumefaciens EHA105 by electric shocking method.

The genetic transformation of embodiment 3 Arabidopis thalianas

1. transformation of Arabidopsis thaliana pre-treatment

When its main tongue grows to 5-6cm, cut whole inflorescence at the inflorescence base portion, remove its apical dominance, 1 all rear 4-6 newborn side tongues that grow at the axillalry bud position, treat that its side tongue inflorescence forms that bud and part are bloomed or when forming 1-2 angle fruit, namely can be used for transforming, need cut off the angle that grown up to before the conversion really.Water sufficient moisture to plant the day before yesterday that transforms, and cover a plastics bag to keep high humidity environment.

2. contaminate the preparation of substratum

The dip-dye medium component that be used for to soak the Arabidopis thaliana titbit is the 1/2MS substratum that contains 5% sucrose, pH=5.8 (regulating with KOH), autoclaving.Time spent is added 0.02%-0.05% tensio-active agent Silwet L-77 or tensio-active agent tween 20 (tween-20), and operation needs soft.

3. Agrobacterium is prepared and transformation of Arabidopsis thaliana

(1) activation of bacterial classification: the bacterium that transforms agrobacterium tumefaciens EHA105 liquid or dull and stereotyped preservation that will store is drawn the plate activation at the YEB solid medium that contains kantlex (Km, 100mg/L) and Rifampin (Rif, 30mg/L), and the performing PCR of going forward side by side detects;

(2) the positive Agrobacterium of the mono-clonal that contains goal gene of picking activation is trained in the base to the fresh YEB liquid that contains kantlex and Rifampin of 5m1, and 28 ℃, 180rpm shakes training 24 hours;

(3) get above-mentioned bacterium liquid 5ml(1%-2%) be connected in the fresh YEB liquid nutrient medium that contains kantlex and Rifampin of 500 m1,28 ℃, 180rpm cultivated 18-24 hour, made OD value reach about 0.8 (usefulness YEB+Rif+Km is as blanks);

(4) above-mentioned bacterium liquid is divided install in the 100 ml centrifuge tubes, room temperature, 5000 leave the heart collected thalline in 20 minutes;

(5) with bacterial suspension in contaminating substratum, make final thalline suitable concentration OD600 value be approximately 0.8-1(and compare with the dip-dye substratum);

(6) above-mentioned dip-dyeing solution is poured in the beaker, plant to be transformed is tipped upside down on rapidly in the dip-dyeing solution, take out after making 60 seconds of inflorescence submergence.As far as possible careful during operation, do not allow the soil bits wait and fall to and contaminate in the substratum;

(7) suck too much bacterium liquid with thieving paper after the conversion, but do not need to inhale too driedly.Plant is kept flat, and cover the Arabidopis thaliana over-ground part with the black plastic bag.After moisturizing is secretly cultivated 16-24h, carefully remove plastics bag, and water sufficient water, recover normal illumination;

(8) in order to improve transformation efficiency, can after a week, repeat an infection processs;

(9) normal management, the results mature seed.Seed after the results is the MS of the Pyocianil of the kantlex that contains 50mg/l and 150mg/l solid medium screening transgenic positive plant.

The Q-PCR of embodiment 4 transgenic seeds detects

(1) extraction of total RNA: extract the total RNA of Arabidopsis that test kit specification sheets step is extracted wild-type and different transgenic line according to the general RNA of the plant of hundred Imtech;

(2) first chain cDNA's is synthetic: according to the specification sheets step operation of the PrimeScript 1st Strand cDNA Synthesis Kit of Takara company;

(3) Q-PCR reaction:

NnANN1Gene primer:

Forward primer: SEQ ID NO:5:5 '-TGCGAAGTCTGACAATCGGA-3 ';

Reverse primer: SEQ ID NO:6:5 '-GCTCACATCTACCTCATCACCAT-3 '.

Confidential reference items Actin2Gene primer:

Forward primer: SEQ ID NO:7:5 '-ATTACCCGATGGGCAAGTCA-3 ';

Reverse primer: SEQ ID NO:8:5 '-TGCTCATACGGTCAGCGATA-3 '.

NnANN1With Actin2The Q-PCR reaction system be: the first chain cDNA template that 1 μ l dilution is 50 times, 12.5 μ l SYBR fluorescence real-time quantitative PCR Master Mix (Toyobo company product), 0.5 μ l forward primer (10 μ M), 0.5 μ l reverse primer (10 μ M), replenish at last deionized water, making totally is 25 μ l.The PCR reaction conditions is: 95 ℃ 10 seconds, 58 ℃ 15 seconds, 72 ℃ 20 seconds.The reaction cycle number is 40.The result of Q-PCR does not detect lotus annexin gene in wild-type Arabidopis thaliana seed shown in A among Fig. 2 NnANN1Expression, and in three different transgenic lines, can both detect in various degree expression.

The Western Blot of embodiment 5 transgenic seeds detects

(1) prokaryotic expression: take embodiment 2 described intermediate carrier pGEMT-MT2a as template, obtain having added restriction enzyme site by the PCR clone EcoRI and XhoThe PCR fragment of I.The PCR primer is as follows, and underscore partly is restriction enzyme site:

Forward primer: SEQ ID NO:9:

5′-CCG GAATTC ATGGCTACCATCACAGTCCCTG -3′；

Reverse primer: SEQ ID NO:10:

5′- CCG CTCGAGTCACAGCTCTTCGCACCCCAGT-3′；

The PCR reaction system is: 1 μ l template, 4 μ l dNTP(2.5 mM), 2 μ l forward primers (10 μ M), 2 μ l reverse primers (10 μ M), 5 μ l, 10 * PCR damping fluid, 0.3 μ l EX Taq enzyme (Takara company product) replenishes deionized water at last, making totally is 50 μ l.The PCR response procedures: 94 ℃ 3 minutes; Then enter following circulation: 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 30 seconds, totally 30 circulations; Last 72 ℃ were extended 7 minutes.PCR product behind the purifying is used EcoRI and XhoAfter the I enzyme is cut, reclaim, connect into the expression vector pET-14b(Novagen company product with same enzymic digestion) in, make up prokaryotic expression carrier 6His-NnANN1.Then transform e. coli bl21 (DE3), carry out PCR, enzyme is cut and the evaluation of checking order, method is identical with embodiment 2.The purifying of albumen carries out according to the His bind purification kit specification sheets of Novagen company.

(2) antibody preparation: the albumen behind the above-mentioned purifying is used for the injection rabbit and prepares specific antibody anti-NnANN1.

(3) protein extraction: the protein extraction of wild-type and transgenic arabidopsis seed is with reference to the method for (1997, Antisense suppression of phospholipase D [alpha] retards abscisic acid [mdash] and ethylene-promoted senescence of postharvest arabidopsis Leaves. The Plant Cell Online 9:2183) such as Fan.

(4) Western Blot: the immune marking is with reference to Mizzen(Mizzen, C.A., et al., 1996, Sensitive detection of metallothioneins-1 ,-2 and-3 in tissue homogenates by immunoblotting:a method for enhanced membrane transfer and retention. J. Biochem. Bioph. Meth. 32:77-83) method.The result of Western Blot does not detect the accumulation of lotus annexin NnANN1 at wild-type Arabidopis thaliana seed, and can both detect the accumulation of lotus annexin NnANN1 in various degree in three different transgenic line shown in B among Fig. 2.

The heat stress of embodiment 6 transgenic seeds is sprouted experiment

Wild-type and transgenic arabidopsis seed are seeded in and are positioned over 4 ℃ of laminations processing on the 1/2 MS solid medium two days later behind sterilization, process 6 h in 50 ℃ of incubators, and the seed after the pyroprocessing is sprouted under normal operation.Statistics Seed germination rate every day amounts to 7 days, the sprouting situation as shown in Figure 3, the sprouting speed of transgenic seed and final germination rate are all far above the seed of wild-type.At after planting the 7th day, the germination rate of wild type seeds only was 16%, and the germination rate of transgenic line shows the overexpression gene up to 50-64% NnANN1Can improve the vigor that seed is sprouted under heat stress.The seed growth of seedling situation that heat stress is processed is seen Fig. 4, and the wild-type seedling growth obviously is weaker than three transgenic lines.

The sprouting experiment of embodiment 7 transgenic seeds behind Artificial ageing

(1) temper(ing) is finished in moisture eliminator.Use first 10% commercially available SYNTHETIC OPTICAL WHITNER (bleach) to process the vessel such as moisture eliminator 30 minutes before aging, then use a large amount of flushing with clean water moisture eliminators, wash again once with aqua sterilisa at last, dry, prevent the growth of fungi during the temper(ing).

(2) inject aqua sterilisa in moisture eliminator bottom, will be positioned in the water isolation type constant incubator after the moisture eliminator sealing, temperature is made as 43 ℃, and balance two days allows the humidity in the moisture eliminator reach 100%.

(3) wild-type and genetically modified Arabidopis thaliana seed are installed with the centrifuge tube that removes lid of 1.5 ml after (about 100 of every pipe) put into rapidly the good moisture eliminator of balance after being positioned on the centrifuge tube shelf, the good seal moisture eliminator was processed 72 hours.Try not to open the door of constant incubator during the processing.

After (4) 72 hours, the Arabidopis thaliana seed handled well is taken out, the balance sterilization that carries out disinfection to the room temperature at once, 4 ℃ of laminations are processed and are sprouted two days later experiment, and the statistics germination rate reaches takes pictures to the growing state of seedling.Seed germination result after the temper(ing) as shown in Figure 5, the sprouting speed of transgenic seed and final germination rate are all far above the seed of wild-type.At after planting the tenth day, the germination rate of wild type seeds only was 20%, and the germination rate of transgenic line is up to 58-70%.Growth of seedling situation after the processing is seen Fig. 6, and wild-type there is no growth through burin-in process, and the seedling of three transgenic lines can normal growth, shows the overexpression gene NnANN1Can improve the vigor of seed.

SEQUENCE LISTING

＜110〉Zhongshan University

＜120〉a kind of lotus annexin and expression vector and application

<130>

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 315

<212> PRT

＜213〉artificial sequence

<400> 1

Met Ala Thr Ile Thr Val Pro Asp His Thr Ser Pro Val Glu Asp Ala

1 5 10 15

Glu Asn Leu Arg Lys Ala Cys Glu Gly Trp Gly Thr Asn Glu Asn Thr

20 25 30

Ile Val Ser Ile Leu Gly His Arg Asn Ala Val Gln Arg Lys Gln Ile

35 40 45

Arg Gln Ala Tyr Glu Glu Ile Tyr Gln Glu Asp Leu Ile Lys Arg Leu

50 55 60

Glu Ser Glu Leu Lys Gly Glu Phe Glu Lys Ala Val Tyr Arg Trp Ile

65 70 75 80

Leu Asp Pro Ala Asp Arg Asp Ala Ile Leu Ala His Val Ala Ala Arg

85 90 95

Asn Ala Lys Ser Asp Asn Arg Thr Ile Ile Glu Ile Ala Cys Ile Arg

100 105 110

Ser Pro Glu Glu Leu Leu Ala Ala Lys Arg Ala Tyr His Phe Arg Tyr

115 120 125

Lys His Ser Leu Glu Glu Asp Val Ala Ser Arg Thr Thr Gly Asp Phe

130 135 140

Arg Lys Leu Leu Val Ala Leu Val Ser Thr Tyr Arg Tyr Asp Gly Asp

145 150 155 160

Glu Val Asp Val Ser Leu Ala Gly Ser Glu Ala Lys Ile Leu His Asn

165 170 175

Met Ile Glu Gly Lys Ser Phe Asn His Glu Glu Val Ile Arg Ile Leu

180 185 190

Ser Thr Arg Ser Lys Ala Gln Leu Asn Ala Thr Phe Asn Arg Tyr Lys

195 200 205

Asp Thr His Gly Ala Ser Ile Thr Lys Ser Leu Ser Gly Asn Pro Ala

210 215 220

Asp Glu Phe Ser Glu Ala Leu Cys Ile Ala Ile Gln Cys Ile Arg Ser

225 230 235 240

Pro Gln Lys Tyr Phe Glu Lys Val Leu Arg Asn Ala Ile Asn Lys Val

245 250 255

Gly Thr Asp Glu Asp Ala Ile Thr Arg Val Ile Val Thr Arg Ala Glu

260 265 270

Lys Asp Leu Lys Asp Ile Lys Asp Leu Tyr His Lys Arg Asn Asn Ala

275 280 285

Ser Leu Glu His Ala Ile Ser Lys Asp Thr Ser Gly Asp Tyr Lys Ile

290 295 300

Phe Leu Leu Thr Leu Leu Gly Cys Glu Glu Leu

305 310 315

<210> 2

<211> 1323

<212> DNA

＜213〉artificial sequence

<400> 2

tgtgcaggct gtagagtgta gaagagaaag aaacagtaag gggttttaag tgattgctca 60

acaatggcta ccatcacagt ccctgatcac acttctcctg ttgaagatgc agagaacctc 120

agaaaggctt gcgagggatg ggggaccaat gagaatacca ttgtttcaat actcgggcat 180

agaaatgcag ttcaaaggaa acaaatcagg caggcttatg aggagattta tcaagaagat 240

ctaattaagc gacttgaatc cgaactcaaa ggggaatttg agaaagctgt atatcgctgg 300

atactagatc ctgcagacag agatgcaatc ttggctcatg tagctgctag aaatgcaaag 360

tctgacaatc ggacgatcat tgaaattgct tgcattcgat ctcccgagga actcttggcg 420

gcgaaacggg cctaccattt ccgctacaag cattctctgg aggaagatgt cgcctctcgt 480

actacaggcg acttccgtaa gcttctagtt gccttagtga gcacttacag gtatgatggt 540

gatgaggtag atgtgagcct agctggatca gaagccaaaa ttcttcataa tatgattgaa 600

gggaaatcct ttaaccatga agaggtaatc agaatcttaa gcacaaggag caaggcacag 660

ctcaatgcaa ccttcaaccg ctacaaggac acacatggag cttccattac caagagttta 720

tcaggtaatc ctgctgatga gttctctgag gcactatgta tagctatcca atgcatcaga 780

tcacctcaaa agtactttga aaaggttctg cgtaatgcaa ttaataaggt aggaactgat 840

gaagatgcaa ttacgcgtgt gattgtaaca cgtgcagaga aggacttgaa ggacatcaag 900

gatttatatc acaagagaaa caatgcatct cttgagcatg caatcagcaa ggatacttca 960

ggcgactaca aaattttcct ccttacttta ctggggtgcg aagagctgta actctgttgt 1020

ccaaatgtgt ggaagaaatt gttaaatctg gattctgtgg tttgagaatt ggtgtctggt 1080

ttgtggggtt tagtttctag gctactggga aagcattttg ctttctgggt tgttaaatgg 1140

taacgagtgc tgaactttgg tgtgcaaata atcctatgat ttccattact cctgctctgt 1200

ttcttcccta gtttctgagt gtcttagatc agaatcttgc ttgatgttta ccggttggaa 1260

ctcagctttc taagaaattt ttatgatgtt gatgaaaaaa aaaaaaaaaa aaaaaaaaaa 1320

aaa 1323

<210> 3

<211> 31

<212> DNA

＜213〉artificial sequence

<400> 3

tcccccggga tggctaccat cacagtccct g 31

<210> 4

<211> 31

<212> DNA

＜213〉artificial sequence

<400> 4

ctggagctct cacagctctt cgcaccccag t 31

<210> 5

<211> 20

<212> DNA

＜213〉artificial sequence

<400> 5

tgcgaagtct gacaatcgga 20

<210> 6

<211> 23

<212> DNA

＜213〉artificial sequence

<400> 6

gctcacatct acctcatcac cat 23

<210> 7

<211> 20

<212> DNA

＜213〉artificial sequence

<400> 7

attacccgat gggcaagtca 20

<210> 8

<211> 20

<212> DNA

＜213〉artificial sequence

<400> 8

tgctcatacg gtcagcgata 20

<210> 9

<211> 31

<212> DNA

＜213〉artificial sequence

<400> 9

ccggaattca tggctaccat cacagtccct g 31

<210> 10

<211> 31

<212> DNA

＜213〉artificial sequence

<400> 10

ccgctcgagt cacagctctt cgcaccccag t 31

Claims

1. a lotus annexin is characterized in that the aminoacid sequence of this albumen is shown in SEQ ID NO:1.

2. the encoding gene of the described lotus annexin of claim 1 is characterized in that nucleotide sequence is shown in SEQ ID NO:2.

3. a lotus annexin expression vector is characterized in that comprising encoding gene claimed in claim 2.

4. expression vector according to claim 3, the carrier that it is characterized in that setting out is prokaryotic expression carrier pET14b, pET32a or carrier for expression of eukaryon pBI121.

5. the preparation method of claim 3 or 4 described expression vectors is characterized in that step is as follows:

6. an agrobacterium tumefaciens is characterized in that containing claim 3 or 4 described expression vectors.

7. agrobacterium tumefaciens according to claim 6 is characterized in that with agrobacterium tumefaciens EHA105 as the bacterium that sets out.

8. the application of the encoding gene of the described lotus annexin of claim 2 in improving seed resistance toheat or promotion seed germination activity.