CN102199673A - Novel fluorescence quantitative PCR (Polymerase Chain Reaction) detection method of encephalitis B virus and encephalitis B virus detection PCR system - Google Patents

Abstract

The invention discloses a novel fluorescence quantitative PCR (Polymerase Chain Reaction) detection method of encephalitis B virus and an encephalitis B virus detection PCR system. The system consists of a primer and a probe, a Premix ex Taq reaction solution and sterilized Tris water. The primer and the probe have good detection specificity and high sensitivity; and the encephalitis B virus detection PCR system is very suitable for detecting encephalitis B virus and has no cross reaction on dengue fever virus and yellow fever virus.

Description

Encephalitis b virus fluorescence quantitative PCR detection novel method and encephalitis b virus detect the PCR system

Technical field

The invention belongs to field of biological detection, be specifically related to step on fast qualitative and the quantitative detecting method and the encephalitis b virus detection PCR system of encephalitis b virus, a pair of Auele Specific Primer and probe are provided.

Background technology

(epidemic encephalitis B JE) is called for short encephalitis to epidemic encephalitis type B, claims japanese encephalitis virus through the mosquito media transmission again by encephalitis b virus, causes the acute viral transmissible disease based on central nervous system damage.Distributed more widely, comprise the torrid zone, subtropics, temperate zone and area, middle temperate zone, some countries of South East Asia are especially many, and global reported cases are counted every year more than 16000, dead 5000 examples.The diagnostic method that uses for encephalitis has the detection of ELISA serology, hemagglutination-inhibition test (HI), RT-PCR detection of nucleic acids etc. at present.But the method for quantitative fluorescent PCR detection of nucleic acids was not also used, it can yet be regarded as a kind of more directly perceived, be fit to the examination criteria of early diagnosis accurately and rapidly.

Summary of the invention

The object of the present invention is to provide a kind of encephalitis b virus fluorescence quantitative PCR detection novel method and encephalitis b virus to detect the PCR system, this method can fast qualitative and detection by quantitative encephalitis b virus, comprises that a pair of specificity is higher, highly sensitive, the primer of good reproducibility and probe.

For achieving the above object, encephalitis b virus fluorescence quantitative PCR detection novel method of the present invention, wherein the primer probe of design employing is:

Name	Sequence	Position	Tm℃	Modification
					FP	GTTTATCTGTGTGAACTTCTTGGC	5-28	57.9	?
RP	TTTAGTCATGGTTATCTTCCGTTC	81-104	57.7	?
					Rrobe	AGTATCGTTGAGAAGAATCGAGAGATTAGTGC	31-62	67.8	CY3/BHQ-2

Further, described encephalitis b virus fluorescence quantitative PCR detection novel method is specially:

1) design primer probe;

2) select fluorescein according to instrument;

3) synthetic primer and probe;

4) preparation positive plasmid standard substance;

5) operation PCR;

6) data analysis;

7) extract viral RNA and carry out the system checking.

Further, described step 2) the selective fluorescent emission group of fluorescein has 6-FAM, TET, HEX, JOE, CY3, CY5, TAMRA, Texas Red in, and the fluorescent quenching group has BHQ-1, BHQ-2, Lowa Black ^TMRQ, Lowa Black ^TMFQ, Dabcyl.

Further, take the gene synthesis mode to make positive plasmid CBG229-1 as positive in the described step 4): to carry out gene synthetic with prolonging 5～50bp before and after the high conserved region territory bp5-bp104 that filters out in the design of primers process respectively, be cloned into then in the pMD19-T carrier, be described positive plasmid sample, numbering CBG229-1.

Further, the quantitative fluorescent PCR reaction is applicable to all quantitative fluorescent PCR reaction instrument in the described step 5).

Further, described quantitative fluorescent PCR reaction instrument comprises SmartCyclerII, ABI real-time PCR system, BioRad PCR in real time detection system, Stratagene quantitative polumerase chain reaction instrument.

Further, best amplification condition is in the described step 5):

A kind of encephalitis b virus detects the PCR system, and this system comprises that primer or other can combine the primer that is equal to of also amplification with encephalitis B full length sequence specificity, and its similar homology can not surpass 90%, and primer sequence is as follows:

A kind of encephalitis b virus detects the PCR system, this system comprise primer and can with encephalitis B full length sequence specific probe, probe sequence is as follows:

Can combine the probe that is equal to of also amplification with encephalitis B full length sequence specificity, the fraction of coverage of its site areas can not surpass 50%, and its homology can not surpass 70%.

The present invention designs a pair of new primer probe, sets up a kind of fluorescence quantitative PCR method in conjunction with utilization SmartCyclerII and detects encephalitis b virus.Pick out the conservative sequence of encephalitis b virus genome camber by the mode of sequence alignment, the a pair of primer of design and a Taqman probe on this sequence, set up the real-time fluorescence quantitative PCR reaction system, and be optimized, detect the sensitivity and the specificity of this method.

Description of drawings

Fig. 1 is that the two dimension of amplification curve shows figure;

Fig. 2 is 1e ³, 1e ², 1e ¹, 1e ⁰The amplification curve diagram of four gradient templates of copies/ μ l; X-axis is represented the amplification cycles number, and Y-axis is represented fluorescence signal intensity;

Fig. 3 is 1e ⁰The graphic representation of 6 parallel amplifications of copies/ μ l template;

Fig. 4 is that repeatability detects synoptic diagram;

Fig. 5 is a canonical plotting.

Embodiment

The principle of work of encephalitis b virus fluorescence quantitative PCR detection novel method of the present invention promptly is to utilize the variation qualitative analysis of fluorescent signal, detect the variation of each cyclic amplification product amount in the pcr amplification reaction in real time, starting template is carried out quantitative analysis by the relation of Ct value and typical curve.The invention still further relates to all the elements that above-mentioned detection architecture comprises.

This method may further comprise the steps:

1) design primer probe;

2) select fluorescein according to instrument;

3) synthetic primer and probe;

4) preparation positive plasmid standard substance;

5) operation PCR;

6) data analysis;

7) extract viral RNA and carry out the system checking.

1, the design of primer probe

According to intending research gene title encephalitis B (epidemic encephalitis B, JE), in genebank, find corresponding complete genome sequence (www.ncbi.nlm.nih.gov), utilization DNASTAR software carries out homology analysis and blast sequential analysis, sift out high conservative zone bp5-bp104 as target sequence, adopt primer-design software Primer Premier 5 to carry out the design of primer probe, sequence sees Table 1.

The primer and the probe of table 1 fluorescence quantitative PCR detection encephalitis b virus

Name	Sequence	Strand	Position	Tm℃	Modification
						FP	GTTTATCTGTGTGAACTTCTTGGC	forward	5-28	57.9	?
RP	TTTAGTCATGGTTATCTTCCGTTC	reverse	81-104	57.7	?

2, the selection of fluorescein

Use the SmartCyclerII of instrument as U.S. Cepheid company, the fluorescent emission group adopts CY3, and the fluorescent quenching group adopts BHQ-2.

3, the synthetic of primer and probe gives precious biotechnology (Dalian) company limited to finish.

4, the present invention takes the gene synthesis mode to make positive plasmid as positive.To carry out gene synthetic with prolonging 30～50bp before and after the high conserved region territory bp5-bp104 that filters out in the design of primers process respectively, is cloned into then in the pMD19-T carrier, is our positive plasmid sample, numbering CBG229-1.

5, the preparation of standard substance

Synthetic by authorized company and extract positive plasmid sample stoste, recording concentration by the ultramicron ultraviolet spectrophotometer is 301ng/ μ l, calculates according to the copy number calculation formula " copy number concentration (copies/ μ l)=DNA concentration (ng/ μ l) * 6.02 * 1023 (copies/mol)/324 * 2 * (carrier base number+goal gene base number) " of single stranded DNA and learns that the DNA copy number concentration of plasmid stoste is about 1 * 10 ¹¹Copies/ μ l.Use EASY Dilution (a kind of liquid that is specifically designed to standard substance dilution use, precious biotech firm produces by Dalian) to carry out gradient dilution and finally obtain 1 * 10 ⁰～1 * 10 ¹⁰The plasmid standard of copies/ μ l.

6, primer and probe dissolved dilution are to desired concn and keep in Dark Place.

Primer generally is diluted to 10 μ m/L, and probe dilution is to 5 μ m/L, and-20 ℃ of refrigerators seal and keep in Dark Place.Dilution institute water is sterilization Tris water (Ph7.0～8.0).

7, Real-Time pcr amplification

The amplification kit of selecting for use is Premix Ex Taq, available from precious biotechnology (Dalian) company limited.Reaction system component and volume see Table 2.

Table 2

Amplification condition is as follows

8, data analysis

9, extract viral RNA, carry out reverse transcription, gained cDNA uses the aqua sterilisa gradient dilution, replaces positive and carries out detection validation.

The selection of threshold value

In the process of the various parameter optimizations of quantitative fluorescent PCR, the Ct value is the reference factor of most critical.The method of calculating the Ct value has in conjunction with two kinds of method of intersection and quafric curve Peak Intensity Method.We will react the threshold line that presents in the amplification curve diagram and drag up and down, para-curve in conjunction with the amplification rate velocity of variation is observed, when the pairing Ct value of the intersection point of threshold line and amplification curve is passed through the peak value of quafric curve just, the threshold value of this moment is optimal threshold, and the Ct value also is Ct value the most accurately.With reference to figure 1, determine that the body series optimal threshold is 11.

The optimization of primer concentration and probe concentration

1. it is standby to lower concentration at first to dilute the primer probe, and primer is diluted to 10 μ m/L, and probe is to 5 μ m/L;

Respectively to each system add 0.5 μ L, 1 μ L, 2 μ L have diluted upstream and downstream primer (10 μ m/L), 0.5 μ L, 1 μ L, 2 μ L Taqman probes (5 μ m/L) move PCR simultaneously, other components of system are pressed table 2 preparation; The preferred optimum response concentration combination of relative method, determine that finally the best proportioning of primer concentration and probe concentration in the 25 μ l encephalitis b virus quantitative fluorescent PCR reaction systems is: primer 400nmol/L, probe 200nmol/L promptly adds respectively and has diluted good each 1 μ L of primer probe.

The selection of annealing temperature

Under the perfect condition, annealing temperature is enough low, effectively anneals with aim sequence to guarantee primer, wants enough high simultaneously, to reduce non-specific binding.Following carrying out when annealing temperature is set: be lower than that design estimates during primer Tm5 ℃ as initial annealing temperature, with 2 ℃ be increment, progressively improve annealing temperature.5 groups of temperature of initial setting: 52 ℃, 54 ℃, 56 ℃, 58 ℃, 60 ℃.All the purpose fragment be can detect under five groups of annealing temperatures, this primer and probe better performances proved, adaptable wider range.But the minimum temperature of the strongest while Ct of fluorescent signal value is 54 ℃, determines that finally optimum annealing temperature is 54 ℃.

The mensuration of sensitivity

Detect gradient template, Fig. 2 according to reaction system of having optimized and response procedures. be 1e ³, 1e ², 1e ¹, 1e ⁰The detected result figure of four gradient templates, Fig. 3. be 1e ⁰Copies/ μ l template is made the curve of 6 parallel amplifications, so because the lower quantity that increases parallel detection of template concentrations, five feminine genders of a positive appear in the result, so lowest detectable limit can only reach tens level, 1e ¹The dilution DNA of copies/ μ l.

Repeatability detects

Fig. 4. be 1e ⁶～1e ²The dna profiling quantitative fluorescent PCR of five concentration gradients of copies/ μ l, each gradient have all been done 2 to 3 parallel laboratory tests, and the amplification curve that each gradient template produced among the figure has all produced and has been consistent Ct value, and repeatability is very good.

The specificity check

Detect dengue virus, the yellow fever virus that belongs to yellow hot section with encephalitis b virus with the system of being set up, the result is all negative.Show that this designed primer probe specificity is very high.

The foundation of typical curve

The quality of system can reflect that the e value levels off to 1 more by amplification efficiency e, amplification efficiency is described more near 100%, and reaction system is good more; E＜1 illustrates that the system amplification efficiency is lower, and system needs to optimize; Inhibition is contained in the explanation system in e＞1, needs to reduce even get rid of the interference of inhibition.The amplification efficiency optimum range of generally acknowledging in this field is between 0.8-1.2.Adopt 1e ⁶～1e ²Copies/ μ l template increases, and the gained typical curve is Fig. 5., the amplification function

Y=-0.31X+13.278, amplification efficiency e=10-k-1=1.04=104%.(k＝-0.31)

Purpose of the present invention is exactly a pair of new primer probe of design, sets up a kind of fluorescence quantitative PCR method in conjunction with utilization SmartCyclerII and detects encephalitis b virus.Pick out the conservative sequence of encephalitis b virus genome camber by the mode of sequence alignment, the a pair of primer of design and a Taqman probe on this sequence, set up the real-time fluorescence quantitative PCR reaction system, and be optimized, detect the sensitivity and the specificity of this method.Detection method of the present invention is highly suitable for encephalitis b virus, with dengue fever virus, yellow fever virus no cross reaction.

Claims (9)

1. encephalitis b virus fluorescence quantitative PCR detection novel method is characterized in that, the primer probe that design is adopted in this method is:

Name Sequence Position Tm℃ Modification FP GTTTATCTGTGTGAACTTCTTGGC 5-28 57.9 RP TTTAGTCATGGTTATCTTCCGTTC 81-104 57.7 Rrobe AGTATCGTTGAGAAGAATCGAGAGATTAGTGC 31-62 67.8 CY3/BHQ-2

2. encephalitis b virus fluorescence quantitative PCR detection novel method as claimed in claim 1 is characterized in that this method is specially:

1) design primer probe;

2) select fluorescein according to instrument;

3) synthetic primer and probe;

4) preparation positive plasmid standard substance;

5) operation PCR;

6) data analysis;

7) extract viral RNA and carry out the system checking.

3. encephalitis b virus fluorescence quantitative PCR detection novel method as claimed in claim 2, it is characterized in that, described step 2) the selective fluorescent emission group of fluorescein has 6-FAM, TET, HEX, JOE, CY3, CY5, TAMRA, Texas Red in, and the fluorescent quenching group has BHQ-1, BHQ-2, Lowa Black ^TMRQ, Lowa Black ^TMFQ, Dabcy1.

4. encephalitis b virus fluorescence quantitative PCR detection novel method as claimed in claim 2, it is characterized in that, take the gene synthesis mode to make positive plasmid CBG229-1 as positive in the described step 4): to carry out gene synthetic with prolonging 5～50bp before and after the high conserved region territory bp5-bp104 that filters out in the design of primers process respectively, be cloned into then in the pMD19-T carrier, be described positive plasmid sample, numbering CBG229-1.

5. encephalitis b virus fluorescence quantitative PCR detection novel method as claimed in claim 2 is characterized in that, the quantitative fluorescent PCR reaction is applicable to all quantitative fluorescent PCR reaction instrument in the described step 5).

6. the encephalitis b virus fluorescence quantitative PCR detection novel method described in the claim 5, it is characterized in that described quantitative fluorescent PCR reaction instrument comprises SmartCyclerII, ABI real-time PCR system, BioRad PCR in real time detection system, Stratagene quantitative polumerase chain reaction instrument.

7. encephalitis b virus fluorescence quantitative PCR detection novel method as claimed in claim 2 is characterized in that best amplification condition is in the described step 5):

8. an encephalitis b virus detects the PCR system, it is characterized in that, this system comprises that primer or other can combine the primer that is equal to of also amplification with encephalitis B full length sequence specificity, and its similar homology can not surpass 90%, and primer sequence is as follows:

9. an encephalitis b virus detects the PCR system, it is characterized in that, this system comprise primer and can with encephalitis B full length sequence specific probe, probe sequence is as follows:

Can combine the probe that is equal to of also amplification with encephalitis B full length sequence specificity, the fraction of coverage of its site areas can not surpass 50%, and its homology can not surpass 70%.

Images