CN102140529A - New dengue virus fluorescence quantitative polymerase chain reaction detection method and dengue virus polymerase chain reaction detection system - Google Patents

Abstract

The invention discloses a new dengue virus fluorescence quantitative polymerase chain reaction (PCR) detection method and a dengue virus PCR detection system. The detection system consists of a primer and a probe, Premix Ex Taq reaction solution and sterilized Tris solution, wherein the primer and probe have good detection specificity. The system has high sensitivity, is very suitable for dengue virus and does not have cross reactions with the yellow fever virus and the Japanese encephalitis virus.

Description

Dengue fever virus fluorescence quantitative PCR detection novel method and dengue fever virus detect the PCR system

Technical field

The invention belongs to field of biological detection, be specifically related to the fast qualitative and the quantitative detecting method of dengue fever virus, a pair of Auele Specific Primer and probe are provided.

Background technology

(Dengue fever is the acute infectious disease that is caused, propagated through yellow-fever mosquito by 1～4 type dengue virus DF), according to the Category B notifiable disease that is defined as of " People's Republic of China's law on the prevention and control of infectious diseases " to singapore hemorrhagic fever.Asia, Oceania, America and Africa all have this disease to take place, and are very serious public health problems of the torrid zone, subtropical zone.The case fatality rate of dengue hemorrhagic fever and dengue shock syndrome is higher, not only has a strong impact on people health, and has a strong impact on the development of local economy, trade and tourist industry.The monitoring method of singapore hemorrhagic fever has the detection of ELISA serology, RT-PCR detection of nucleic acids, viral separation sequence mensuration, immunofluorescence Detection of antigen method etc. at present.But the method for quantitative fluorescent PCR detection of nucleic acids can yet be regarded as a kind of more directly perceived, be fit to the examination criteria of early diagnosis accurately and rapidly.

Summary of the invention

The object of the present invention is to provide a kind of dengue fever virus fluorescence quantitative PCR detection novel method and dengue virus to detect the PCR system, it can fast qualitative and detection by quantitative dengue fever virus, comprises that a pair of specificity is higher, highly sensitive, the primer of good reproducibility and probe.

For achieving the above object, the primer probe that design is adopted in the dengue fever virus fluorescence quantitative PCR detection novel method of the present invention is:

Name	Sequence	Position	Tm℃	Modification
					FP	GCTGGAAGGACTAGAGGTTAGAG	10627-10649	56.6	?
RP	GATTCAACAGCACCATTCCAT	10748-10768	57.2	?
					Probe	AAACAGCATATTGACGCTGGGAAAGA	10670-10695	67.4	Texas?Red/BHQ-2

Further, dengue fever virus fluorescence quantitative PCR detection novel method is specially:

1) design primer probe;

2) select fluorescein according to instrument;

3) synthetic primer and probe;

4) preparation positive plasmid standard substance;

5) operation PCR;

6) data analysis;

7) extract viral RNA and carry out the system checking.

Further, described step 2) the selective fluorescent emission group of fluorescein has 6-FAM, TET, HEX, JOE, CY3, CY5, TAMRA, Texas Red in, and the fluorescent quenching group has BHQ-1, BHQ-2, Lowa Black ^TMRQ, Lowa Black ^TMFQ, Dabcyl.

Further, take the gene synthesis mode to make positive plasmid CBG231-3 as positive in the described step 4): to carry out gene synthetic with prolonging 30～50bp before and after the high conserved region territory bp10627-bp10768 that filters out in the design of primers process respectively, be cloned into then in the pMD19-T carrier, be described positive plasmid sample, numbering CBG231-3.

Further, Real-Time PCR reaction is applicable to all quantitative fluorescent PCR reaction instrument in the described step 5).

Further, described quantitative fluorescent PCR reaction instrument comprises SmartCyclerII, ABI real-time PCR system, BioRad PCR in real time detection system, Stratagene quantitative polumerase chain reaction instrument.

Further, best amplification condition is in the described step 5):

A kind of dengue fever virus detects the PCR system, it is characterized in that, this system comprises that primer or other can combine the primer that is equal to that also increases with stepping on leather full length sequence specificity, and its similar homology can not surpass 90%, and primer sequence is as follows:

A kind of dengue fever virus detects the PCR system, it is characterized in that, this system comprise primer and can with step on leather full length sequence specific probe, probe sequence is as follows:

Can combine the probe that is equal to that also increases with stepping on leather full length sequence specificity, the fraction of coverage of its site areas can not surpass 50%, and its homology can not surpass 70%.

The present invention designs a pair of new primer probe, sets up a kind of fluorescence quantitative PCR method in conjunction with SmartCyclerII and detects dengue fever virus.Pick out the conservative sequence of dengue fever virus genome camber by the mode of sequence alignment, the a pair of primer of design and a Taqman probe on this sequence, set up the real-time fluorescence quantitative PCR reaction system, and be optimized, detect the sensitivity and the specificity of this method.

Description of drawings

Fig. 1 is that the two dimension of amplification curve shows figure;

Fig. 2 is 1e ³, 1e ², 1e ¹, 1e ⁰The amplification curve diagram of four gradient templates of copies/ μ l, X-axis is represented the amplification cycles number, Y-axis is represented fluorescence signal intensity;

Fig. 3 is 1e ¹The graphic representation of 3 parallel amplifications of copies/ μ l template;

Fig. 4 is 1e ⁰The graphic representation of 6 parallel amplifications of copies/ μ l template;

Fig. 5 is that repeatability detects synoptic diagram;

Fig. 6 is a canonical plotting.

Embodiment

The principle of work of dengue fever virus fluorescence quantitative PCR detection novel method of the present invention promptly is to utilize the variation qualitative analysis of fluorescent signal, detect the variation of each cyclic amplification product amount in the pcr amplification reaction in real time, starting template is carried out quantitative analysis by the relation of Ct value and typical curve.The invention still further relates to all the elements that above-mentioned detection architecture comprises.

This method may further comprise the steps:

1. design the primer probe;

2. select fluorescein according to instrument;

3. synthetic primer and probe;

4. prepare the positive plasmid standard substance;

5. move PCR;

6. data analysis;

7. extract viral RNA and carry out the system checking.

1, the design of primer probe

According to intending research gene title dengue virus (Dengue fever, DF), in genebank, find corresponding complete genome sequence (www.ncbi.nlm.nih.gov), utilization DNASTAR software carries out homology analysis and blast sequential analysis, sift out high conservative zone bp10627-bp10768 as target sequence, adopt primer-design software Primer Premier 5 to carry out the design of primer probe, sequence sees Table 1.

The primer of table 1. dengue virus and probe

Name	Sequence	Position	Tm℃	Modification
					FP	GCTGGAAGGACTAGAGGTTAGAG	10627-10649	56.6	?

2, the selection of fluorescein

Use the SmartCyclerII of instrument as U.S. Cepheid company, the fluorescent emission group adopts Texas Red, and the fluorescent quenching group adopts BHQ-2.

3, the synthetic of primer and probe gives precious biotechnology (Dalian) company limited to finish.

4, the present invention takes the gene synthesis mode to make positive plasmid as positive.To carry out gene synthetic with prolonging 30～50bp before and after the high conserved region territory bp10627-bp10768 that filters out in the design of primers process respectively, is cloned into then in the pMD19-T carrier, is our positive plasmid sample, numbering CBG228-3.

5, the preparation of standard substance

Synthetic by authorized company and extract positive plasmid sample stoste, recording concentration by the ultramicron ultraviolet spectrophotometer is 299ng/ μ l, calculates according to the copy number calculation formula " copy number concentration (copies/ μ l)=DNA concentration (ng/ μ l) * 6.02 * 1023 (copies/mol)/324 * 2 * (carrier base number+goal gene base number) " of single stranded DNA and learns that the DNA copy number concentration of plasmid stoste is about 9.6 * 10 ¹⁰Copies/ μ l.Use EASY Dilution (a kind of liquid that is specifically designed to standard substance dilution use, precious biotech firm produces by Dalian) to carry out gradient dilution and finally obtain 1 * 10 ⁰～1 * 10 ¹⁰The plasmid standard of copies/ μ l.

6, primer and probe dissolved dilution are to desired concn and keep in Dark Place.

Primer generally is diluted to 10 μ m/L, and probe dilution is to 5 μ m/L, and-20 ℃ of refrigerators seal and keep in Dark Place.Dilution institute water is sterilization Tris water (Ph7.0～8.0).

7, Real-Time pcr amplification

The amplification kit of selecting for use is Premix Ex Taq, available from precious biotechnology (Dalian) company limited.Reaction system component and volume see Table 2.

Table 2

Amplification condition is as follows

8, data analysis

9, extract viral RNA, carry out reverse transcription, gained cDNA uses the aqua sterilisa gradient dilution, replaces positive and carries out detection validation.

The selection of threshold value

In the process of the various parameter optimizations of quantitative fluorescent PCR, the Ct value is the reference factor of most critical.The method of calculating the Ct value has in conjunction with two kinds of method of intersection and quafric curve Peak Intensity Method.We will react the threshold line that presents in the amplification curve diagram and drag up and down, para-curve in conjunction with the amplification rate velocity of variation is observed, when the pairing Ct value of the intersection point of threshold line and amplification curve is passed through the peak value of quafric curve just, the threshold value of this moment is optimal threshold, and the Ct value also is Ct value the most accurately.With reference to figure 1, determine that the body series optimal threshold is 30.

The optimization of primer concentration and probe concentration

1. it is standby to lower concentration at first to dilute the primer probe, and primer is diluted to 10 μ m/L, and probe is to 5 μ m/L;

Respectively to each system add 0.5 μ L, 1 μ L, 2 μ L have diluted upstream and downstream primer (10 μ m/L), 0.5 μ L, 1 μ L, 2 μ L Taqman probes (5 μ m/L) move PCR simultaneously, other components of system are pressed table 2 preparation; The preferred optimum response concentration combination of relative method, determine that finally the best proportioning of primer concentration and probe concentration in the 25 μ l dengue virus quantitative fluorescent PCR reaction systems is: primer 400nmol/L, probe 200nmol/L promptly adds respectively and has diluted good each 1 μ L of primer probe.

The selection of annealing temperature

Under the perfect condition, annealing temperature is enough low, effectively anneals with aim sequence to guarantee primer, wants enough high simultaneously, to reduce non-specific binding.Following carrying out when annealing temperature is set: be lower than that design estimates during primer Tm5 ℃ as initial annealing temperature, with 2 ℃ be increment, progressively improve annealing temperature.5 groups of temperature of initial setting: 52 ℃, 54 ℃, 56 ℃, 58 ℃, 60 ℃.All the purpose fragment be can detect under five groups of annealing temperatures, this primer and probe better performances proved, adaptable wider range.But the minimum temperature of the strongest while Ct of fluorescent signal value is 56 ℃, determines that finally optimum annealing temperature is 56 ℃.

The mensuration of sensitivity

Detect gradient template according to reaction system of having optimized and response procedures, Fig. 2 is 1e ³, 1e ², 1e ¹, 1e ⁰The detected result figure of four gradient templates, Fig. 3 are 1e ¹Copies/ μ l template is made the curve of 3 parallel amplifications, feminine gender of two positives, and Fig. 4 is 1e ⁰Copies/ μ l template is made the curve of 6 parallel amplifications, so because the lower quantity that increases parallel detection of template concentrations, total negative as a result is so lowest detectable limit can only reach tens level, 1e ¹The dilution DNA of copies/ μ l.

Repeatability detects

Fig. 5 is 1e ⁸～1e ⁴The dna profiling quantitative fluorescent PCR of five concentration gradients of copies/ μ l, each gradient have all been done 2 to 3 parallel laboratory tests, and the amplification curve that each gradient template produced among the figure has all produced and has been consistent Ct value, and repeatability is very good.

The specificity check

Detect encephalitis b virus, the yellow fever virus that belongs to yellow hot section with dengue virus with the system of being set up, the result is all negative.Show that this designed primer probe specificity is very high.The foundation of typical curve

The quality of system can reflect that the e value levels off to 1 more by amplification efficiency e, amplification efficiency is described more near 100%, and reaction system is good more; E＜1 illustrates that the system amplification efficiency is lower, and system needs to optimize; Inhibition is contained in the explanation system in e＞1, needs to reduce even get rid of the interference of inhibition.The amplification efficiency optimum range of generally acknowledging in this field is between 0.8-1.2.Adopt 1e ⁸～1e ⁴Copies/ μ l template increases, and the gained typical curve is Fig. 6, the amplification Function Y=-0.299X+12.859, amplification efficiency e=10-k-1=0.991=99.1%.(k＝-0.299)

Purpose of the present invention is exactly a pair of new primer probe of design, sets up a kind of fluorescence quantitative PCR method in conjunction with utilization SmartCyclerII and detects dengue fever virus.Pick out the conservative sequence of dengue fever virus genome camber by the mode of sequence alignment, the a pair of primer of design and a Taqman probe on this sequence, set up the real-time fluorescence quantitative PCR reaction system, and be optimized, detect the sensitivity and the specificity of this method.Detection method of the present invention is highly suitable for dengue fever virus, with yellow fever virus, encephalitis b virus no cross reaction.

Claims (9)

1. dengue fever virus fluorescence quantitative PCR detection novel method is characterized in that, the primer probe that design is adopted in this method is:

Name Sequence Position Tm℃ Modification FP GCTGGAAGGACTAGAGGTTAGAG 10627-10649 56.6 RP GATTCAACAGCACCATTCCAT 10748-10768 57.2 Probe AAACAGCATATTGACGCTGGGAAAGA 10670-10695 67.4 Texas?Red/BHQ-2

2. dengue fever virus fluorescence quantitative PCR detection novel method as claimed in claim 1 is characterized in that this method is specially:

1) design primer probe;

2) select fluorescein according to instrument;

3) synthetic primer and probe;

4) preparation positive plasmid standard substance;

5) operation PCR;

6) data analysis;

7) extract viral RNA and carry out the system checking.

3. dengue fever virus fluorescence quantitative PCR detection novel method as claimed in claim 2, it is characterized in that, described step 2) the selective fluorescent emission group of fluorescein has 6-FAM, TET, HEX, JOE, CY3, CY5, TAMRA, Texas Red in, and the fluorescent quenching group has BHQ-1, BHQ-2, Lowa Black ^TMRQ, Lowa Black ^TMFQ, Dabcyl.

4. dengue fever virus fluorescence quantitative PCR detection novel method as claimed in claim 2, it is characterized in that, take the gene synthesis mode to make positive plasmid CBG231-3 as positive in the described step 4): to carry out gene synthetic with prolonging 30～50bp before and after the high conserved region territory bp10627-bp10768 that filters out in the design of primers process respectively, be cloned into then in the pMD19-T carrier, be described positive plasmid sample, numbering CBG231-3.

5. dengue fever virus fluorescence quantitative PCR detection novel method as claimed in claim 2 is characterized in that, Real-Time PCR reaction is applicable to all quantitative fluorescent PCR reaction instrument in the described step 5).

6. dengue fever virus fluorescence quantitative PCR detection novel method as claimed in claim 5, it is characterized in that described quantitative fluorescent PCR reaction instrument comprises SmartCyclerII, ABI real-time PCR system, BioRad PCR in real time detection system, Stratagene quantitative polumerase chain reaction instrument.

7. dengue fever virus fluorescence quantitative PCR detection novel method as claimed in claim 2 is characterized in that best amplification condition is in the described step 5):

8. a dengue fever virus detects the PCR system, it is characterized in that, this system comprises that primer or other can combine the primer that is equal to that also increases with stepping on leather full length sequence specificity, and its similar homology can not surpass 90%, and primer sequence is as follows:

9. a dengue fever virus detects the PCR system, it is characterized in that, this system comprise primer and can with step on leather full length sequence specific probe, probe sequence is as follows:

Can combine the probe that is equal to that also increases with stepping on leather full length sequence specificity, the fraction of coverage of its site areas can not surpass 50%, and its homology can not surpass 70%.

Images