CN102140533B - Marburg and Ebola dual-virus fluorescent quantitative PCR (Polymerase Chain Reaction) detection method and dual-virus detection PCR system - Google Patents
Marburg and Ebola dual-virus fluorescent quantitative PCR (Polymerase Chain Reaction) detection method and dual-virus detection PCR system Download PDFInfo
- Publication number
- CN102140533B CN102140533B CN2010106055391A CN201010605539A CN102140533B CN 102140533 B CN102140533 B CN 102140533B CN 2010106055391 A CN2010106055391 A CN 2010106055391A CN 201010605539 A CN201010605539 A CN 201010605539A CN 102140533 B CN102140533 B CN 102140533B
- Authority
- CN
- China
- Prior art keywords
- marburg
- ebola
- pcr
- virus
- dual
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses Marburg and Ebola dual-virus fluorescent quantitative PCR (Polymerase Chain Reaction) detection method and system, wherein the detection system comprises primers, probes, a Premix EX Taq reaction solution and sterilizing Tris water. As two pairs of primers and probes have very good specificity, the detection system has high sensitivity and is suitable for simultaneously detecting Marburg and Ebola viruses without having cross reaction with other kinds of hemorrhagic fever arbovirus, such as yellow fever, dengue and rift valley fever.
Description
Technical field
The invention belongs to field of biological detection, be specifically related to fast qualitative and the quantitative detecting method of Marburg, the dual virus of Ebola, a pair of Auele Specific Primer and probe respectively are provided.
Background technology
Marburg virus (Marburg virus, MbV), be also referred to as grivet virus, the grivet factor, that human the 1st kind of inovirus of finding belongs to virus, can in people and other primates, cause the hemorrhagic fever of high mortality, the marburg hemorrhagic fever onset is unexpected, often with severe headache and uncomfortable, sore muscle is a common feature, be generally 3～9 latent period, can surpass for 2 weeks than the elder, can be used as potential bio-terrorism weapon or biological warfare agent and use, carry out the potent virus of highest biological safety protection (P4 level) for needs.The WTO title that gives the alarm, " Marburg virus is to have up to now one of fatefulue virus most.”
Ebola virus (Ebola virus, EBOV) can cause a kind of infectious diseases common to human beings and animals, be ebola hemorrhagic fever (Ebola hemorrhagil fever, EBHF), 1976 is the regional the first explosion in Ebola river of present Congo (Congo-Kinshasa) in the Sudan south and Zaire, mortality causes the extensive concern of medical circle up to 90%, and Ebola virus is gained the name thus.The Ebola virus infectivity is extremely strong, can propagate by direct contact infection person's body fluid or the number of ways such as other infected tissues, skin diabrosis wound and the spittle.The infected serious bleeding can occur and cause shock syndrome.The World Health Organization has classified EBOV as one of the most serious virus of mankind harm, i.e. the 4th grade of virus, and relative test operation must carry out in P4 level laboratory.
Ebola virus and Marburg virus have formed the inovirus genus jointly.Two-strain is at gene order and copy and widely homology is arranged aspect the mechanism, but represents two kinds of distinct viruses from gene level, and there is not serological cross reaction in the two, has obvious different at the structural protein collection of illustrative plates with viral virion form.Detect simultaneously Marburg, two kinds of inovirus of Ebola will be saved the more time for epidemic monitoring, save more costs.The detection method that is used at present Marburg and Ebola virus has had ELISA Detection of antigen, indirect immunofluorescence serology to detect, virus is separated, the RT-PCR detection of nucleic acids, the detection method of generally acknowledged a kind of more directly perceived, faster a kind of suitable early diagnosis but the method for quantitative fluorescent PCR detection of nucleic acids be can yet be regarded as.
Summary of the invention
The object of the present invention is to provide a kind of Marburg, the dual FLuorescent quantitative PCR new detecting method of Ebola and this dual virus detect the PCR system, the method can fast qualitative and detection by quantitative Marburg virus, Ebola virus comprises that the 2 pairs of specificitys are higher, highly sensitive, primer and the probe of good reproducibility.
For achieving the above object, Marburg of the present invention, the dual FLuorescent quantitative PCR new detecting method of Ebola, in the method:
1) first pair of primer probe of design detection Marburg virus is:
| Name | Sequence | Position | Tm℃ | Modification |
| FP | AAATCATCAGGTTAGTATCTGTAATCAG | 187-214 | 57.7 | |
| RP | TTATAGTAATGCTCAACACACAACG | 276-300 | 57.5 | |
| Probe | TGCAATAAACTCAGGGATTGATCTTGGA | 223-250 | 68.4 | FAM/BHQ-1 |
2) second pair of primer probe of design detection Ebola virus is:
| Name | Sequence | Position | Tm℃ | Modification |
| query_L1 | CAAGGACTGATACAATATCCAACAG | 1025-1049 | 58 | |
| query_R1 | GAATTTGAAATCACAGCATCGT | 1164-1185 | 57.1 | |
| query_P1 | TGGCAATCAGTAGGACACATGATGGTG | 1052-1078 | 69 | Texas Red/BHQ-2 |
Further, described Marburg, the dual FLuorescent quantitative PCR new detecting method of Ebola is specially:
1) design primer probe;
2) select fluorescein according to instrument;
3) synthetic primer and probe;
4) preparation positive plasmid standard substance;
5) operation PCR;
6) data analysis;
7) extract viral RNA and carry out the system checking.
Further, described step 2) the selective fluorescent emission group of fluorescein has 6-FAM, TET, HEX, JOE, CY3, CY5, TAMRA, Texas Red in, and the fluorescent quenching group has BHQ-1, BHQ-2, Lowa Black
TMRQ, Lowa Black
TMFQ, Dabcyl.
Further, described step 4) take the gene synthesis mode to make positive plasmid CBG232-3, CBG233-4 as positive in: with the high conserved region territory bp187-bp300 that filters out in the design of primers process, prolonging respectively 5～50bp before and after the bp1025-bp1185, to carry out gene synthetic, then be cloned in the pMD19-T carrier, be described positive plasmid sample, numbering CBG232-3, CBG233-4.
Further, the quantitative fluorescent PCR reaction is applicable to all quantitative fluorescent PCR reaction instrument described step 5);
Further, described quantitative fluorescent PCR reaction instrument comprises SmartCyclerII, ABI real-time PCR system, BioRad PCR in real time detection system, Stratagene quantitative polumerase chain reaction instrument.
Further, best amplification condition is described step 5):
A kind of Marburg, the dual virus of Ebola detects the PCR system, this system comprise primer or other can with the primer that is equal to of Marburg full length sequence specific binding and amplification, its similar homology can not surpass 90%, primer sequence is as follows:
A kind of Marburg, the dual virus of Ebola detects the PCR system, this system comprise primer and can with Marburg full length sequence specific probe, probe sequence is as follows:
Can with Marburg full length sequence specific binding and amplification be equal to probe, the fraction of coverage of its site areas can not surpass 50%, its homology can not surpass 70%.
A kind of Marburg, the dual virus of Ebola detects the PCR system, this system comprise primer or other can with the primer that is equal to of Ebola's full length sequence specific binding and amplification, its similar homology can not surpass 90%, primer sequence is as follows:
A kind of Marburg, the dual virus of Ebola detects the PCR system, this system comprise primer and can with Ebola's full length sequence specific probe, probe sequence is as follows:
Can with Ebola's full length sequence specific binding and amplification be equal to probe, the fraction of coverage of its site areas can not surpass 50%, its homology can not surpass 70%.
The present invention designs 2 pairs of new primer probes, in conjunction with use SmartCyclerII set up a kind of fast, responsive, special fluorescence quantifying PCR method detects Marburg and two kinds of inovirus of Ebola simultaneously.Pick out the conservative sequence of two-strain genome camber by the mode of sequence alignment, on this sequence, design respectively pair of primers and a Taqman probe, set up the real-time fluorescence quantitative PCR reaction system, and be optimized, detect sensitivity and the specificity of the method.
Description of drawings
Fig. 1 is the amplification curve diagram of Marburg virus in the double check;
Fig. 2 is the amplification curve diagram of Ebola virus in the double check;
Fig. 3 is two-strain amplification curve overview diagrams in the double check;
Fig. 4 is the canonical plotting of Marburg in the double check;
Fig. 5 is the canonical plotting of Ebola in the double check.
Embodiment
Marburg of the present invention, the principle of work of the dual FLuorescent quantitative PCR new detecting method of Ebola namely is to utilize the variation qualitative analysis of fluorescent signal, detect in real time the variation of each cyclic amplification product amount in the pcr amplification reaction, by the relation of Ct value and typical curve starting template is carried out quantitative analysis.The invention still further relates to all the elements that above-mentioned detection system comprises.
The method may further comprise the steps:
1) design primer probe;
2) select fluorescein according to instrument;
3) synthetic primer and probe;
4) preparation positive plasmid standard substance;
5) operation PCR;
6) data analysis;
7) extract viral RNA and carry out the system checking.
1, the design of primer probe
According to intending research gene title Marburg virus (Marburg virus, MbV), Ebola virus (Ebola virus, EBOV), in genebank, find corresponding complete genome sequence (www.ncbi.nlm.nih.gov), use DNASTAR software to carry out homology analysis and blast sequential analysis, sift out high conservative zone 5 ' end 187-300 (MbV); Bp1025-bp1185 (EBOV) adopts primer-design software Primer Premier 5 to carry out the design of primer probe as target sequence, and sequence sees Table 1. tables 2.
Primer and the probe of table 1 fluorescence quantitative PCR detection Marburg virus
Primer and the probe of table 2 fluorescence quantitative PCR detection Ebola virus
2, the selection of fluorescein
Use instrument to be the SmartCyclerII of U.S. Cepheid company, MbV fluorescent emission group adopts the most stable FAM group of characteristic, and the fluorescent quenching group adopts BHQ-1; EBOV fluorescent emission group adopts Texas Red, and the fluorescent quenching group adopts BHQ-2.The two uses different fluorescent signals to show difference.
3, the synthetic of primer and probe gives precious biotechnology (Dalian) company limited to finish.
4, the present invention takes the gene synthesis mode to make positive plasmid as positive.To carry out gene synthetic with prolonging respectively 30～50bp before and after high conserved region territory 5 ' the end 187-300/bp1025-bp1185 that filters out in the design of primers process, then be cloned in the pMD19-T carrier, be our positive plasmid sample, numbering CBG232-3, CBG233-4.
5, the preparation of plasmid standard
Synthetic by authorized company and extract positive plasmid sample stoste, record concentration by the ultramicron ultraviolet spectrophotometer and be respectively 300ng/ μ l (MbV), 360ng/ μ l (EBOV), calculate according to the copy number calculation formula " copy number concentration (copies/ μ l)=DNA concentration (ng/ μ l) * 6.02 * 1023 (copies/mol)/324 * 2 * (carrier base number+goal gene base number) " of single stranded DNA and learn that the DNA copy number concentration of Marburg virus plasmid stoste is about 1 * 10
11Copies/ μ l; The DNA copy number concentration of Ebola's plasmid stoste is about 1.13 * 10
11Copies/ μ l.Use EASYDilution (a kind of liquid that is specifically designed to standard substance dilution use, precious biotech firm produces by Dalian) to carry out respectively gradient dilution and finally obtain 1 * 10
0～1 * 10
10The plasmid standard of copies/ μ l.
6, primer and probe dissolved dilution are to desired concn and keep in Dark Place.
Primer generally is diluted to 10 μ m/L, and probe dilution is to 5 μ m/L, and-20 ℃ of refrigerators seal and keep in Dark Place.Dilution institute water is sterilization Tris water (Ph7.0～8.0).
7, Real-Time pcr amplification
The amplification kit of selecting is Premix Ex Taq test kit, available from precious biotechnology (Dalian) company limited.Reaction system component and volume thereof see Table 3.
(M represents Marburg to table 3.; E represents the Ebola)
Amplification condition is as follows
8, data analysis
9, extract viral RNA, carry out reverse transcription, gained cDNA uses the aqua sterilisa gradient dilution, replaces positive and carries out detection validation.
The optimization of primer concentration and probe concentration
1. it is for subsequent use to lower concentration at first to dilute each primer probe, and primer is diluted to 10 μ m/L, and probe is to 5 μ m/L;
2. the upstream and downstream primer (10 μ m/L) and the 0.5 μ L Taqman probe (5 μ m/L) that at first add respectively 0.5 μ L two-strain in the 25 μ L systems, template respectively adds 1 μ L, Premix Ex Taq reaction solution still adds 12.5 μ L, and residual volume is supplied with aqua sterilisa.Operation PCR.The result shows that Texas Red fluorescent value is very little, be starkly lower than FAM fluorescence, show in two kinds of simultaneous situations of fluorophor, Texas Red luminous efficiency is quite low, for not affecting positive judgement, the pre-add-on that improves Texas Red probe primer is convenient to data and is read to improve its luminous efficiency.
3. the primer probe add-on with the Ebola doubles, i.e. 1 μ L, the primer probe amount of Marburg is constant simultaneously, other as above, operation PCR.Effect increases, but still has 0.5 times fluorescent value difference.
4. continue to improve the add-on of Ebola's primer probe, increase to 1.5 μ L, namely 3 of the Marburg add-on times, again move PCR.The luminous value convergence of two kinds of fluorescence of result 1: 1.Therefore, determine that Marburg primer concentration and probe concentration is 200 * 100nm/L in the 25 μ L double fluorescent quantitative PCR reaction systems, Ebola's primer concentration and probe concentration then is 600 * 300nm/L.
The selection of annealing temperature
Under the perfect condition, annealing temperature is enough low, effectively anneals with aim sequence to guarantee primer, wants simultaneously enough high, to reduce non-specific binding.Following carrying out when annealing temperature is set: be lower than that design estimates during primer Tm5 ℃ as initial annealing temperature, take 2 ℃ as increment, progressively improve annealing temperature.5 groups of temperature of initial setting: 52 ℃, 54 ℃, 56 ℃, 58 ℃, 60 ℃.All the purpose fragment be can detect under five groups of annealing temperatures, this primer and probe better performances proved, adaptable wider range.But the minimum temperature of the strongest while Ct of fluorescent signal value is 58 ℃, determines that finally optimum annealing temperature is 58 ℃.
The mensuration of sensitivity
Detect gradient template, Fig. 1 according to the reaction system of having optimized and response procedures. be Marburg virus 1e
4～1e
0Copies/ μ l template detection is figure as a result, and amplification curve all appears in first three gradient template, and two gradients in back do not have obvious curve; Fig. 2. be Ebola virus 1e
4～1e
0Copies/ μ 1 template detection is figure as a result, the same Marburg of result.Think that so the two lowest detectable limit all is hundred figure place level, i.e. 1e
2The dilution DNA of copies/ μ l.
Repeatability detects
By the dna profiling quantitative fluorescent PCR of five concentration gradients of Fig. 1 .2., the amplification curve that each template produces in 2 to 3 parallel laboratory tests of each gradient has produced more consistent Ct value, and repeatability better.
The specificity check
With the method detection of setting up and Marburg, Ebola virus be all entomophila hemorrhagic fever cause of disease yellow heat, step on leather, Rift Valley fever virus, the result is all negative.Show that this designed primer probe specificity is very high.
The foundation of typical curve
The quality of system can reflect that by amplification efficiency e the e value more levels off to 1, amplification efficiency is described more near 100%, and reaction system is better; E＜1 illustrates that the system amplification efficiency is lower, and system needs to optimize; Inhibition is contained in the explanation system in e＞1, needs to reduce even get rid of the interference of inhibition.The amplification efficiency optimum range of generally acknowledging in this field is between 0.8-1.2.Adopt respectively 1e
4～1e
2Copies/ μ l template increases, and the gained typical curve is Fig. 4. Fig. 5. and, the amplification function
MbV：Y＝-0.325X+13.467，e＝10
-k-1＝1.11＝111％。(k＝-0.325)
EBOV：Y＝-0.296X+12.144，e＝10
-k-1＝0.977＝97.7％。(k＝-0.296)
Purpose of the present invention is exactly 2 pairs of new primer probes of design, in conjunction with use SmartCyclerII set up a kind of fast, sensitivity, special fluorescence quantifying PCR method detect Marburg and two kinds of inovirus of Ebola simultaneously.Pick out the conservative sequence of two-strain genome camber by the mode of sequence alignment, on this sequence, design respectively pair of primers and a Taqman probe, set up the real-time fluorescence quantitative PCR reaction system, and be optimized, detect sensitivity and the specificity of the method.Detection method of the present invention is highly suitable for Marburg, Ebola virus detects simultaneously, and is hot such as Huang with other several entomophila hemorrhagic fever viruss, steps on leather, the Rift Valley fever no cross reaction.
Claims (6)
1. Marburg, the non-diagnostic assays method of the dual FLuorescent quantitative PCR of Ebola is characterized in that, in the method:
1) first pair of primer probe of design detection Marburg virus is:
2) second pair of primer probe of design detection Ebola virus is:
。
2. Marburg as claimed in claim 1, the non-diagnostic assays method of the dual FLuorescent quantitative PCR of Ebola is characterized in that the method is specially:
1) design primer probe;
2) select fluorescein according to instrument;
3) synthetic primer and probe;
4) preparation positive plasmid standard substance;
5) operation PCR;
6) data analysis;
7) extract viral RNA and carry out the system checking.
3. Marburg as claimed in claim 2, the non-diagnostic assays method of the dual FLuorescent quantitative PCR of Ebola, it is characterized in that, described step 4) take the gene synthesis mode to make positive plasmid CBG232-3, CBG233-4 as positive in: with the high conserved region territory bp187-bp300 that filters out in the design of primers process, prolonging respectively 5～50bp before and after the bp1025-bp1185, to carry out gene synthetic, then be cloned in the pMD19-T carrier, be described positive plasmid sample, numbering CBG232-3, CBG233-4.
4. Marburg as claimed in claim 2, the non-diagnostic assays method of the dual FLuorescent quantitative PCR of Ebola is characterized in that described step 5) in the quantitative fluorescent PCR reaction be applicable to all quantitative fluorescent PCRs reaction instrument.
5. the Marburg described in the claim 4, the non-diagnostic assays method of the dual FLuorescent quantitative PCR of Ebola, it is characterized in that described quantitative fluorescent PCR reaction instrument comprises SmartCyclerII, ABI real-time PCR system, BioRad PCR in real time detection system, Stratagene quantitative polumerase chain reaction instrument.
6. Marburg as claimed in claim 2, the non-diagnostic assays method of the dual FLuorescent quantitative PCR of Ebola is characterized in that described step 5) in best amplification condition be:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010106055391A CN102140533B (en) | 2010-12-24 | 2010-12-24 | Marburg and Ebola dual-virus fluorescent quantitative PCR (Polymerase Chain Reaction) detection method and dual-virus detection PCR system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010106055391A CN102140533B (en) | 2010-12-24 | 2010-12-24 | Marburg and Ebola dual-virus fluorescent quantitative PCR (Polymerase Chain Reaction) detection method and dual-virus detection PCR system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102140533A CN102140533A (en) | 2011-08-03 |
| CN102140533B true CN102140533B (en) | 2013-10-30 |
Family
ID=44408327
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010106055391A Active CN102140533B (en) | 2010-12-24 | 2010-12-24 | Marburg and Ebola dual-virus fluorescent quantitative PCR (Polymerase Chain Reaction) detection method and dual-virus detection PCR system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102140533B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102277452A (en) * | 2011-08-18 | 2011-12-14 | 深圳国际旅行卫生保健中心 | Kit used for detecting highly infectious disease and detection method |
| CN103045755B (en) * | 2011-10-14 | 2016-06-08 | 中国农业科学院上海兽医研究所 | A kind of fluorescent quantitative PCR detection method detecting Ebola virus and primer thereof and test kit |
| CN102719557B (en) * | 2011-12-13 | 2014-04-02 | 广东出入境检验检疫局检验检疫技术中心 | Multiplex fluorescent polymerase chain reaction (PCR) kit and primers for detecting Ebola viruses, Marburg viruses, Lassa viruses and Rift Valley fever viruses |
| CN104557412A (en) * | 2013-10-11 | 2015-04-29 | 中国石油化工股份有限公司 | Technology for recovering raw materials from limonene synthesis by-product |
| CN104357581B (en) * | 2014-10-30 | 2016-08-24 | 薛芳 | Ebola virus nucleic acid molecules characteristic standard sample and preparation method thereof |
| CN107937612A (en) * | 2017-12-21 | 2018-04-20 | 北京卓诚惠生生物科技股份有限公司 | A kind of primer, probe and kit for detecting Marburg virus |
| CN110628955B (en) * | 2019-11-04 | 2023-04-07 | 中国人民解放军军事科学院军事医学研究院 | CrRNA target and CRISPR-Cas13a system for detecting Ebola virus |
-
2010
- 2010-12-24 CN CN2010106055391A patent/CN102140533B/en active Active
Non-Patent Citations (6)
| Title |
|---|
| Christian Drosten等.Rapid Detection and Quantification of RNA of Ebola and Marburg Viruses, Lassa Virus, Crimean-Congo Hemorrhagic Fever Virus,Rift Valley Fever Virus, Dengue Virus, and Yellow Fever Virus by Real-Time Reverse Transcription-PCR.《Journal of Clinical Microbiology》.2002,第40卷(第7期), |
| Grolla A等.Laboratory diagnosis of Ebola and Marburg hemorrhagic fever.《Virologie》.2005,第98卷(第3期), |
| Laboratory diagnosis of Ebola and Marburg hemorrhagic fever;Grolla A等;《Virologie》;20051231;第98卷(第3期);第205-209页 * |
| Manfred Weidmann等.Rapid detection protocol for filoviruses.《Journal of Clinical Virology》.2004,第30卷(第1期), |
| Rapid Detection and Quantification of RNA of Ebola and Marburg Viruses, Lassa Virus, Crimean-Congo Hemorrhagic Fever Virus,Rift Valley Fever Virus, Dengue Virus, and Yellow Fever Virus by Real-Time Reverse Transcription-PCR;Christian Drosten等;《Journal of Clinical Microbiology》;20020731;第40卷(第7期);第2323-2330页 * |
| Rapid detection protocol for filoviruses;Manfred Weidmann等;《Journal of Clinical Virology》;20041231;第30卷(第1期);摘要部分，第2.1节和3.4节以及表1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102140533A (en) | 2011-08-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102140533B (en) | Marburg and Ebola dual-virus fluorescent quantitative PCR (Polymerase Chain Reaction) detection method and dual-virus detection PCR system | |
| Li et al. | Primer design for quantitative real-time PCR for the emerging Coronavirus SARS-CoV-2 | |
| CN102191338B (en) | Fluorescence quantitative polymerase chain reaction (PCR) new method for detecting multiple viruses of yellow fever, dengue fever and epidemicencephalitis B and multiple virus detection PCR system | |
| CN101979666B (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for quickly detecting herpes simplex viruses 2 | |
| PT1421200E (en) | Fluorescent multiplex hpv pcr assays using multiple fluorophores | |
| Weaver et al. | Low‐level persistence of human papillomavirus 16 DNA in a cohort of closely followed adolescent women | |
| CN102140529A (en) | New dengue virus fluorescence quantitative polymerase chain reaction detection method and dengue virus polymerase chain reaction detection system | |
| CN102140532A (en) | Novel Ebola virus fluorescent quantitative PCR (Polymerase Chain Reaction) detection method and system | |
| Ge et al. | A Palm Germ-Radar (PaGeR) for rapid and simple COVID-19 detection by reverse transcription loop-mediated isothermal amplification (RT-LAMP) | |
| CN102140530B (en) | New chikungunya virus fluorescence quantitative polymerase chain reaction detection method and chikungunya virus polymerase chain reaction detection system | |
| Gryadunov et al. | Hepatitis C virus genotyping using an oligonucleotide microarray based on the NS5B sequence | |
| WO2020199441A1 (en) | Use of primer probe combination and kit thereof in hbv detection | |
| CN103255232B (en) | Dual fluorescence RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) detection kit and method for avian influenza H7N9 virus | |
| CN102409109B (en) | Novel orthobunyavirus fluorescence quantitative detection kit and detection method of virus | |
| JP7105553B2 (en) | Dual-probe assay for target nucleic acid detection | |
| CN102140531B (en) | Novel Marburg virus fluorescent quantitative PCR (Polymerase Chain Reaction) detection method and Marburg virus PCR detection system | |
| CN113508182B (en) | Assay for detection of Human Papillomavirus (HPV) | |
| WO2009061640A2 (en) | Hepatitis b virus (hbv) specific oligonucleotide sequences | |
| CN106636454A (en) | Real-time fluorescence multi-RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method for simultaneously detecting human coronaviruses 229E, OC43, NL63 and HKU1 | |
| Medici et al. | Broadly reactive nested reverse transcription-PCR using an internal RNA standard control for detection of noroviruses in stool samples | |
| CN103966356A (en) | Human immunodeficiency virus type 1 one-step fluorescence quantitative RT-PCR detection kit | |
| CN102277446B (en) | Novel fluorescence quantitative PCR (Polymerase Chain Reaction) detection method for yellow fever viruses and yellow fever virus detection PCR system | |
| CN105132584A (en) | Kit for genotyping VZV, production method of kit and application of kit | |
| EP1806410A2 (en) | Fluorescent multiplex HPV PCR assays using multiple fluorophores | |
| KR102207965B1 (en) | Primers and probes for detection of Hantaan virus and Seoul virus and detecting method for Hantaan virus and Seoul virus using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |