CN102199559B - Bacillus subtilis strain and application thereof - Google Patents
Bacillus subtilis strain and application thereof Download PDFInfo
- Publication number
- CN102199559B CN102199559B CN2011100237954A CN201110023795A CN102199559B CN 102199559 B CN102199559 B CN 102199559B CN 2011100237954 A CN2011100237954 A CN 2011100237954A CN 201110023795 A CN201110023795 A CN 201110023795A CN 102199559 B CN102199559 B CN 102199559B
- Authority
- CN
- China
- Prior art keywords
- strain
- bacillus subtilis
- bacterium
- fermented
- soya bean
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a Bacillus subtilis strain and an application thereof. The bacterium is 0.5mu m in width and 2.6mu m in length and is Gram-positive; the shape of the spore is oval, the spore is in the center of the bacterium; the cysts fail to expand; the bacterium does not have parasporal crystal; and the bacterium has flagella. The bacterial colony is pure white and is irregular in shape; the center of the bacterial colony is raised in a concentric ring shape, the bacterial colony is non-transparent and has dry surface; and bacteria are slightly sticky and easy to pick up. The color and luster of the fermented soybean fermented by the Bacillus subtilis strain are similar to that of the fermented soybean fermented naturally; and the strain can not generate gas, and the strain has higher enzyme-producing capability and better fermentation flavor and is suitable for the industrial pure fermention production of fermented soybean.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of Bacillus subtilis strain, also relate to simultaneously the application of this Bacillus subtilis strain aspect the realization pure-breed bacterial fermentation of fermented soybean.
Background technology
The bacteria type fermented soya bean are main at present to adopt traditional spontaneous fermentation to produce, do not realize pure-blood ferment, cause living contaminants often occurring by the natto that wet fermented soya beans, salted or other wise allotment is produced, aerogenesis, top cover and secondary pollution phenomenon are serious, easily produce toxin, and salt content is too high, and these factors are the health of serious threat human body all.
And the production of Japanese Natto and the training of Indonesia sky is owing to adopting the pure-blood ferment technology, and production and marketing output is all very large, steps into already suitability for industrialized production.Main bacteria seed in the bacteria type fermented soya bean of spontaneous fermentation has genus bacillus, micrococci, milk-acid bacteria and yeast.During primary fermentation, genus bacillus quantity is preponderated, the Secretases most species, and yield of enzyme is also maximum; During secondary fermentation, owing to adding salt, the micrococci of salt tolerance, milk-acid bacteria and yeast just begin growth.At present, genus bacillus is mainly used in the production of industrial enzyme preparation.Then there are the difficult problems such as fermented flavour, color and luster and quality be poor in the pure-blood ferment fermented soya bean, are difficult to be applied to foodstuffs industry production.
Summary of the invention
A kind of fermentative production fermented soya bean color and luster that the object of the invention is to overcome above-mentioned shortcoming and provide is similar to spontaneous fermentation, and the Bacillus subtilis strain that aerogenesis, enzymatic productivity are not strong, fermented flavour suits industrial purebred fermentative production fermented soya bean preferably.
Another object of the present invention is to provide this Bacillus subtilis strain in the purposes in the fermented soya bean fermentative production.
A kind of subtilis (Bacillus subtilis) BJ3-2 is the anaerogen strain, and its product proteolytic enzyme ability (3.60h/c) is higher.Individual morphology feature: the wide 0.5 μ m of thalline, the long 2.6 μ m of thalline; Gram-reaction is positive; Gemma is shaped as ellipse, is positioned in the middle of the thalline; Sporangium is without expanding; Without parasporal crystal; Amphitrichous.Colonial morphology: pure white, out-of-shape, bacterium colony center are concentric annular protuberance, opaque, surface drying, the little thickness of thalline, easy picking.The thalline size is all less than normal than the description of genus bacillus 0.7-0.8 * 2-3 (μ m * μ m) in " uncle Jie Shi identification handbook ", gives birth in the gemma.Bacterial strain is safe, nontoxic.
This bacterial classification has been deposited in (address: BeiJing, China Institute of Microorganism, Academia Sinica), China Committee for Culture Collection of Microorganisms common micro-organisms center on October 22nd, 2010, preserving number: CGMCC NO:4256, name is called: subtilis (Bacillus subtilis) BJ3-2.
(1) separating step of a kind of fermented soya bean genus bacillus bacterial classification (Bacillus subtilis BJ3-2):
1. primary dcreening operation
Adopt the dilution method of scoring to separate the acquisition single strain in the bacteria type fermented soya bean sample of the major areas such as Guizhou Bijie, Zun Yi, purifying is by Gram-stained doubtful Bacillus strain, inoculation autoclaving and cooled soybean, color and luster, haircuts, fermented soya beans, salted or other wise according to fermented soya bean after the fermentation is fragrant, sauce is fragrant, the ammonia flavor, ground carry out comprehensive evaluating and marking, filter out the outstanding bacterial strain of fermentation quality.
2. sieve again
Multiple sieve adopts bigness scale to produce the proteolytic enzyme ability and the fermented flavour sense organ is evaluated and tested the method that combines.The bacterial strain that primary dcreening operation is obtained is inoculated in respectively the casein agar flat board, and according to the ratio of the transparent circle diameter (h) that produces behind the decomposition casein with colony diameter (c), with reference to the flavor quality of its fermented soybean local flavor, screening obtains the BJ3-2 bacterial strain simultaneously.
(2) cultivation of bacterial classification:
Perfect medium: Tryptones 10g, yeast extract paste 5g, sodium-chlor 10g, water 1000mL, pH7.0.Solid medium adds agar 20g, 121 ℃ of sterilization 20min.
(3) conservation and going down to posterity:
Beef-protein medium: extractum carnis 3g, peptone 10g, NaCl 5g, add water to 1000mL.Transfer pH 7.0-7.2 with 5N NaOH.
The LB substratum: yeast extract 5g, peptone 10g, NaCl 10g adds water to 1000mL, and 5N NaOH transfers pH7.0-7.2.
It more than is liquid nutrient medium.Solid medium need add agar by 2%, and 121 ℃ of sterilization 20min pour in the culture dish when being cooled to 45-50 ℃ and get final product.
Store method has three kinds:
(1) per month once, from the solid of having grown or liquid nutrient medium is inoculated on the new flat board by an inoculation circular rector or the slant tube, 32 ℃, 30h.Place 4 ℃ of preservations.
(2) with the test tube of 15 * 180mm, contain nutrient agar 5mL, beveling, the inoculation bacterial classification, 32 ℃, cultivate 30h, pour approximately that 10ml sterilization paraffin oil covers on it into, place 4 ℃ of preservations.3 months transferred speciess once.
(3) freezing preservation method.Inoculation LB liquid nutrient medium, 32 ℃, 200rpm adds 20% aseptic glycerine behind the 24h, and aseptic pouring in the cryopreservation tube behind the mixing places-80 ℃ of preservations.1 year transferred species once.
(4) ecological characteristic of bacterial classification:
BJ3-2 bacterial strain 1% inoculation beef extract-peptone liquid nutrient medium, 32 ℃, 200rpm cultivates, and 0-4h is lag phase; 5-10h is logarithmic phase; 10-14h is for growing stationary phase; 14-20h is decline phase.Colony morphology characteristic: Gram-positive; Gemma is shaped as ellipse, is positioned in the middle of the thalline; Sporangium is without expanding; Without parasporal crystal; Amphitrichous.Colonial morphology is that pure white, out-of-shape, bacterium colony center are concentric annular protuberance, opaque, surface drying, the little thickness of thalline, easy picking.The thalline size all than " in uncle's Jie Shi Bacteria Identification handbook the 8th edition the description of genus bacillus 0.7-0.8 * 2-3 (μ m * μ m) less than normal, give birth in the gemma.
(5) cultural characters of bacterial classification
(1) culture temperature is 4 ℃-50 ℃, and optimum growth temperature is at 32 ℃-42 ℃.
(2) cultivate pH6-8, best pH is 7.0-7.2.
According to common " bacterial system identification handbook " (eastern elegant pearl, 1999) and " appraisal basis that uncle's Jie Shi Bacteria Identification handbook provides, to the cloning and analyzing of its 16SrDNA, length is 932bp simultaneously, compare with subtilis, sequence homology is up to 99%.Comprehensive sequence analysis result determines that this bacterial strain belongs to Bacillaceae, bacillus, subtilis.Because this bacterial classification is to obtain from Bijie Prefecture, Guizhou (BJ) fermented soya bean sample separation, special according to screening quantity called after: fermented soya bean genus bacillus (Bacillus subtilis) BJ3-2.
The present invention compared with prior art, has obvious beneficial effect, as can be known from the above technical solutions: from the good bacteria type fermented soya bean sample of local flavor, the fermentation bacterial classification that plays a major role is separated, screens, obtain the Bacillus strain that fermented flavour is outstanding, enzyme system is comparatively complete, and by the fermentation gas test, the anaerogenic bacterial strain of screening primary fermentation, simultaneously the secondary fermentation condition is optimized, can realizes the pure-blood ferment of bacteria type fermented soya bean.Product physics and chemistry and sanitary index all reach fermented soya bean standard DB52/524-2007, and the fermented soya bean organoleptic quality is similar to the spontaneous fermentation fermented soya bean, and quality is better, and fragrance is outstanding, and wire drawing is longer, and good stability occurs without phenomenons such as " smelly ", " aerogenesis ".The natto product quality that goes out as raw material production significantly is better than aging process, and the lid rate is low in advance for product.Neutral protease in the fermented soya bean, Sumizyme MP, lipase activity, fermented soya bean fibrinolytic enzyme vigor are higher, and fermented soya bean color and luster and better flavor can be used as for the purebred fermentative production candidate strain of industry.
Embodiment
(1) fermented soya bean genus bacillus (Bacillus subtilis) BJ3-2 strains separation and screening
1) strain separating and purifying
Get the commercially available bacteria type fermented soya bean sample of the major areas such as 2g Guizhou Bijie, Zun Yi in the triangular flask of 18g sterilized water, and add 0.1% tween 80,180rpm cultivates 30min, and then gradient dilution is 10-2-10-9, and each dilution gradient is done 3 repetitions.Get liquid 1mL after leaving standstill 10min, evenly coat on the beef extract-peptone flat board, cultivate 24h for 37 ℃.Gramstaining and spore staining, conservation is in the beef extract-peptone slant tube after 3 generations with the single bacterium colony purifying of G+ genus bacillus, and each sample keeps the 4-5 bacterial strain, and the dull and stereotyped form of record bacterial strain, sorts out.
2) primary dcreening operation
Inoculating strain is in the beef extract-peptone liquid tube, cultivate 12h for 30 ℃, in soya bean (g): the ratio of planting daughter bacteria liquid (mL)=125: 1 is inoculated into fermention medium, cultivate 72h for 37 ℃, take bacillus natto (CICC:1023) pure-blood ferment fermented soya bean and spontaneous fermentation fermented soya bean as contrast, color and luster and the local flavor of sensory evaluation fermentation fermented soya bean therefrom filter out similar to the control strain fermented flavour or the bacterial strain of characteristics are arranged, and each area filters out preferably bacterial strain of 1-3 strain fermentation quality.
3) multiple sieve
Bacterial strain produces the mensuration of proteolytic enzyme ability: the bacterial strain point is connected to the casein agar flat board, cultivate 24h for 37 ℃, measure respectively bacterium colony transparent circle diameter (h) and colony diameter (c), each is surveyed 3 times, calculating mean value, h/c value size expression thalline produces the height of proteolytic enzyme ability.
The evaluation and test of color and luster and local flavor: soya bean 200g, the fermentation of 1% inoculating strain.Outward appearance, local flavor and the quality etc. of subjective appreciation bacterium fermentation fermented soya bean, standards of grading see the following form.With score value just represent the to ferment quality of fermented soya bean quality.
Table 1 sensory evaluation standard
The project standards of grading
Color and luster tawny (8-10 divides), deep yellow brown or khaki (5-7 divides), chocolate (0-4 divides)
Haircuts very sticking (8-10 divides), medium (5-7 divides), sticking (0-4 divides)
Fermented soya beans, salted or other wise aromatic strongly fragrant (16-20 divides), medium (11-15 divides), fermented soya beans, salted or other wise is lightly seasoned or peculiar smell (0-10 divides) is arranged
The ammonia flavor is (16-20 divides), medium (11-15 divides), heavy (0-10 divides) gently
Sauce aromatic strongly fragrant (16-20 divides), medium (11-15 divides), light (0-10 divides)
Quality moderate (15-20 divides), too hard or too soft (10-14 divides)
4) fermentation gas test
The bacterium liquid of 1mL beef extract-peptone liquid culture is inoculated in the fermentation gas substratum, cultivates 72h for 37 ℃, have or not bubble in the inversion Durham's fermentation tube in the observation test tube, the person is positive bubble to the occur.
(2) identification of strains
1) individual morphology feature
Thalline is carried out gramstaining, use the microscopic examination individual morphology, and measure the thalline size with ocular micrometer.
2) colonial morphology
The isolated strains dibbling on beef-protein medium, is cultivated 24h for 37 ℃, form bacterium colony.Observe size, quality, shape, the color of bacterium colony.
3) Physiology and biochemistry is identified
By tests such as sugar-fermenting, propionic salt, Citrate trianion, lecithinases, carry out Physiology and biochemistry and identify, identify kind with reference to " uncle Jie Shi identification handbook " (the 8th edition) and common bacteria system identification handbook (eastern elegant pearl etc., 1999).
4) Molecular Identification
Pcr amplification 16S rDNA sequence
The lysozyme lysis method is extracted the bacillus gene group, adopts Auele Specific Primer (P1:GAGAGTTTGATCCTGGCTCAG/P2:GCCCCCGTCA ATTCCTTTGAG) amplification bacterial 16 S rDNA sequence after the ultraviolet detection by quantitative.94℃，5min×1cycle→94℃，1min→50℃，40Sec→72℃，40sec×5cycle→94℃，1min→54℃，40Sec→72℃，40sec×25cycle→72℃，8min→4℃，∞。
16S rDNA clone and order-checking
Glue reclaims 16S rDNA 0.5-1 μ g, is cloned into pMD18-T, and positive colony send the order-checking of the precious biotech firm in Dalian.
The sequence accession number
Genbank：FJ235079.2
(3) mensuration of strain enzyme-producing vigor
The bacillus subtilis bacterial strain is inoculated pretreated soybean, and interior the sampling respectively every 6h of 72h detected proteolytic enzyme, lipase, fibrinolytic enzyme, amylase, glutamine enzyme activity, and the highest bacterial strain of enzyme activity is produced in screening.
1) proteinase activity is measured
The drafting of tyrosine typical curve
Preparation 50ug/mL tyrosine standardized solution is got six test tube labels 0,1,2,3,4,5.Add respectively 0mL, 0.2mL, 0.4mL, 0.6mL, 0.8mL, the standard tyrosine solution of 1.0mL.Each effective distilled water is supplied last each pipe of sodium carbonate solution 5mL that 1mL adds respectively 0.55mol/L again and is added successively phenol reagent 0.5mL and shake up and place 30 ℃ of constant temperature colour developing 15min, and ultraviolet spectrophotometer is measured light absorption value at 680nm.Take tyrosine content as ordinate zou, light absorption value is X-coordinate, the drawing standard curve.
The mensuration of vigor
Draw 0.5% casein solution 2mL and place test tube behind 30 ℃ of water-bath 5min, (30 ℃ 5min) are clocked the 1mL enzyme liquid of adding preheating immediately; Take out behind the 10min and add immediately 10% trichoroacetic acid(TCA) solution 3mL, use dried filter paper filtering after placing 15min, control group adds first 3mL trichoroacetic acid(TCA) solution and then adds 0.5% casein 2mL, takes out behind 30 ℃ of insulation 10min and places 15min, filtration; Get three test tube numberings, add respectively 1mL sample filtrate, contrast filtrate and each 1mL of water, then add the Na of 0.55mol/L
2CO
3Solution 5mL adds 0.5mL forint phenol reagent again, 30 ℃ of colour developing 15min, colorimetric under the 680nm.Measure OD value secundum legem curve calculation proteinase activity.
2) lipase activity is measured
Adopt sweet oil emulsion hydrolysis volumetry.Get two 100mL triangular flasks, in blank bottle (A) and sample bottle (B), add substrate (25% polyvinyl alcohol sweet oil emulsion) 4.0mL and phosphoric acid buffer 5.0mL, in the A bottle, add again 95% ethanol 15.0mL, preheating 5min in 40 ℃ of water-baths, and then respectively add enzyme liquid 1.0mL to be determined in two bottles, immediately mixing timing, accurate response 15min in 40 ℃ of water-baths adds 95% ethanol 15.0mL termination reaction immediately in the B bottle, take out.In blank and sample solution, respectively add 2 of phenolphthalein indicators, with the titration of 0.05mol/L standard solution of sodium hydroxide, until blush and keep that 30s is colour-fast to be its terminal point, the volume of record consumption 0.05mol/L sodium hydroxide.
Calculation formula: X=(B-A) * c/0.05 * 50 * 1/15 * n=200/3 * (B-A) * c * n
In the formula: X: the enzyme activity of sample, μ/g
B: consume the volume of sodium hydroxide standard solution during the titration sample, mL
A: consume the volume of sodium hydroxide standard solution when titration is blank, mL
C: sodium hydroxide standard solution concentration, mol/L
0.05: sodium hydroxide standard solution concentration conversion coefficient
50:0.05mol/L sodium hydroxide solution 1.00mL is equivalent to lipid acid 50 μ moL
1/15: the reaction times, in 1min
N: extension rate
3) amylase activity is measured
The making of maltose typical curve
Get 7 clean tool plug scale test tubes, numbering adds respectively maltose standardized solution (1mg/mL) 0,0.2,0.6,1.0,1.4,1.8,2.0, and then adding distil water makes each pipe reach 2.0mL.Each adds 3,5-dinitrosalicylic acid (DNS) 2.0mL, shakes up, and puts and boils 5min in the boiling water bath.Flowing water cooling after taking out, adding distil water is settled to 20mL.With No. 1 pipe as blank zeroising, colorimetric estimation under the 520nm wavelength.Take maltose content as X-coordinate, absorbance is ordinate zou, the drawing standard curve.
The mensuration of vigor
Get 4 in test tube, add zyme extract 1.0mL in every test tube, at 70 ℃ of heating in water bath 15min.Take out rapidly cooling, in test tube, add the citrate buffer solution of 1.0mL pH 5.6.Add first 4.0mL NaOH in the control tube, stop the activity of enzyme.With control tube with measure pipe and put in 40 ℃ of waters bath with thermostatic control and be incubated 15min, add the starch solution 2.0mL of 40 ℃ of preheatings, mixing is put into immediately 40 ℃ of water-baths and is accurately removed behind the insulation 15min, adds 4.0mL 0.4mol/L NaOH, stops enzymic activity.
Get solution after the enzyme effect and each 2.0mL in the control tube, put into the 25mL test tube and add 3.0mL DNS mixing, find maltose content by typical curve, calculate alpha-amylase activity.
Calculation formula: alpha-amylase activity (mg/g)=(A-A ') * diluted sample volume/[heavy (the g) * C of sample]
In the formula:
A: the maltose content that α-amylasehydrolysis starch generates;
A ': the maltose content in the α-amylase control tube;
C: sample liquid milliliter number during colorimetric.
4) fibrinolytic enzyme vitality test
The preparation of fibrin plate
Pipette 10mL 2% agar-agar soln in flat board, form the first layer after the cooled and solidified.In the aseptic agarose solution (the 0.2g agarose is dissolved in 20mL Veronal sodium-HCl damping fluid) with 12.5mL fibrinogen solution and 20mL 1.0%, 50 ℃ are fully mixed, add rapidly 250 μ l 20IU/mL thrombin of beef, backward each agar plate of mixing pipettes 15mL, forms double-deck fibrin plate.
The extraction of enzyme liquid
Fermented soya bean sample (g) mixes in 1: 2 ratio with stroke-physiological saline solution (mL), gets 50mL, and lixiviate 24h in 4 ℃ of refrigerators, vat liquor be through whizzer 4,000rpm, and centrifugal 30min gets supernatant for subsequent use.
Point sample
Micro-punch tool with bore 3mm punches at fibrin plate, point enzyme liquid 10 μ L in each hole, static 10min, cultivate 18h in 37 ℃, measure and calculate bacteriolyze circle area (products of two perpendicular diameter), take the urokinase unit of activity as X-coordinate, bacteriolyze circle area is ordinate zou, checks in fibrinolytic enzyme vigor (U) by the urokinase typical curve.
5) glutamine enzyme activity determination
Adopt GENMED SCIENTIFICS IN.U.S.A bacterium glutaminase active spectrography immue quantitative detection reagent box (article No.: GMS50374.4).
(4) strain fermentation performance
Bacterial strain production optimal pH, temperature, pretreating raw material, inoculum size, loading capacity, relative humidity, fermentation time are all judged with the fermented soya bean amino acid nitrogen content, determine the fermentation parameter of optimizing by orthogonal test.
(5) bacterial strain production and application explanation
The bacterial classification preparation: slant strains inoculation LB liquid nutrient medium, 200rpm cultivates 12-14h for 30 ℃.
Fermenting container: bamboo basket (10-20kg) adopts wet sterilization to process 15min.
Production technique: 30-35 ℃ of soaking bean water temperature, soaking bean water pH8.0, beans amount (g): the water yield (mL) is 1: 4, bubble beans 4-10h, soybean boiling 4-8h is cooled to 40 ℃ ± 3.
Fermentation condition: inoculum size 1%, leavening temperature 36-38 ℃, relative humidity 65-90%, fermentation time 70-72h.
Proving room: 〉=30m2, temperature control are the coil pipe type of heating.
A 201110023795.4 Bacillus subtilis strain and uses thereof sequence table
SEQUENCE LISTING
＜110〉Guizhou University
Support the army Wu
＜120〉a kind of Bacillus subtilis strain and uses thereof
<130>NCBI/FJ235079.2
<140>201110023795.4
<141>2011-01-21
<160>2
<170>PatentIn version 3.3
<210>1
<211>21
<212>DNA
<213>Bacillus subtilis
<220>
<221>rRNA
<222>(1)..(21)
<300>
<308>P1
<309>2008-10-28
<313>(1)..(21)
<400>1
gagagtttga tcctggctca g 21
<210>2
<211>21
<212>DNA
<213>Bacillus subtilis
<220>
<221>rRNA
<222>(1)..(21)
<300>
<308>P2
<309>2008-10-28
<313>(1)..(21)
<400>2
gcccccgtca attcctttga g 21
Claims (2)
1. a subtilis (Bacillus subtilis) BJ3-2, the preserving number that it is characterized in that described bacterial classification is CCTCC NO:4256.
2. the purposes of subtilis BJ3-2 as claimed in claim 1 in the fermented soya bean fermentative production.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100237954A CN102199559B (en) | 2011-01-21 | 2011-01-21 | Bacillus subtilis strain and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100237954A CN102199559B (en) | 2011-01-21 | 2011-01-21 | Bacillus subtilis strain and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102199559A CN102199559A (en) | 2011-09-28 |
| CN102199559B true CN102199559B (en) | 2013-03-06 |
Family
ID=44660548
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011100237954A Expired - Fee Related CN102199559B (en) | 2011-01-21 | 2011-01-21 | Bacillus subtilis strain and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102199559B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108611298B (en) * | 2018-05-05 | 2021-03-23 | 上海海洋大学 | Deep sea bacillus and application thereof in inducing juvenile mytilus coruscus to attach |
| CN109536420B (en) * | 2018-12-29 | 2022-09-09 | 贵州大学 | Bacillus subtilis and application thereof |
| CN109673956A (en) * | 2019-02-25 | 2019-04-26 | 贵州大学 | A kind of beans sauce and preparation method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1986776A (en) * | 2006-12-25 | 2007-06-27 | 浙江大学 | Bacillus subtilis strain suitable for pure-breed bacterial fermentation of fermented soybean |
| WO2008133226A1 (en) * | 2007-04-25 | 2008-11-06 | Mizkan Group Corporation | Novel strain of bacillus natto and soft natto produced by using the bacillus natto strain |
-
2011
- 2011-01-21 CN CN2011100237954A patent/CN102199559B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1986776A (en) * | 2006-12-25 | 2007-06-27 | 浙江大学 | Bacillus subtilis strain suitable for pure-breed bacterial fermentation of fermented soybean |
| WO2008133226A1 (en) * | 2007-04-25 | 2008-11-06 | Mizkan Group Corporation | Novel strain of bacillus natto and soft natto produced by using the bacillus natto strain |
Non-Patent Citations (2)
| Title |
|---|
| Inatsu Y等.Characterization of Bacillus subtilis strains isolated from fermented soybean foods in Southeast Asia: Comparison with B-subtilis (natto) starter strains.《JARQ-JAPAN AGRICULTURAL RESEARCH QUARTERLY》.2002,第36卷(第3期),169-175. * |
| 贾东旭等.细菌型豆豉发酵芽孢杆菌的筛选与鉴定.《食品科学》.2009,第30卷(第05期),217-221. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102199559A (en) | 2011-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109797115B (en) | Bacillus amyloliquefaciens GZU05 for producing nattokinase and beta-glucoside and application method thereof | |
| CN104087511A (en) | Mucor racemosus strain and its application | |
| CN113957003A (en) | Antifungal streptomyces hygroscopicus and application thereof | |
| CN106011002B (en) | Bacillus megaterium T317, microbial inoculum thereof and preparation method of microbial inoculum | |
| CN103184160A (en) | Strain for producing organic solvent tolerant lipase, organic solvent tolerant lipase and preparation method of organic solvent tolerant lipase | |
| CN103243037B (en) | High temperature yeast for brewing msalais, preparation method thereof and brewed msalais | |
| CN109370924A (en) | One Aspergillus oryzae ZA112 and its application | |
| CN102199559B (en) | Bacillus subtilis strain and application thereof | |
| CN101139564B (en) | Duganella bacterium and uses thereof | |
| CN109321500B (en) | Bacillus amyloliquefaciens strain and application thereof in prevention and treatment of camellia oleifera anthracnose disease | |
| CN113293105B (en) | Aspergillus oryzae ZA173 and application thereof | |
| CN104630076A (en) | Monascus purpureus (Monascus purpureus) Mp-42 strain capable of producing amylase at high yield and application of monascus purpureus Mp-42 strain | |
| CN104450571A (en) | Bacillus thuringiensis strain for efficient degradation of fly larvae protein | |
| CN102986536B (en) | A kind of flammulina velutipes strain and preparation method | |
| CN103773709B (en) | Bacillus subtilis with efficient phosphate solubilizing effect and application thereof | |
| CN106119166B (en) | One plant of Switzerland lactic acid bacteria and its application | |
| CN105670936B (en) | A kind of method of Trametes trogii bacterial strain and its application and Pu'er tea processing | |
| KR20180118477A (en) | Safe starter for the production of soybean fermented food and soybean fermented food therefrom | |
| CN108265019B (en) | Leuconostoc mesenteroides subsp mesenteroides, preparation method and application | |
| CN104357342B (en) | A kind of high-quality yeast of Xinjiang local characteristic crusty pancake dough and its application in system is cramed food into one's mouth | |
| CN109136100A (en) | One plant of Tabin aspergillus bacterial strain and the application on fermentation green brick tea | |
| CN113151111B (en) | Staphylococcus carnosus IEF1018 and application thereof | |
| CN106011023B (en) | One plant of acetic acid bacteria for being isolated from traditional fermented food acid congee and its application | |
| CN114874942A (en) | Bacillus cereus producing protease and application thereof in yeast for making hard liquor | |
| CN114540221A (en) | Neutral protease producing bacillus and method for producing neutral protease by using same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130306 Termination date: 20210121 |