CN102146418A

CN102146418A - Recombinant II type herpes simplex virus vector, preparation method of recombinant II type herpes simplex virus vector, recombinant virus, medicinal composition and application

Info

Publication number: CN102146418A
Application number: CN2010101162753A
Authority: CN
Inventors: 刘滨磊
Original assignee: WUHAN BINHUI BIOLOGICAL TECHNOLOGY Co Ltd
Current assignee: Wuhan waterfront biological Polytron Technologies Inc
Priority date: 2010-02-09
Filing date: 2010-02-09
Publication date: 2011-08-10
Anticipated expiration: 2030-02-09
Also published as: CN102146418B

Abstract

The invention provides a recombinant II type herpes simplex virus vector. An ICP34.5 gene and an ICP47 gene of a wild II type herpes simplex virus HG52 strain are removed in the virus vector, and preferably a human granulocyte macrophage-colony stimulating factor (hGM-CSF) expression box is inserted into the position where the ICP34.5 gene is removed. The invention also provides a preparation method of the recombinant II type herpes simplex virus vector, a recombinant virus using the recombinant II type herpes simplex virus as a vector, a medicinal composition consisting of the recombinant II type herpes simplex virus vector and a pharmaceutically acceptable vector or excipient, and application of the recombinant II type herpes simplex virus vector in preparation of a gene medicament for treating tumors. As the ICP34.5 gene is removed in the recombinant II type herpes simplex virus vector provided by the invention, the oncolysis virus is safe and can selectively grow and propagate in tumor cells; the ICP47 gene is removed to promote immune response and enhance oncolysis activity; and the curative effect of the recombinant II type herpes simplex virus vector is superior to that of the conventional recombinant I type herpes simplex virus vector, and the recombinant II type herpes simplex virus vector has high safety.

Description

Recombinant type II herpes simplex virus vector and preparation method thereof, recombinant virus, pharmaceutical composition and application

Technical field

The present invention relates to recombinate II herpes simplex virus type carrier and preparation method thereof, comprise this reorganization II herpes simplex virus type carrier recombinant virus, comprise the application in the genomic medicine of preparation treatment tumour of this reorganization II herpes simplex virus type carrier medicament composition and described reorganization II herpes simplex virus type carrier and recombinant virus.

Background technology

(Herps simplex virus HSV) is the double-stranded DNA virus of a kind of 154kb of being about to herpes simplex virus vector, can duplicate in the host cell nuclear that is contaminted.Hsv vector has the following advantages: 1) host cell is extensive; 2) virus titer height; 3) the foreign gene capacity is big.The shortcoming of hsv vector is its toxicity.

For example, the function of the translocator (TAP1 and TAP2) that the influence of ICP47 albumen is relevant with the antigen processing, the antigen table that hinders MHC I molecule is process.Help the enhancing immunity reaction so reject the ICP47 gene.In addition, reject the ICP47 gene, the US11 genetic expression in downstream is increased, US11 can resist the inhibition of PKR to the viral growth breeding.ICP34.5 is the neural malicious factor, and the virus that has lacked ICP34.5 is killing tumor cell optionally, and its mechanism is: ICP34.5 can resist the deactivation of PKR to translation initiation factor eIf-2a, makes virus breeding smoothly.Therefore, after the virus that has lost ICP34.5 enters normal cell, inducing interferon/PKR path activation, and then cause the eIf-2a inactivation, viral protein can not synthesize, viral proliferation is obstructed.And the Interferon, rabbit of most of tumour cells/PKR signal path is impaired.Therefore, lost the virus of ICP34.5 can be in tumour cell growth and breeding.And ICP6 genes encoding ribonucleotide reductase, this enzyme provides essential precursor for viral dna replication, is dispensable gene in somatoblast (as tumour cell), rejects the carrying capacity that this gene can increase virus vector.

Existing herpes simplex virus vector is all obtained by rejecting above gene by wild-type I herpes simplex virus type.For example CN 1283803C discloses a kind of attenuation HSV-1 gene therapy vector, and this carrier has been rejected ICP47, ICP6 and three genes of ICP34.5.There is long, the insufficient problem of oncolytic activity of production cycle in existing herpes simplex virus vector by the preparation of wild-type I herpes simplex virus type; Whether wild-type II herpes simplex virus type can be used as herpes simplex virus vector, does not also report for work at present.

Summary of the invention

The objective of the invention is to overcome existing herpes simplex virus vector by the preparation of wild-type I herpes simplex virus type, long, the insufficient shortcoming of oncolytic activity of production cycle provides a kind of with short production cycle, reorganization II herpes simplex virus type carrier that oncolytic activity is high.

Prior art be it is generally acknowledged wild-type II herpes simplex virus type (multiple parasitism is in reproductive tract) than wild-type I herpes simplex virus type (infecting oral cavity and mouthful all skin mucous membranes) poor stability more, so does not select wild-type II herpes simplex virus type to prepare herpes simplex virus vector.But the present inventor finds, only rejects the reorganization II herpes simplex virus type carrier that ICP47 and ICP34.5 obtain by wild-type II herpes simplex virus type, and security is good.Therefore in addition, prior art thinks that also the ICP6 gene is an indispensable gene in Unseparated Cell (as normal cell), be dispensable gene in somatoblast, rejects the carrying capacity that ICP6 can increase virus vector and the selectivity of target somatoblast.The present inventor finds in fact to reject ICP6 makes the growth and breeding of virus be subjected to very big influence later on, and oncolytic activity descends, and is difficult to produce the virus of high titre; Make on the contrary under the situation that keeps ICP6, viral growth is bred, produce the virus of high titre easily, and reduced the step of rejecting ICP6 and can improve the efficient of producing reorganization II herpes simplex virus type carrier greatly, and owing to rejected ICP34.5, the recombinate tumor-selective of II herpes simplex virus type carrier of the present invention kills and wounds and is not subjected to remarkably influenced.

The invention provides a kind of reorganization II herpes simplex virus type carrier, wherein, described carrier has been rejected the ICP34.5 gene and the ICP47 gene of wild II herpes simplex virus type HG52 strain.

The invention provides a kind of reorganization II herpes simplex virus type carrier, wherein, described carrier has been rejected the ICP34.5 gene and the ICP47 gene of wild II herpes simplex virus type HG52 strain, and described carrier has inserted human granulocyte-macrophage colony stimulating factor (hGM-CSF) expression cassette on the position of disallowable ICP34.5 gene.

The present invention also provides a kind of preparation method of the II of reorganization herpes simplex virus type carrier, and wherein, this method may further comprise the steps:

(1) from wild-type II herpes simplex virus type HG52 strain, reject the ICP47 gene, make up HG52dICP47 reorganization II herpes simplex virus type:

A. extract the total length viral DNA of II herpes simplex virus type HG52 strain;

B. make up the plasmid pdICP47H2 that contains ICP47 upstream region of gene flanking region sequence and pterion, downstream side sequence:

B1. use the primer shown in the table 1, the total length viral DNA that obtains with step a is a template, pcr amplification ICP47 upstream region of gene flanking region sequence and pterion, downstream side sequence;

Table 1

B2. step b1 amplification gained PCR product upstream side pterion sequence is inserted into the SmaI site of pSP73 plasmid, obtains the pSP73ICP47US plasmid;

B3. step b1 amplification pterion, gained PCR product downstream side sequence is inserted into the Sma I site of pSP73 plasmid, obtains the pICP47DS plasmid;

B4. enzyme from the pICP47DS plasmid that step b3 obtains cuts out pterion, downstream side sequence with restriction enzyme SacI and BamHI, and this pterion, downstream side sequence is inserted into the BglII site of the pSP73ICP47US plasmid that step b2 obtains, obtain containing the pdICP47H2 plasmid of ICP47 upstream region of gene flanking region sequence and pterion, downstream side sequence

B5. the egfp expression box of cytomegalovirus IE promotor control is inserted into the EcoRV site of the pdICP47H2 plasmid of step b4 acquisition, obtains the pdICP47H2-GFP plasmid;

C. make up the reorganization II herpes simplex virus type HG52dICP47 that rejects the ICP47 gene:

C1. the pdICP47H2-GFP plasmid co-transfection bhk cell that obtains of total length viral DNA that step a is obtained and step b, ICP47 gene on the total length viral DNA and the egfp expression box generation homologous recombination on the pdICP47H2-GFP plasmid, the malicious spot green-emitting fluorescence of generation recombinant virus;

C2. select green fluorescence poison spot, be purified into reorganization II herpes simplex virus type HG52dICP47-GFP;

C3. extract the total length viral DNA of reorganization II herpes simplex virus type HG52dICP47-GFP;

C4. the pdICP47H2 plasmid co-transfection bhk cell that the total length viral DNA of the reorganization II herpes simplex virus type HG52dICP47-GFP that step c3 is obtained and step b4 obtain, the egfp expression box generation homologous recombination on the reorganization II herpes simplex virus type HG52dICP47-GFP is disallowable;

C5. select no fluorescence poison spot, be purified into reorganization II herpes simplex virus type HG52dICP47;

(2) reject the ICP34.5 gene, make up reorganization II herpes simplex virus type HG52dICP47d34.5-GFP:

A. extract the total length viral DNA of reorganization II herpes simplex virus type HG52dICP47;

B. make up the plasmid pH2dI34.5 that contains ICP34.5 upstream region of gene flanking region sequence and pterion, downstream side sequence:

B1. use the primer shown in the table 2, the total length viral DNA that obtains with step a is a template, pcr amplification ICP34.5 upstream region of gene flanking region sequence and pterion, downstream side sequence;

Table 2

B2. step B1 amplification gained PCR product upstream side pterion sequence is inserted into the PvuII/XbaI site of pSP72 plasmid, obtains the pSP72H2d34.5US plasmid;

B3. step B1 amplification pterion, gained PCR product downstream side sequence is inserted into the EcoRV/BglII site of the pSP72H2d34.5US plasmid of step B2 acquisition, obtains containing the pH2d34.5 plasmid of ICP34.5 upstream region of gene flanking region sequence and pterion, downstream side sequence;

B4. the egfp expression box of cytomegalovirus IE promotor control is inserted into the EcoRV site of the pH2d34.5 plasmid of step B3 acquisition, obtains the pH2d34.5GFP plasmid;

C. make up the reorganization II herpes simplex virus type carrier HG52dICP47d34.5 that rejects the ICP34.5 gene:

C1. the total length viral DNA of the reorganization II herpes simplex virus type HG52dICP47 that steps A is obtained and the pH2d34.5GFP plasmid co-transfection bhk cell that step B obtains, ICP34.5 gene on the total length viral DNA and the egfp expression box generation homologous recombination on the pH2d34.5GFP plasmid, the malicious spot green-emitting fluorescence of generation recombinant virus;

C2. select green fluorescence poison spot, be purified into reorganization II herpes simplex virus type HG52dICP47d34.5-GFP;

C3. extract the total length viral DNA of reorganization II herpes simplex virus type HG52dICP47d34.5-GFP;

C4. the pH2d34.5 plasmid co-transfection bhk cell that the total length viral DNA of the reorganization II herpes simplex virus type HG52dICP47d34.5-GFP that step C3 is obtained and step B3 obtain, the egfp expression box generation homologous recombination on the reorganization II herpes simplex virus type HG52dICP47d34.5-GFP is disallowable;

C5. select no fluorescence poison spot, be purified into reorganization II herpes simplex virus type carrier HG52dICP47d34.5.

Table 1

B3. step b1 amplification pterion, gained PCR product downstream side sequence is inserted into the SmaI site of pSP73 plasmid, obtains the pICP47DS plasmid;

(2) reject the ICP34.5 gene, insert the human granulocyte-macrophage colony stimulating factor expression cassette, make up reorganization II herpes simplex virus type HG52dICP47dICP34.5-hGM-CSF:

B '. make up the plasmid pH2dI34.5 that contains ICP34.5 upstream region of gene flanking region sequence and pterion, downstream side sequence:

B ' 1. uses the primer shown in the table 2, and the total length viral DNA that obtains with step a is a template, pcr amplification ICP34.5 upstream region of gene flanking region sequence and pterion, downstream side sequence;

Table 2

B ' 2. is inserted into step B ' 1 amplification gained PCR product upstream side pterion sequence the PvuII/XbaI site of pSP72 plasmid, obtains the pSP72H2d34.5US plasmid;

B ' 3. is inserted into step B ' 1 amplification pterion, gained PCR product downstream side sequence the EcoRV/BglII site of the pSP72H2d34.5US plasmid of step B ' 2 acquisitions, obtains containing the pH2d34.5 plasmid of ICP34.5 upstream region of gene flanking region sequence and pterion, downstream side sequence;

B ' 4. is inserted into the human granulocyte-macrophage colony stimulating factor expression cassette of cytomegalovirus IE promotor control the EcoRV site of the pH2d34.5 plasmid of step B ' 3 acquisitions, obtains the pH2d34.5-hGM-CSF plasmid;

C '. make up the reorganization II herpes simplex virus type HG52dICP47d34.5-hGM-CSF that rejects the ICP34.5 gene:

The pH2d34.5-hGMCSF plasmid co-transfection bhk cell that total length viral DNA that C ' 1. obtains steps A and step B ' obtain, the malicious spot expressing human granulocyte-macrophage colony stimutaing factor of the virus of described homologous recombination takes place in ICP34.5 gene on the total length viral DNA and the human granulocyte-macrophage colony stimulating factor expression cassette generation homologous recombination on the pH2d34.5-hGMCSF plasmid;

C ' 2. selects enzyme-linked immunosorbent assay male poison spot, is purified into reorganization II herpes simplex virus type carrier HG52dICP47dICP34.5-hGM-CSF.

The present invention also provides a kind of recombinant virus, and described recombinant virus comprises that as the virus of carrier and goal gene wherein, described virus as carrier is reorganization II herpes simplex virus type carrier of the present invention.

The present invention also provides a kind of pharmaceutical composition, and it comprises reorganization II herpes simplex virus type carrier of the present invention and/or recombinant virus of the present invention, and medicine acceptable carrier or vehicle composition.

The present invention also provides reorganization II herpes simplex virus type carrier of the present invention and the application of recombinant virus in the genomic medicine of preparation treatment tumour.

Reorganization II herpes simplex virus type carrier of the present invention is when treatment animal solid tumor, and curative effect is better than the reorganization I herpes simplex virus type carrier of existing oncolytic.Reorganization II herpes simplex virus type carrier of the present invention has kept the ICP6 that often rejects at existing reorganization I herpes simplex virus type carrier, the security of II herpes simplex virus type carrier of not only recombinating is not affected, the production efficiency height, and can produce than the stronger oncolytic activity of reorganization I herpes simplex virus type carrier.Reorganization II herpes simplex virus type carrier of the present invention has been rejected the gene of ICP34.5, and security and selectivity are good; Rejected the ICP47 gene, promoted immunne response and strengthen oncolytic activity.Reorganization II herpes simplex virus type carrier of the present invention in addition can also insert the gene order of human granulocyte macrophage colony stimulating factor (hGM-CSF), thereby has strengthened antineoplastic immune response.

The simple scar exanthema virus of classification called after II type of the simple scar exanthema virus that the present invention obtains, the Latin formal name used at school is Herpes Simplex Virus Type 2, to China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) that is positioned at No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, deposit number was CGMCC No.3600 in preservation on February 03 in 2010.By the biomaterial H2d3d4-hGF strain of preservation, the implication of its strain number is: H2 refers to II herpes simplex virus type HG52 strain (HSV2); D3 refers to reject ICP34.5; D4 refers to reject ICP47; HGF refers to insert human granulocyte-macrophage colony stimulating factor (hGM-CSF) expression cassette.

Description of drawings

Fig. 1 is the synoptic diagram of the reorganization II herpes simplex virus type carrier of the embodiment of the invention 1;

Fig. 2 is for making up the synoptic diagram of reorganization II herpes simplex virus type carrier of the present invention by the dna homology recombinant technology;

Fig. 3 is for making up the synoptic diagram of ICP47 flank region (Flanking Region is called for short FLR) and relevant plasmid;

Fig. 4 is for making up the synoptic diagram of HG52dICP47-GFP;

Fig. 5 is for making up the synoptic diagram of HG52dICP47;

Fig. 6 is for making up the synoptic diagram of ICP34.5 flank region (FLRs) and relevant plasmid;

Fig. 7 is for making up the synoptic diagram of HG52d47d34.5-GFP;

Fig. 8 is for making up the synoptic diagram of HG52d47d34.5-hGM-CSF.

Embodiment

Preferably, the present invention also provides a kind of reorganization II herpes simplex virus type carrier, wherein, described carrier has been rejected the ICP34.5 gene and the ICP47 gene of wild II herpes simplex virus type HG52 strain, and described carrier has inserted human granulocyte-macrophage colony stimulating factor (hGM-CSF) expression cassette on the position of disallowable ICP34.5 gene.Described reorganization II herpes simplex virus type carrier constitutes as shown in Figure 1.

Table 1

(2) reject the ICP34.5 gene, make up reorganization II herpes simplex virus type HG52dICP47d34.5GFP:

Table 2

Table 1

Table 2

B ' 4. is inserted into the human granulocyte-macrophage colony stimulating factor expression cassette of cytomegalovirus IE promotor control the EcoRV site of the pH2d34.5 plasmid of step B ' 3 acquisitions, obtains the pH2d34.5-hGMCSF plasmid;

The present invention also provides a kind of pharmaceutical composition, is made up of reorganization II herpes simplex virus type carrier of the present invention and medicine acceptable carrier or vehicle.

The present invention also provides the application of reorganization II herpes simplex virus type carrier of the present invention in the genomic medicine of preparation treatment tumour.

Preferably, the preparation method of reorganization II herpes simplex virus type carrier of the present invention is further comprising the steps of:

(3) insert the human granulocyte-macrophage colony stimulating factor expression cassette, make up reorganization II herpes simplex virus type carrier HG52dICP47dICP34.5-hGM-CSF:

I. the total length viral DNA of the reorganization II herpes simplex virus type carrier HG52dICP47d34.5 that obtains of extraction step C5;

Ii. the human granulocyte-macrophage colony stimulating factor expression cassette of cytomegalovirus IE promotor control is inserted into the EcoRV site of the pH2d34.5 plasmid of step B3 acquisition, obtains the pH2d34.5-hGMCSF plasmid;

Iii. the pH2d34.5-hGMCSF plasmid co-transfection bhk cell that reorganization II herpes simplex virus type carrier HG52dICP47d34.5 total length viral DNA that step I is obtained and step I i obtain, the malicious spot expressing human granulocyte-macrophage colony stimutaing factor of the virus of generation homologous recombination;

Iv. select enzyme-linked immunosorbent assay male poison spot, be purified into reorganization II herpes simplex virus type carrier HG52dICP47dICP34.5-hGM-CSF.

Preferably, the preparation method of reorganization II herpes simplex virus type carrier of the present invention may further comprise the steps:

I. the total length viral DNA of the reorganization II herpes simplex virus type HG52dICP47d34.5-GFP that obtains of extraction step C2;

III. the pH2d34.5-hGMCSF plasmid co-transfection bhk cell that reorganization II herpes simplex virus type carrier HG52dICP47d34.5-GFP total length viral DNA that step I is obtained and Step II obtain, take place homologous recombination virus malicious spot expressing human granulocyte-macrophage colony stimutaing factor but do not fluoresce;

IV. select no fluorescence poison spot, be purified into reorganization II herpes simplex virus type carrier HG52dICP47dICP34.5-hGM-CSF.

Further preferably, the preparation method of reorganization II herpes simplex virus type carrier of the present invention also comprises the step that all plasmids that relates to are checked order and take place with the sudden change of confirmation nothing.For the monitoring of plasmid sequence, can guarantee the accuracy of whole preparing carriers process.

Preferably, the present invention also provides a kind of preparation method of the II of reorganization herpes simplex virus type carrier, and wherein, this method may further comprise the steps:

Table 1

Table 2

C ' 2. selects enzyme-linked immunosorbent assay male poison spot, is purified into reorganization II herpes simplex virus type carrier HG52dICP47dICP34.5-hGM-CSF.Further preferably, the preparation method of above-mentioned reorganization II herpes simplex virus type carrier also comprises the step that all plasmids that relates to are checked order and take place with the sudden change of confirmation nothing.

The preparation method of reorganization of the present invention II herpes simplex virus type carrier can adopt the operation of this area routine to finish and extract whole audience DNA, makes up plasmid, processes such as enzyme is cut, homologous recombination, insertion expression cassette, pcr amplification, enzyme-linked immunosorbent assay.

The present invention also provides by the prepared reorganization II herpes simplex virus type carrier of the method for the invention described above.

The present invention also provides a kind of recombinant virus, and described recombinant virus comprises that as the virus of carrier and goal gene wherein, described virus as carrier is reorganization II herpes simplex virus type carrier of the present invention.Herpes simplex virus vector of the present invention not only can act on the cracking killing tumor cell separately, but also can be used as carrier by transmitting goal gene and/or cracking killing tumor cell.Can carry the goal gene of 0.1-50kb as the hsv of the present invention of carrier, preferably carry the goal gene of 2-20kb.Described goal gene can be the gene of anti-tumor activity, one or more in the gene of the gene of the prodrug activator of for example encoding, the gene of codes for tumor arrestin, Codocyte antiapoptotic factors (Pro-apoptotic factors) precursor and the proteic gene of coding immunostimulation.Described immunostimulation albumen can be for self having Cytotoxic albumen, can stimulating/strengthen the albumen of anti-tumor immune response.Certain virus of the present invention also can be used for one or more goal gene are passed in the cell that needs its expression, this cell can be a for example neurocyte of non-tumor cell, described one or more goal gene can be replied or the gene of the polypeptide of relieve chronic pain pain stimulation for coding changes, described polypeptide for example can completely cut off for example albumen of nerve growth factor, other regulating pain neurotrophic factor, neurotrophic factor sample molecule, Substance P and other neural skin.Described one or more goal gene also can stimulate injured nerve regrowth in the degenerative disease or prevent the neural further gene of the polypeptide of sex change for coding.Described goal gene can also comprise regulating and controlling sequence, for example the promotor of described one or more destination gene expressions, terminator and enhanser.Described goal gene can comprise that also marker gene (for example, the gene of coding beta-galactosidase, green fluorescent protein or other fluorescin) or its product regulate the gene of other genetic expression.Described goal gene can also be mRNA, tRNA or rRNA except that being the DNA, can also comprise the associated retroviral regulating and controlling sequence relevant with transcription sequence, for example transcription termination signal, polyadenylation site and downstream enhancer element usually.

The present invention also provides a kind of pharmaceutical composition, and it comprises reorganization II herpes simplex virus type carrier of the present invention and/or recombinant virus of the present invention, and medicine acceptable carrier or vehicle composition.Hsv of the present invention can be used the cracking killing tumor cell separately; Can also be as the preparing carriers recombinant virus, described recombinant virus uses separately by transmitting goal gene and/or cracking killing tumor cell.Preferred pharmaceutical composition of the present invention, by reorganization II herpes simplex virus type carrier of the present invention and/or recombinant virus, and medicine acceptable carrier or vehicle composition.Reorganization II herpes simplex virus type carrier of the present invention and/or recombinant virus can combine with pharmaceutically-acceptable excipients or carrier and form pharmaceutical composition.Medicine acceptable carrier or vehicle refer to nontoxic solid-state, semi-solid state or liquid weighting agent, thinner, coating material or other pharmaceutical adjuncts, for example, include but not limited to salt solution, buffering saline solution, glucose, water, Gan Bo, ethanol and composition thereof.Described pharmaceutical composition is suitable in parenteral, hypogloeeis, the brain pond, in the intravaginal, intraperitoneal, internal rectum, cheek, in the tumour or the epidermis administration.

Parenteral admin comprises that intravenously, intramuscular, intraperitoneal, breastbone are interior, subcutaneous, intra-articular injection and infusion.The pharmaceutical composition that is suitable for parenteral admin comprises sterilized water body lotion or non-aqueous solution, dispersion liquid, suspension or emulsion, and is used for before facing use in sterile injectable solution or dispersion liquid powder formulated.Suitable water-based or non-aqueous carrier, thinner, solvent or vehicle comprise water, ethanol, Gan Bo, propylene glycol, polyoxyethylene glycol, complete methylcellulose gum, vegetables oil and injectable organic enzyme as mooring sour second vinegar.

These compositions can also contain adjuvants such as sanitas, wetting agent, emulsifying agent and dispersion agent.Adding isotonic agent may be favourable as carbohydrate, sodium chloride etc.

The epidermis administration is included on skin, the Mongolian film and in lung and the surperficial administration of eye.Such pharmaceutical composition comprises pulvis, ointment, drops, transdermal patch, Iontophoretic device and inhalation etc.

The composition of rectum or vagina administration is preferably suppository, it can be by being mixed with carrier of the present invention and suitable non-irritating excipient or carrier such as theobroma oil, polyoxyethylene glycol or suppository wax, described vehicle or carrier are solid-state in room temperature, be liquid under body temperature, therefore fusing and discharge active compound in rectum or vaginal canal.

When treating with above-mentioned or other modes, the present invention of treatment significant quantity II herpes simplex virus type carrier of recombinating can be the recombinate independent form of II herpes simplex virus type carrier of the present invention, uses or do not use pharmaceutically-acceptable excipients.The treatment significant quantity refer to suitable therapeutic modality to the treatment tumour the recombinate amount of II herpes simplex virus type carrier of effective the present invention.Concrete treatment effective dose to any particular patient depends on many factors, comprises gentle its severity of the disease of being treated; The activity of used reorganization II herpes simplex virus type carrier; Used particular composition: patient's age, body weight, sex, diet and general health situation; Administration time; Route of administration; The drainage rate of reorganization II herpes simplex virus type carrier; The time length associating of treatment or the other drug of taking simultaneously etc.

Preferred described pharmaceutical composition is an injection liquid, and described injection liquid comprises pharmaceutically acceptable carrier and virus of the present invention and/or recombinant virus, contains 10 in every milliliter of described injection liquid ²-10 ¹⁰The virus plaque forming unit.Described pharmaceutically acceptable carrier is the phosphoric acid buffer of pH value for 4.0-9.0.Described injection liquid also contains protective material and/or osmotic pressure regulator; With described injection liquid is benchmark, and described protectant content is 0.01-30 weight %, and described protective material is selected from one or more in inositol, sorbyl alcohol and the sucrose; It is 200-700 m osmole/kilogram that the content of described osmotic pressure regulator makes the osmotic pressure of described injection liquid, and described osmotic pressure regulator is sodium-chlor and/or Repone K.When using described injection liquid to carry out, the virus quantity scope that gives is 10 ³-10 ¹⁰Virus plaque forming unit (pfu), preferred 10 ⁵-10 ⁸Pfu, more preferably 10 ⁶-10 ⁸Pfu.When injection medicinal compositions of the present invention, the injection consumption can be this area dosage commonly used, 500 microlitres, general 1-200 microlitre, preferred 1-10 microlitre at the most; But, also can use 10 milliliters dosage at the most according to described tumour and inoculation position.Because those skilled in the art can easily determine best route of administration and dosage, so described route of administration and dosage are for reference only.Described dosage can be according to various parameters, especially determine according to the severity and the route of administration of patient's age to be treated, body weight and illness, disease or illness.In addition, be to be injected directly in the tumour for the preferred route of administration of cancer patients.Medicine composition injection of the present invention also can be administered systemically, and also medicine composition injection of the present invention can be expelled to the intravascular administration into tumor feeding.Most preferred route of administration depends on the position and the size of described tumour.

The present invention also provides reorganization II herpes simplex virus type carrier of the present invention and the application of recombinant virus in the genomic medicine of preparation treatment tumour.Preferred described tumour is selected from squamous cell carcinoma, colorectal carcinoma, lymphoma and melanoma.Reorganization II herpes simplex virus type carrier of the present invention can play oncolysis separately, can also carry multiple goal gene as gene therapy medicament.

The classification called after herpes simplex virus I I type HG52 strain of the hsv that the present invention relates to; the Latin formal name used at school is Herps simplex virus type II; Genbank numbers Z86099; can be purchased, for example can buy from culture collection association of Britain healthy protect portion (Health Protection Agency CultureCollections) (Britain HPA).The HG52 whole genome sequence is known.

Further specify the present invention below in conjunction with embodiment, the used reagent of the present invention, substratum are the commercial goods unless stated otherwise.

Embodiment 1

From wild-type HSV-2 (HG52) genome, reject the ICP47 gene, make up HG52dICP47

(1) DNA of purifying HG52 wild-type virus

Cultivate HG52 virus with bhk cell, use DNAzol ^TMGenomic dna separating kit (Helena Biosciences Cat.No.DN127200) purified virus DNA.Bhk cell grown in 175 square centimeters the culturing bottle, nutrient solution is the DMEM that contains 10% foetal calf serum, 1% mycillin.Culture condition is 37 ℃, 5% carbonic acid gas.When cell grows to 90% when saturated, virus inoculation.Continue hatching 24-48 hour, when cytopathy appears in 90% above cell, remove nutrient solution, and add the DNAzol of 10ml.Inhale with the 10ml suction pipe and to blow 5 times and cell pyrolysis liquid is transferred in the Falcon test tube of 50ml, add 100% ethanol of 5ml, shake test tube as circumferential motion lightly, allow viral DNA fully separate out.With suction nozzle DNA is chosen in another test tube, wash one time, with suction nozzle DNA is chosen in the little centrifuge tube again with 70% ethanol.The residual ethanol that exhausts is dissolved in DNA in the 1ml aqua sterilisa, be stored in after the packing-20 ℃ standby.

(2) make up the pdICP47H2 plasmid

The ICP47 gene is positioned at nt147775-148035 in the HG52 genome.Reject the ICP47 gene, need to make up the plasmid that contains ICP47 upstream region of gene flanking region sequence, pterion, downstream side sequence (FLR).Upstream side pterion sequence and downstream trip flanking region sequence are all through pcr amplification.The primer that PCR uses is as follows:

Upstream (US) FLR:nt146554-147775DNA fragment

Forward primer ¹⁴⁶⁵⁵⁴AGAGTCACGACGCATTTGCCC ¹⁴⁶⁵⁷⁴

Reverse primer ¹⁴⁷⁷⁷⁵ATACGATCTCGTCGACCGGGG ¹⁴⁷⁷⁵⁵

Downstream (DS) FLR:nt148033-149211DNA fragment

Forward primer ¹⁴⁸⁰³³CATGGTGTCCCGTCCACGAAG ¹⁴⁸⁰⁵³

Reverse primer ¹⁴⁹²¹¹GGTTCGTGGTAATGAGATGCC ¹⁴⁹¹⁹¹

During PCR (50ul reaction volume) amplification upstream and downstream FLR, all use following reaction conditions

20ng wild-type virus DNA

30mM Tris-HCl(pH9.2)

10mM sal epsom

15mM sodium-chlor

100uM dNTPs

The 50pMol forward primer

The 50pMol reverse primer

1U (enzyme reaction unit) TaqDNA polysaccharase

35 cyclic amplifications, each round-robin temperature and time is: 95 ℃, 60 seconds; 62 ℃, 20 seconds; 72 ℃, 120 seconds.

To go up FLR and downstream FLR is cloned among the pSP73, promptly obtain pdICP47H2 (as shown in Figure 3).

From the pcDNA3CMFGFP plasmid, the EcoRV site with Nru I/Pvu II enzyme downcuts the CMV-GFP-BGHpA fragment and inserts pdICP47H2 obtains pdICP47H2GFP (as shown in Figure 3).

(3) make up the HG52 recombinant virus (HG52dICP47) of rejecting the ICP47 gene

Employed solution and cell:

A, viral DNA, 1 mg/ml is with DNAzol test kit preparation (the same).

B, plasmid DNA 1 mg/ml.

C, Hepes transfection damping fluid, 140mM NaCL, 5mM KCL, 0.75mM Na ₂HPO ₄, 5.5mM D-glucose, 20mM Hepes, pH are 7.05.(0.22 μ m aperture filter membrane normal temperature filtration sterilization)

D, 2M CaCl ₂(filtration sterilization, room temperature preservation)

The bhk cell that the growth of 80-90% density is arranged on E, 6 well culture plates.

F, 1.6% carboxymethyl cellulose (CMC, 121 ℃ of following 20 minutes autoclavings)

Operation steps:

1) gets two aseptic eppendorf test tubes, add the Hepes transfection damping fluid of 400 microlitres therein in one.

2) in another test tube, add 31 microlitre 2M CaCl ₂, 20 microlitre viral DNAs, 8 microlitre plasmid DNA.Behind the mixing, it is slowly joined in the Hepes transfection damping fluid of 400 microlitres gently with pipettor.

3) gently behind the mixing, under room temperature, left standstill 40 minutes.

4) after 40 minutes, in 6 well culture plates, inhale the nutrient solution that removes bhk cell, above-mentioned transfection mixed solution is slowly added in the culture plate, each hole corresponding transfection mixed solution, a 5%CO then ₂, placed 30 minutes in 37 ℃ of incubators.

5) in every hole, add 1 ml cells nutrient solution after 30 minutes, and then Tissue Culture Plate is put back in 37 ℃ of incubators, hatched 5 hours.

6) with Hepes damping fluid preparation 20%DMSO solution, place ice.

7) after 5 hours, remove all nutrient solutions in the culture plate, and clean cell 2 times with 1 milliliter of fresh medium.

8) every hole adds 1 milliliter of 20%DMSO liquid, places 90 seconds under the room temperature.

9) remove 20%DMSO liquid and carefully clean cell 2 times rapidly with fresh medium.

10) add 2 milliliters of fresh cell culture fluids in every hole, put 37 ℃, 5%CO ₂Incubator.Can be observed viral plaque in 48 hours.Culture plate is placed-70 ℃ of refrigerators once frozen.After thawing, harvested cell and nutrient solution.

11) cultivate bhk cell with 6 well culture plates, when treating that cell reaches 70% density, absorb nutrient solution and every hole adding 1ml serum-free medium, every then hole adds 0.1 or 10 microlitres results liquid and covers the CMC of 2ml: complete culture solution (2: 5).Cultivate two days later, under the microscope direct-view, have the viral plaque of green fluorescence with 20 microlitre liquid-transfering gun pickings, be the HG52 recombinant virus of having rejected the ICP47 gene (HG52dICP47-GFP, as shown in Figure 4).Choose spot purification of Recombinant virus through 5 times, cultivate virus with foregoing method again and virus genom DNA is extracted in preparation.

12) with the HG52dICP47-GFP viral DNA of purifying with pdICP47H2 plasmid DNA transfection bhk cell, the GFP on the HG52dICP47-GFP is disallowable after recombinating, and obtains HG52dICP47 recombinant virus (as shown in Figure 5).This takes turns not green-emitting fluorescence of viral plaque that recombinant virus forms, thus select the viral plaque of no green fluorescence, through 5 times choose the spot purifying, carry out the cultivation of recombinant virus and the extraction of viral DNA then.

Reject the ICP34.5 gene, make up HG52dICP47dICP34.5-hGM-CSF

(1) makes up the pH2d34.5 plasmid.

Pcr amplification goes out pterion, ICP34.5 upstream region of gene flanking region sequence downstream side sequence (FlankingRegion is called for short FLR).Used PCR primer sequence sees the following form 2.

Table 2

20ng wild-type virus DNA

30mM Tris-HCl(pH9.2)

10mM sal epsom

15mM sodium-chlor

100uM dNTPs

The 50pMol forward primer

The 50pMol reverse primer

1U (enzyme reaction unit) TaqDNA polysaccharase

At first, the PCR product of upstream FLR is inserted into the PvuII/XbaI site of pSP72 plasmid, obtains pSP72H2d34.5US.The PCR product of downstream FLR then is inserted into the EcoRV/BglII site of pSP72H2d34.5US, obtains containing the pH2d34.5 of ICP34.5 gene upstream and downstream flanking region sequence.At last, the EcoRV site with the GFP expression cassette or the hGM-CSF expression cassette of CMV IE promotor control is inserted into pH2d34.5 obtains pH2d34.5-GFP or pH2d34.5-hGMCSF.The structure of pH2d34.5 and related plasmid is seen Fig. 6.All plasmids all confirm not have sudden change through sequential analysis.

Prepare the bhk cell of 80-90% density with 6 well culture plates.

In above-mentioned HG52dICP47 viral DNA and the common transfection bhk cell of pH2d34.5-GFP plasmid DNA, through homologous recombination, the GFP expression cassette has been replaced the ICP34.5 gene, makes the malicious spot green-emitting fluorescence of recombinant virus.Through 5 plaque purifications of taking turns, select green fluorescence poison spot, just can purification of Recombinant virus (HG52dICP47d34.5GFP, as shown in Figure 7).

Cultivate HG52dICP47d34.5GFP with bhk cell, and extract viral DNA.

Change the DNA and the pH2d34.5-hGMCSF plasmid DNA of HG52dICP47d34.5-GFP virus over to bhk cell, through homologous recombination, hGM-CSF has changed the GFP gene, and the malicious spot that makes new recombinant virus is green-emitting fluorescence not.Through 5 plaque purifications of taking turns, select no fluorescence poison spot, just can purification of Recombinant virus (HG52dICP47d34.5-hGM-CSF, as shown in Figure 8).

Recombinant virus (HG52dICP47d34.5-hGM-CSF) finally obtains 10 through cultivating amplification ¹⁰The recombinant viral vector solution of pfu, solvent are the DMEM substratum.

Comparative Examples 1

The I herpes simplex virus type carrier that the method for putting down in writing according to CN 1283803C obtains, this carrier is with ICP47, ICP34.5 in the wild-type I herpes simplex virus type and the gene knockout of ICP6.

Embodiment 2

Present embodiment illustrates pharmaceutical composition of the present invention.

The preparation of injection liquid will be prepared one group of phosphate buffered saline buffer respectively according to the dosage shown in the table 3, sterilize 20 minutes down for 121 ℃.Under aseptic condition, hsv stoste with 0.45 micron filtering with microporous membrane embodiment 1 known titre, remove cell debris, collect filtrate to aseptic centrifuge tube, 8000 rev/mins centrifugal 1 hour, supernatant discarded is according to the virus titer shown in the table 3, gained virus precipitation is dispersed in the phosphoric acid buffer behind the above-mentioned high-temperature sterilization, promptly gets injection liquid of the present invention.

Table 3

Medicine	Prescription 1	Prescription 2	Prescription 3	Prescription 4
					Phosphoric acid buffer (mol)	0.21	0.13	0.15	0.10
Inositol (weight %)	4.2	3.8	3.5	4.0
					Sorbyl alcohol (weight %)	1.8	1.5	2.5	2.0
Sucrose (weight %)	0.2	0.5	1.3	1.0
					Osmotic pressure regulator and concentration thereof (weight %)	Sodium-chlor 0. 9	Repone K 0. 5	Sodium-chlor 0. 9	Sodium-chlor 0. 9
Osmotic pressure (m osmole/kilogram)	500	550	450	600
					Virus titer (pfu/ml)	10 ⁶	10 ⁷	10 ⁵	10 ⁸

Embodiment 3

The recombinate toxicity test of II herpes simplex virus type carrier of the present invention:

40 free drinking waters of 4-6 week Balb/c mouse in age adapt to a week, divide four groups at random, every group each 10.Four groups of mouse are respectively at intraperitoneal injection DMEM nutrient solution, 10 ⁸PFU (viral plaque forming unit) embodiment 1 recombinant viral vector (HG52dICP47d34.5-hGM-CSF), 10 ⁸PFU Comparative Examples 1 or 10 ³PFU wild-type virus (HG52wt).Each 0.1ml of volume injected, wherein the solvent of viral solution is the DMEM nutrient solution.Observe toxicity, the number of mice of every group of survival of 4 week back statistics the results are shown in Table 4.The result shows that recombinant viral vector of the present invention is compared with wild-type virus, and toxicity greatly reduces; Suitable with the carrier of existing Comparative Examples.

Table 4: the toxicity of recombinant viral vector of the present invention and wild-type virus relatively

	DMEM	Embodiment 1	Comparative Examples 1	Wild-type virus
					Surviving animals number (only)	10	10	10	3

Embodiment 4

The recombinate pharmacodynamic experiment of II herpes simplex virus type carrier of the present invention

Oncolytic effect in the foundation of several animal models for tumour and the body of recombinant viral vector of the present invention:

The Balb/c nude mice, age in 4-6 week, the 16-20 gram, female, available from Chinese Academy of Medical Sciences's Experimental Animal Center.Select squamous cell carcinoma, colorectal carcinoma, lymphoma and melanoma cell respectively, it is subcutaneous to be inoculated into nude mice right side armpit with trochar.Every subcutaneous injection 10 of mouse flank ⁵Oncocyte, when knurl piece diameter is about 0.5-0.7 centimetre (injection back the 10th day), divide 3 groups (1 group of No. 4, the present invention prescription, 1 group of Comparative Examples, blank groups) at random, 10 every group begin with embodiment 2 virus injection liquid of the present invention and Comparative Examples 1, phosphoric acid buffer.In the 1st day, the 4th day and the 7th day intratumor injection, volumetric injection was 100 microlitres.The dosage of virus of the present invention is 2.5 * 10 ⁸Pfu/kg, Comparative Examples 1 also is 2.5 * 10 ⁸Pfu/kg, negative control medicine are and the isopyknic phosphoric acid buffer of virus injection liquid of the present invention.After the last administration, measure the observed gross tumor volume of animal body surface energy weekly, observed for 6 weeks, animal is put to death in the neck dislocation then, the results are shown in Table 5, and the diameter of tumor size is a millimeter.

Table 5: tumor killing effect in the body of recombinant viral vector of the present invention

Recombinant viral vector of the present invention all has tangible tumor killing effect to above-mentioned 4 kinds of tumours.The sustainable growth of control group tumour, diameter of tumor can reach more than 1.5 centimetres after 3 weeks.The tumour of embodiment 2 treatment groups is being dwindled after 3 weeks, is then significantly being dwindled after 6 weeks.And the result of treatment of embodiment 2 is significantly better than Comparative Examples 1.

Claims

1. a reorganization II herpes simplex virus type carrier is characterized in that described carrier has been rejected the ICP34.5 gene and the ICP47 gene of wild II herpes simplex virus type HG52 strain.

2. reorganization II herpes simplex virus type carrier according to claim 1, wherein, described carrier has inserted the human granulocyte-macrophage colony stimulating factor expression cassette on the position of disallowable ICP34.5 gene.

3. preparation method of II herpes simplex virus type carrier that recombinates is characterized in that this method may further comprise the steps:

Table 1

Table 2

C4. the pH2d34.5 plasmid co-transfection bhk cell that the total length viral DNA of the reorganization II herpes simplex virus type HG52dICP47d34.5-GFP that step C3 is obtained and step B3 obtain, the egfp expression box generation homologous recombination on the reorganization II herpes simplex virus type HG52dICP47d34.5GFP is disallowable;

4. the preparation method of reorganization II herpes simplex virus type carrier according to claim 3 is characterized in that this method may further comprise the steps:

5. the preparation method of reorganization II herpes simplex virus type carrier according to claim 3 is characterized in that this method may further comprise the steps:

6. according to the preparation method of any described reorganization II herpes simplex virus type carrier among the claim 3-5, it is characterized in that described method also comprises the step that all plasmids that relates to are checked order and take place with the sudden change of confirmation nothing.

7. preparation method of II herpes simplex virus type carrier that recombinates is characterized in that this method may further comprise the steps:

Table 1

Table 2

B ' 4. is inserted into human granulocyte-macrophage colony stimulating factor (hGM-CSF) expression cassette of cytomegalovirus IE promotor control the EcoRV site of the pH2d34.5 plasmid of step B ' 3 acquisitions, obtains the pH2d34.5hGM-CSF plasmid;

8. the preparation method of reorganization II herpes simplex virus type carrier according to claim 7 is characterized in that described method also comprises the step that all plasmids that relates to are checked order and take place with the sudden change of confirmation nothing.

9. a reorganization II herpes simplex virus type carrier is characterized in that described carrier is by the prepared reorganization II herpes simplex virus type carrier of any described method among the claim 3-8.

10. recombinant virus, described recombinant virus comprises as the virus of carrier and goal gene, it is characterized in that, described virus as carrier is any described reorganization II herpes simplex virus type carrier in claim 1-2 and 9.

11. a pharmaceutical composition, described composition comprise any described reorganization II herpes simplex virus type carrier and/or the described recombinant virus of claim 10 in claim 1-2 and 9, and medicine acceptable carrier or vehicle.

12. pharmaceutical composition according to claim 11, wherein, described pharmaceutical composition is an injection liquid, described injection liquid comprises any described reorganization II herpes simplex virus type carrier and/or the described recombinant virus of claim 10 in pharmaceutically acceptable carrier and claim 1-2 and 9, contains 10 in every milliliter of described injection liquid ²-10 ¹⁰The described virus and/or the recombinant virus of virus plaque forming unit.

13. pharmaceutical composition according to claim 12, wherein, described pharmaceutically acceptable carrier is the phosphoric acid buffer of pH value for 4.0-9.0.

14. pharmaceutical composition according to claim 12, wherein, described injection liquid also contains protective material and/or osmotic pressure regulator; With described injection liquid is benchmark, and described protectant content is 0.01-30 weight %, and described protective material is selected from one or more in inositol, sorbyl alcohol and the sucrose; It is 200-700 m osmole/kilogram that the content of described osmotic pressure regulator makes the osmotic pressure of described injection liquid, and described osmotic pressure regulator is sodium-chlor and/or Repone K.

15. any described reorganization II herpes simplex virus type carrier and the application of the described recombinant virus of claim 10 in the genomic medicine of preparation treatment tumour in root claim 1-2 and 9.