CN101376892A - Herpes simplex virus vector, recombinant virus, host cell and pharmaceutical composition thereof - Google Patents

Abstract

The invention provides a herpes simplex virus carrier which is separated from the yellow race and lacks one or more than one gene of the gene of coded infection cell multi-peptide 34.5, the gene of coded infection cell multi-peptide 6 and the gene of coded infection cell multi-peptide 47; the virus carrier has high specificity infection rate to the host cells of the yellow race with high reproduction speed and low toxicity, so the virus carrier can be directly used for injecting and dissolving the tumor cells of the yellow race, and carry genomic medicine into the cells of the yellow race to have gene therapy.

Description

Herpes simplex virus vector and recombinant virus and host cell and pharmaceutical composition thereof

Technical field

The invention relates to a kind of virus vector, comprise this virus vector recombinant virus, comprise the host cell of described virus vector and/or described recombinant virus, and the pharmaceutical composition that comprises described virus vector and/or described recombinant virus.Specifically, the invention relates to a kind of herpes simplex virus vector, comprise this virus vector recombinant virus, comprise the host cell of described virus vector and/or described recombinant virus, and the pharmaceutical composition that comprises described virus vector and/or described recombinant virus.

Background technology

Hsv (Herpes simplex virus, HSV) spherical in shape, be made up of core, capsid, tunicle (Tegument) and cyst membrane by complete hsv.This viral core contains double-stranded DNA, is wound in the fibril spool.Capsid is the icosahedron symmetry, and diameter is about 100 nanometers, is made up of 162 shell particulates.Capsid is covered by the tunicle of gage distortion.The virus outermost layer is typical double-layer of lipoid cyst membrane.The viral diameter that comprises cyst membrane is the 150-200 nanometer.Viral glycoprotein B (gB), viral glycoprotein C (gC), viral glycoprotein D (gD), viral glycoprotein G (gG) and viral glycoprotein M (gM) are contained in the cyst membrane surface.Hsv comprise the I herpes simplex virus type (Herpes SimplexVirus Type I, HSV-1) and the II herpes simplex virus type.This virus is relevant with the three-dimensional arrangement of hsv membrane glycoprotein to the infection ability of host cell, and promptly can the three-dimensional arrangement of membrane glycoprotein have determined virus enter host cell, and the virus titer that can enter host cell.

Because hsv can be with the human cell as host cell, and human cell's type that can infect is wide, the propagation that meets accident can use the prevention of herpes medicine, burst times and latent period all unconformability host cell gene group to insert sudden change danger little, therefore, hsv has been used for the gene therapy of tumour or nervous system degenerative disease.For example, I herpes simplex virus type F strain HSV1716 is used for the treatment of cerebral glioma (referring to " HSV1716 injection into the brain adjacent to tumourfollowing surgical resection of high-grade glioma:safety data and long-termsurvival ", people such as S.Harrow, Gene Therapy, 11,1648-1658,2004); I herpes simplex virus type 17+ strain infected tumor cell is treated cancer by this viral lytic replication dissolving tumour cell.In addition, coding infected cell polypeptides 34.5 (the infected cellpolypeptides of hsv, ICP34.5) gene, the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47 is proved the human normal cell harmful but do not influence the propagation of hsv in tumour cell respectively, therefore can be by knocking out one or several preparation herpes simplex virus vector in described three genes (referring to " Mapping of herpes simplex virus-1 neurovirulence togamma 1 34.5; a gene nonessential for growth in culture ", people such as J Chou, Science, Vol 250, Issue 4985,1262-1266, September nineteen ninety; Treatment of Malignant GliomasUsing Ganciclovir-hypersensitive, Ribonucleotide Reductase-deficient HerpesSimplex Viral Mutant, people such as Toshihiro Mineta, Cancer Research 54,3963-3966, in August, 1994; And CN 1283803C).Described herpes simplex virus vector can be with the form infected tumor cell of empty carrier, by the rapid propagation killing tumor cell of virus vector; Also can carry antitumor foreign gene (for example granulocyte-macrophage colony-stimulating factor), by virus vector propagation and the expression of foreign gene in tumour cell, killing tumor cell.

Yet, the I herpes simplex virus type genome that infects different ethnic groups has visibly different restriction enzyme resolution model, promptly there is restriction fragment length polymorphism (restriction fragment lengthpolymorphism, RFLP) (referring to " Quantitative analysis of genomic polymorphismof herpes simplex virus type 1 strains from six countries:studies of molecularevolution and molecular epidemiology of the virus ", people such as H.Sakaoka, Journal ofGeneral Virology, Vol 75,513-527,1994), herpes simplex virus 1 7+ strain separates from the white race, therefore, the white race's I herpes simplex virus type 17+ strain will be easy to infect, knock out the gene of coding infected cell polypeptides 34.5, the carrier of one or several back gained in the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47, when being used for that the anthous carried out gene therapy, exist viral infection rate low, in host cell, duplicate the slow shortcoming of rate of propagation.

Summary of the invention

First purpose of the present invention is the gene that overcomes existing disappearance coding infected cell polypeptides 34.5, viral infection rate was low when the herpes simplex virus vector of one or several gene in the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47 was used for anthous's gene therapy, in host cell, duplicate the slow shortcoming of rate of propagation, a kind of gene that lacks coding infected cell polypeptides 34.5 is provided, the herpes simplex virus vector of one or several gene in the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47, when this virus vector is used for anthous's gene therapy, the viral infection rate height, it is fast to duplicate rate of propagation in host cell.

Second purpose of the present invention provides the recombinant virus that comprises above-mentioned virus vector.

The 3rd purpose of the present invention provides the host cell that comprises above-mentioned virus vector and/or above-mentioned recombinant virus.

The 4th purpose of the present invention provides a kind of pharmaceutical composition that comprises above-mentioned virus vector and/or above-mentioned recombinant virus.

The present inventor knocks out the gene of coding infected cell polypeptides 34.5 at the I herpes simplex virus type 17+ strain that is easy to infect the white race, the carrier of one or several back gained in the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47, when being used for that the anthous carried out gene therapy, exist viral infection rate low, in host cell, duplicate the slow shortcoming of rate of propagation, from Chinese's bicker bleb of growing up, isolate hsv (classification called after herpes simplex virus I-type, the Latin formal name used at school is Herpes Simplex Virus Type I, in preservation on June 14 in 2006 to China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) that is positioned at the No. 13, North No.1 Row, Zhongguancun, Haidian District, Beijing City, deposit number is CGMCC No.1736), and this virus carried out genome complete sequence determination and analysis, determined the difference that this clinical separation strain and I herpes simplex virus type 17+ strain exist aspect the gene of coding envelope protein.And the present inventor also knocked out one or several gene in the gene of the gene of gene, coding infected cell polypeptides 6 of hsv coding infected cell polypeptides 34.5 and coding infected cell polypeptides 47, obtains the herpes simplex virus vector that toxicity is low, can carry more goal gene.

The invention provides a kind of herpes simplex virus vector, the gene of described virus vector disappearance coding infected cell polypeptides 34.5, one or several gene in the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47, described virus vector has envelope protein, wherein, described envelope protein comprises a kind of aminoacid sequence that this virus vector of promotion infects the host cell function that has, described aminoacid sequence is selected from the aminoacid sequence shown in the SEQ ID:NO.1, aminoacid sequence shown in the SEQ ID:NO.3, aminoacid sequence shown in the SEQ ID:NO.5, aminoacid sequence shown in the SEQ ID:NO.7, aminoacid sequence shown in the SEQ ID:NO.9, and to described SEQ ID:NO.1, SEQ ID:NO.3, SEQ ID:NO.5, aminoacid sequence shown in SEQ ID:NO.7 or the SEQ ID:NO.9 carries out one or several aminoacid replacement, add or disappearance and having of obtaining promote virus vector to infect one or more in the aminoacid sequence of host cell function.

The present invention also provides a kind of herpes simplex virus vector, the gene of described virus vector disappearance coding infected cell polypeptides 34.5, one or several gene in the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47, described virus has the gene of coding envelope protein, wherein, described envelope protein comprises a kind of aminoacid sequence that this virus vector of promotion infects the host cell function that has, described aminoacid sequence is selected from the aminoacid sequence shown in the SEQ ID:NO.1, aminoacid sequence shown in the SEQ ID:NO.3, aminoacid sequence shown in the SEQ ID:NO.5, aminoacid sequence shown in the SEQ ID:NO.7, aminoacid sequence shown in the SEQ ID:NO.9, and to described SEQ ID:NO.1, SEQ ID:NO.3, SEQ ID:NO.5, aminoacid sequence shown in SEQ ID:NO.7 or the SEQ ID:NO.9 carries out one or several aminoacid replacement, add or disappearance and having of obtaining promote virus vector to infect one or more in the aminoacid sequence of host cell function.

The present invention also provides a kind of recombinant virus, and described recombinant virus comprises virus vector and goal gene, and wherein, described virus vector is a herpes simplex virus vector of the present invention.

The present invention also provides a kind of infection virulent host cell, and wherein, described virus is virus vector provided by the invention and/or recombinant virus.

The present invention also provides a kind of pharmaceutical composition, and wherein, described pharmaceutical composition comprises virus vector provided by the invention and/or recombinant virus.

The invention provides the herpes simplex virus vector of one or several gene of a kind of separation in the gene of the gene of the anthous and disappearance coding infected cell polypeptides 34.5, the gene of coding infected cell polypeptides 6 and the infected cell polypeptides 47 of encoding, this virus vector is for the specificity infection rate height of anthous's host cell, reproduction speed is fast, toxicity is low, therefore can be directly used in and infect and dissolve xanthous tumour cell, also can be used as virus vector and carry genomic medicine and to anthous's cell, carry out gene therapy.In addition, with existing separate from white ethnic group and knock out the gene of gene, coding infected cell polypeptides 6 of coding infected cell polypeptides 34.5 and the gene of coding infected cell polypeptides 47 in the I herpes simplex virus type 17+ strain vector that obtains of one or several gene compare, when virus vector of the present invention is used for other ethnic groups pilosity tumour cells, stronger to the dissolving power of tumour cell.

The classification called after herpes simplex virus I-type of the hsv that the present invention relates to, the Latin formal name used at school is Herpes Simplex Virus Type I, to China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) that is positioned at the No. 13, North No.1 Row, Zhongguancun, Haidian District, Beijing City, deposit number was CGMCC No.1736 in preservation on June 14 in 2006.

Description of drawings

Fig. 1 is the electron micrograph (amplifying 52000 times) that the present invention relates to hsv;

Fig. 2 is the growing state optical microscope photograph (amplifying 400 times) that normal human mammary cancerous cell line MCF-7 cultivated 96 hours;

Fig. 3 is for cultivating MCF-7 cell after 48 hours, is to cultivate 48 hours growing state optical microscope photograph (amplifying 400 times) again after the 0.1 transfection virus of the present invention by the ratio (MOI) of virus activity particle/cell count;

Fig. 4 is that virus vector of the present invention is to the inhibiting drug effect photo of human colon adenocarcinoma HT-29 transplanted tumor in nude mice;

Fig. 5 is that virus vector of the present invention is to the inhibiting curve of adenocarcinoma of colon HT-29 transplanted tumor in nude mice;

Fig. 6 is for expressing the KB cell of the green fluorescence protein gene that is carried by virus vector of the present invention.

Embodiment

The invention provides a kind of herpes simplex virus vector, the gene of described virus vector disappearance coding infected cell polypeptides 34.5, one or several gene in the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47, described virus vector has envelope protein, wherein, described envelope protein comprises a kind of aminoacid sequence that the promotion virus vector infects the host cell function that has, described aminoacid sequence is selected from the aminoacid sequence shown in the SEQ ID:NO.1, aminoacid sequence shown in the SEQ ID:NO.3, aminoacid sequence shown in the SEQ ID:NO.5, aminoacid sequence shown in the SEQ ID:NO.7, aminoacid sequence shown in the SEQ ID:NO.9, and to described SEQ ID:NO.1, SEQ ID:NO.3, SEQ ID:NO.5, aminoacid sequence shown in SEQ ID:NO.7 or the SEQ ID:NO.9 carries out one or several aminoacid replacement, add or disappearance and having of obtaining promote virus vector to infect one or more in the aminoacid sequence of host cell function.

Described envelope protein is generally glycoprotein, to infect host cell relevant with virus vector, for example viral glycoprotein B (gB), viral glycoprotein C (gC) and viral glycoprotein D (gD) all with adsorb/to penetrate host cell relevant, they also can induce host cell to merge, and the effect that induces the host cell neutralizing antibody is all arranged; Viral glycoprotein B (gB), viral glycoprotein C (gC), viral glycoprotein D (gD), viral glycoprotein G (gG) and viral glycoprotein M (gM) can both induce cytotoxicity.Because the envelope protein of herpes simplex virus vector of the present invention, the viral glycoprotein B shown in the SEQ ID:NO.1 for example, viral glycoprotein C shown in the SEQ ID:NO.3, viral glycoprotein D shown in the SEQ ID:NO.5, among the viral glycoprotein M shown in viral glycoprotein G shown in the SEQ ID:NO.7 and the SEQ ID:NO.9 one or more, with wild-type herpes simplex virus 1 7+ knock out the coding infected cell polypeptides 34.5 gene, the corresponding envelope protein of the virus vector that one or several gene in the gene of the gene of coding infected cell polypeptides 6 and the infected cell polypeptides 47 of encoding obtains is compared, variation has taken place, the corresponding target of the three-dimensional arrangement of envelope protein and host cell (for example cell surface receptor) is more identical, therefore especially the virus vector of anthous's host cell is more to enter host cell, thereby the viral vector infection rate is obviously improved.

20 seed amino acid residues of constitutive protein matter can be divided into four classes according to side chain polarity: 1, nonpolar amino acid: as L-Ala (Ala), Xie Ansuan (Val), leucine (Leu), Isoleucine (Ile), methionine(Met) (Met), phenylalanine (Phe), tryptophane (Trp) and proline(Pro) (Pro); 2, the uncharged amino acid of polarity: as glycine (Gly), Serine (Ser), Threonine (Thr), halfcystine (Cys), aspartic acid (Asn), glutamine (Gln) and tyrosine (Tyr); 3, positively charged amino acid: as arginine (Arg), Methionin (Lys) and Histidine (His); 4, electronegative amino acid: as aspartic acid (Asp) and L-glutamic acid (Glu) (referring to " biological chemistry " (second edition) first volume, Shen is with, Wang Jingyan, 82-83 page or leaf, Higher Education Publishing House, December nineteen ninety).If belonging to the amino-acid residue of a classification in the protein together replaces, for example replace Lys or replace Ile by Leu by Arg, described residue role in protein domain does not change as the effect that positive charge is provided or forms hydrophobic capsule bag constructions, therefore can't exert an influence to proteinic three-dimensional arrangement, therefore still can realize proteinic function.For example, as well known to those skilled in the art, Ala and Ser, Val and Ile, Asp and Glu, Ser and Thr, Ala and Gly, Ala and Thr, Ser and Asn, Ala and Val, Ser and Gly, Tyr and Phe, Ala and pro, Lys and Arg, Asp and Asn, Leu and Ile, Leu and Val, Ala and Glu and Asp and Gly, replace mutually between any two, can not influence proteinic three-dimensional arrangement and function.The described amino-acid residue replacement that belongs to a classification together can occur on any one amino acid residue position of above-mentioned envelope protein.On the contrary, different classes of amino-acid residue replaces, and proteinic structure is changed, and difference appears in function.For example knock out the gene of coding infected cell polypeptides 34.5 with herpes simplex virus 1 7+, the virus vector that one or several gene in the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47 obtains relatively, different classes of replacement has taken place because of the base of membrane glycoprotein in herpes simplex virus vector of the present invention, the 79th amino acids residue as the viral glycoprotein B of herpes simplex virus 1 7+ carrier is a Methionin, therefore and the 79th amino acids residue of the viral glycoprotein B of herpes simplex virus vector of the present invention is a Threonine, the herpes simplex virus vector of the present invention easy infection anthous more.

To the aminoacid sequence shown in the described SEQ ID:NO.1 carry out one or several aminoacid replacement and obtain have the aminoacid sequence that promotes virus vector to infect the host cell function and can be selected from the 79th aminoacid sequence among the SEQID:NO.1 for Serine, halfcystine, l-asparagine, glutamine, tyrosine or glycine.To the aminoacid sequence shown in the described SEQ ID:NO.3 carry out one or several aminoacid replacement and having of obtaining promote virus vector infect the host cell function aminoacid sequence can among the SEQ ID:NO.3 the 201st among the aminoacid sequence of L-glutamic acid and/or the SEQ ID:NO.3 the 295th be Methionin or arginic aminoacid sequence.To the aminoacid sequence shown in the described SEQ ID:NO.5 carry out one or several aminoacid replacement and having of obtaining promote virus vector infect the host cell function aminoacid sequence can among the SEQ ID:NO.5 the 369th be Methionin or arginic aminoacid sequence.To the aminoacid sequence shown in the described SEQ ID:NO.7 carry out one or several aminoacid replacement and obtain have the aminoacid sequence that promotes virus vector to infect the host cell function and can be selected among the SEQ ID:NO.7 the 3rd and be L-Ala, Xie Ansuan, leucine, Isoleucine, methionine(Met), the aminoacid sequence of phenylalanine or tryptophane, the 86th is the aminoacid sequence of aspartic acid among the SEQ ID:NO.7, the 116th is Serine among the SEQ ID:NO.7, Threonine, halfcystine, l-asparagine, the aminoacid sequence of glutamine or tyrosine, the 118th is the aminoacid sequence of aspartic acid among the SEQ ID:NO.7, the 130th is L-Ala among the SEQ ID:NO.7, Xie Ansuan, leucine, Isoleucine, methionine(Met), the aminoacid sequence of phenylalanine or tryptophane, the 151st is glycine among the SEQ ID:NO.7, Threonine, halfcystine, l-asparagine, the aminoacid sequence of glutamine or tyrosine, the 153rd is the aminoacid sequence of aspartic acid among the SEQ ID:NO.7, the 162nd is glycine among the SEQ ID:NO.7, Serine, Threonine, halfcystine, the aminoacid sequence of l-asparagine or tyrosine, the 164th is L-Ala among the SEQ ID:NO.7, Xie Ansuan, leucine, Isoleucine, methionine(Met), the aminoacid sequence of phenylalanine or tryptophane, the 208th is Xie Ansuan among the SEQID:NO.7, leucine, Isoleucine, methionine(Met), the aminoacid sequence of phenylalanine or tryptophane and the 236th are L-Ala, Xie Ansuan, leucine, Isoleucine, methionine(Met), in the aminoacid sequence of phenylalanine or tryptophane one or more.To the aminoacid sequence shown in the described SEQID:NO.9 carry out one or several aminoacid replacement and having of obtaining promote virus vector infect the host cell function aminoacid sequence can among the SEQ ID:NO.9 the 440th be L-Ala, Xie Ansuan, leucine, Isoleucine, methionine(Met), the 446th is glycine among the aminoacid sequence of phenylalanine or tryptophane and/or the SEQ ID:NO.9, Serine, Threonine, halfcystine, the aminoacid sequence of glutamine or tyrosine.

Aminoacid sequence of the present invention is preferably selected from one or more in the aminoacid sequence shown in aminoacid sequence shown in the aminoacid sequence shown in the aminoacid sequence shown in the aminoacid sequence shown in the SEQ ID:NO.1, the SEQID:NO.3, the SEQ ID:NO.5, the SEQ ID:NO.7 and the SEQ ID:NO.9.More preferably described aminoacid sequence is the aminoacid sequence shown in aminoacid sequence shown in the aminoacid sequence shown in the aminoacid sequence shown in the aminoacid sequence shown in the SEQ ID:NO.1, the SEQ ID:NO.3, the SEQ ID:NO.5, the SEQ ID:NO.7 and the SEQ ID:NO.9.

The present invention also provides a kind of herpes simplex virus vector, the gene of described virus vector disappearance coding infected cell polypeptides 34.5, one or several gene in the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47, described virus vector has the gene of coding envelope protein, wherein, described envelope protein comprises a kind of aminoacid sequence that the promotion virus vector infects the host cell function that has, described aminoacid sequence is selected from the aminoacid sequence shown in the SEQ ID:NO.1, aminoacid sequence shown in the SEQ ID:NO.3, aminoacid sequence shown in the SEQ ID:NO.5, aminoacid sequence shown in the SEQ ID:NO.7, aminoacid sequence shown in the SEQ ID:NO.9, and to described SEQ ID:NO.1, SEQ ID:NO.3, SEQ ID:NO.5, aminoacid sequence shown in SEQ ID:NO.7 or the SEQ ID:NO.9 carries out one or several aminoacid replacement, add or disappearance and having of obtaining promote virus vector to infect one or more in the aminoacid sequence of host cell function.

As well known to those skilled in the art, in 20 kinds of different amino acid of constitutive protein matter, except that Met (ATG) or Trp (TGG) were respectively single password coding, other 18 seed amino acids were respectively by 2-6 codon encode (Sambrook etc., molecular cloning, press of cold spring harbor laboratory, New York, the U.S., second edition, 1989, see 950 pages of appendix D).Promptly because the degeneracy of genetic codon determines more than one mostly of an amino acid whose codon, and the displacement of the 3rd Nucleotide often can not change amino acid whose composition in the triplet codon, the nucleotide sequence of the same protein of therefore encoding can be different.Those skilled in the art are according to known password sublist, from aminoacid sequence disclosed by the invention, and promote virus vector to infect the aminoacid sequence of host cell function by having of obtaining of described aminoacid sequence, can derive their nucleotide sequence of to encode fully, nucleotide sequence as described in obtaining by biological method (as PCR method, mutation method) or chemical synthesis process, be applied in the middle of recombinant technology and the gene therapy, so this partial nucleotide sequence all should be included in the scope of the present invention.Identical reason, utilize dna sequence dna disclosed herein, also can be by means commonly known in the art, for example method (molecular cloning, the press of cold spring harbor laboratory of Sambrook etc., New York, the U.S., second edition, 1989) carry out, by revising nucleotide sequence provided by the invention, obtain and the consistent aminoacid sequence of envelope protein function of the present invention.

The gene of preferred described coding envelope protein comprises that a kind of coding has the nucleotide sequence that the promotion virus vector infects the aminoacid sequence of host cell function, described nucleotide sequence is selected from the nucleotide sequence shown in the SEQ ID:NO.2, nucleotide sequence shown in the SEQ ID:NO.4, nucleotide sequence shown in the SEQ ID:NO.6, nucleotide sequence shown in the SEQ ID:NO.8, nucleotide sequence shown in the SEQ ID:NO.10, and to described SEQ ID:NO.2, SEQ ID:NO.4, SEQ ID:NO.6, nucleotide sequence shown in SEQ ID:NO.8 or the SEQ ID:NO.10 carries out that one or several Nucleotide replaces and in the constant nucleotide sequence of the proteins encoded that obtains one or more.Wherein, the nucleotide sequence shown in the described SEQ ID:NO.2 is carried out that one or several Nucleotide replaces and the constant nucleotide sequence of proteins encoded that obtains can be selected among the SEQ ID:NO.2 the 144th and is the nucleotide sequence of cytosine(Cyt) (C), the 183rd is VITAMIN B4 (A) among the SEQ ID:NO.2, the nucleotide sequence of guanine (G) or thymus pyrimidine (T), the 186th is A among the SEQ ID:NO.2, the nucleotide sequence of G or T, the 210th is the nucleotide sequence of A among the SEQ ID:NO.2, the 219th is the nucleotide sequence of G among the SEQ ID:NO.2, the 237th is A among the SEQ ID:NO.2, the nucleotide sequence of T or C, the 865th is the nucleotide sequence of T among the SEQ ID:NO.2, the 867th is A among the SEQ ID:NO.2, the nucleotide sequence of T or C, the 1161st is A among the SEQ ID:NO.2, the nucleotide sequence of T or G, the 1410th is T among the SEQ ID:NO.2, the nucleotide sequence of G or C, the 1513rd is the nucleotide sequence of A among the SEQ ID:NO.2, the 1515th is A among the SEQ ID:NO.2, the nucleotide sequence of T or C, the 2095th is T among the SEQ ID:NO.2, the nucleotide sequence of G or C, the 2097th is T among the SEQ ID:NO.2, the nucleotide sequence of G or C, the 2196th is the nucleotide sequence of T among the SEQID:NO.2, the 2530th is the nucleotide sequence of T among the SEQ ID:NO.2, the 2532nd is A among the SEQ ID:NO.2, the 2562nd is A among the nucleotide sequence of T or C and the SEQ ID:NO.2, in the nucleotide sequence of T or C one or more.Nucleotide sequence shown in the described SEQ ID:NO.4 is carried out that one or several Nucleotide replaces and the constant nucleotide sequence of proteins encoded that obtains can be selected among the SEQ ID:NO.4 the 120th and is G, the nucleotide sequence of T or C, the 177th is the nucleotide sequence of G among the SEQ ID:NO.4, the 267th is the nucleotide sequence of G among the SEQ ID:NO.4, the 597th is the nucleotide sequence of T among the SEQ ID:NO.4, the 865th is the nucleotide sequence of A among the SEQ ID:NO.4, the 867th is T among the SEQ ID:NO.4, the nucleotide sequence of G or C, the 1059th is A among the SEQ ID:NO.4, the nucleotide sequence of T or C, the 1149th is T among the SEQ ID:NO.4, the 1368th is T among the nucleotide sequence of G or C and the SEQ ID:NO.4, in the nucleotide sequence of the nucleotide sequence of G or C one or more.Nucleotide sequence shown in the described SEQ ID:NO.6 is carried out that one or several Nucleotide replaces and the constant nucleotide sequence of proteins encoded that obtains can be selected among the SEQ ID:NO.6 the 75th and is A, the nucleotide sequence of T or G, the 90th is A among the SEQ ID:NO.6, the nucleotide sequence of T or C, the 822nd is A among the SEQ ID:NO.6, the nucleotide sequence of G or C, the 870th is the nucleotide sequence of G among the SEQ ID:NO.6, the 948th is A among the SEQ ID:NO.6, the nucleotide sequence of T or C, the 963rd is the nucleotide sequence of A or T among the SEQ ID:NO.6, the 1095th is the nucleotide sequence of T among the SEQ ID:NO.6, the 1099th is the nucleotide sequence of A among the SEQ ID:NO.6, the 1101st is A among the SEQ ID:NO.6, the nucleotide sequence of T or G, among the SEQ ID:NO.6 the 1105th be among the nucleotide sequence of A and the SEQ ID:NO.6 the 1107th be A, in the nucleotide sequence of T or C one or more.Nucleotide sequence shown in the described SEQ ID:NO.8 is carried out that one or several Nucleotide replaces and the constant nucleotide sequence of proteins encoded that obtains can be selected among the SEQ ID:NO.8 the 9th and is A, the nucleotide sequence of T or C, the 108th is the nucleotide sequence of A among the SEQ ID:NO.8, the 228th is the nucleotide sequence of A or T among the SEQ ID:NO.8, the 258th is the nucleotide sequence of A among the SEQ ID:NO.8, the 261st is A among the SEQID:NO.8, the nucleotide sequence of T or C, the 270th is the nucleotide sequence of C among the SEQ ID:NO.8, the 327th is A among the SEQ ID:NO.8, the nucleotide sequence of G or C, the 336th is A among the SEQ ID:NO.8, the nucleotide sequence of T or G, the 345th is A among the SEQ ID:NO.8, the nucleotide sequence of T or G, the 348th is A among the SEQ ID:NO.8, the nucleotide sequence of T or C, the 351st is the nucleotide sequence of C among the SEQ ID:NO.8, the 354th is the nucleotide sequence of T among the SEQ ID:NO.8, the 390th is A among the SEQ ID:NO.8, the nucleotide sequence of T or G, the 396th is A among the SEQ ID:NO.8, the nucleotide sequence of G or C, the 430th is the nucleotide sequence of A among the SEQ ID:NO.8, the 432nd is T among the SEQ ID:NO.8, the nucleotide sequence of G or C, the 453rd is the nucleotide sequence of C among the SEQ ID:NO.8, the 459th is the nucleotide sequence of A among the SEQ ID:NO.8, the 472nd is the nucleotide sequence of A among the SEQ ID:NO.8, the 474th is T among the SEQ ID:NO.8, the nucleotide sequence of G or C, the 486th is the nucleotide sequence of G among the SEQ ID:NO.8, the 492nd is A among the SEQ ID:NO.8, the nucleotide sequence of T or G, the 501st is A among the SEQ ID:NO.8, the nucleotide sequence of T or C, the 624th is A among the SEQ ID:NO.8, the 708th is A among the nucleotide sequence of G or C and the SEQ ID:NO.8, in the nucleotide sequence of T or G one or more.Nucleotide sequence shown in the described SEQ ID:NO.10 is carried out that one or several Nucleotide replaces and the constant nucleotide sequence of proteins encoded that obtains can be selected among the SEQ ID:NO.10 the 27th and is A, the nucleotide sequence of T or G, the 136th is the nucleotide sequence of T among the SEQ ID:NO.10, the 138th is A among the SEQ ID:NO.10, the nucleotide sequence of G or C, the 315th is A among the SEQ ID:NO.10, the nucleotide sequence of T or C, the 489th is the nucleotide sequence of G among the SEQ ID:NO.10, the 609th is A among the SEQ ID:NO.10, the nucleotide sequence of T or C, the 618th is A among the SEQ ID:NO.10, the nucleotide sequence of G or C, the 643rd is the nucleotide sequence of A among the SEQ ID:NO.10, the 645th is T among the SEQ ID:NO.10, the nucleotide sequence of G or C, the 728th is T among the SEQ ID:NO.10, the nucleotide sequence of G or C, the 762nd is the nucleotide sequence of T or C among the SEQ ID:NO.10, the 784th is the nucleotide sequence of T among the SEQ ID:NO.10, the 786th is A among the SEQ ID:NO.10, the nucleotide sequence of G or C, the 954th is A among the SEQ ID:NO.10, the nucleotide sequence of T or G, the 966th is A among the SEQ ID:NO.10, the nucleotide sequence of G or C, the 1320th is A among the SEQ ID:NO.10, the nucleotide sequence of T or G, among the SEQ ID:NO.10 the 1338th be among the nucleotide sequence of T and the SEQ ID:NO.10 the 1344th be in the nucleotide sequence of A one or more.

The immediate early gene of hsv (immediate early phase, IE) refer to that virus enters the gene that host cell just utilizes host cell expression (generally in 1 hour) immediately, because herpes simplex virus vector is also relevant with the expression abundance of infected cell polypeptides in host cell that the immediate early gene of this virus vector is encoded to the infection ability of host cell, the abundance that the immediate early gene of infected cell polypeptides of promptly encoding is expressed in host cell is high more, and then the rate of propagation of virus vector in host cell is fast more.Therefore more preferably described virus vector also comprises a kind of aminoacid sequence that promotes virus vector propagation function that has, the infected cell polypeptides that is a kind of immediate early gene coding is expressed the higher aminoacid sequence of abundance, described aminoacid sequence is selected from the aminoacid sequence shown in the SEQ ID:NO.11, aminoacid sequence shown in the SEQ ID:NO.13, and the aminoacid sequence shown in described SEQ ID:NO.11 or the SEQ ID:NO.13 carried out one or several aminoacid replacement, add or disappearance and obtain have in the aminoacid sequence that promotes virus vector propagation function one or more.

To described SEQ ID:NO.11 carry out one or several aminoacid replacement and the aminoacid sequence that promotes virus vector propagation function that has that obtains can be selected among the SEQ ID:NO.11 the 34th be Xie Ansuan, leucine, Isoleucine, methionine(Met), phenylalanine, the aminoacid sequence of tryptophane or proline(Pro), the 102nd is Serine among the SEQ ID:NO.11, glycine, halfcystine, l-asparagine, the aminoacid sequence of glutamine or tyrosine, the 281st is Xie Ansuan among the SEQ ID:NO.11, leucine, Isoleucine, methionine(Met), phenylalanine, the aminoacid sequence of tryptophane or proline(Pro), among the SEQID:NO.11 the 351st be among the aminoacid sequence of arginine or Histidine and the SEQ ID:NO.11 the 360th be in the aminoacid sequence of Methionin or Histidine one or more.To described SEQID:NO.13 carry out one or several aminoacid replacement and the aminoacid sequence that promotes virus vector propagation function that has that obtains can be selected among the SEQ ID:NO.13 the 36th be Xie Ansuan, leucine, Isoleucine, methionine(Met), phenylalanine, the aminoacid sequence of tryptophane or proline(Pro), the 178th is Methionin or arginic aminoacid sequence among the SEQ ID:NO.13, the 179th is the aminoacid sequence of Methionin or Histidine among the SEQ ID:NO.13, the 180th is the aminoacid sequence of Methionin or Histidine among the SEQ ID:NO.13, the 181st is Serine among the SEQ ID:NO.3, Threonine, halfcystine, l-asparagine, the aminoacid sequence of glutamine or tyrosine, the 206th is L-Ala among the SEQ ID:NO.13, Xie Ansuan, leucine, Isoleucine, methionine(Met), the aminoacid sequence of phenylalanine or tryptophane, the 383rd is Xie Ansuan among the SEQ ID:NO.13, leucine, Isoleucine, methionine(Met), phenylalanine, in the aminoacid sequence of tryptophane or proline(Pro) one or more.

Further preferred described virus vector also comprises a kind of aminoacid sequence that promotes virus vector propagation function that has, and described aminoacid sequence is the aminoacid sequence shown in aminoacid sequence shown in the SEQ ID:NO.11 and/or the SEQID:NO.13.

In the gene of described coding envelope protein, described envelope protein more preferably is selected from one or more in the envelope protein of the aminoacid sequence shown in aminoacid sequence shown in the aminoacid sequence shown in the aminoacid sequence shown in the aminoacid sequence shown in the SEQ ID:NO.1, the SEQ ID:NO.3, the SEQ ID:NO.5, the SEQ ID:NO.7 and the SEQ ID:NO.9.

Further preferred described nucleotide sequence is selected from one or more in the nucleotide sequence shown in nucleotide sequence shown in the nucleotide sequence shown in the nucleotide sequence shown in the nucleotide sequence shown in the SEQ ID:NO.2, the SEQID:NO.4, the SEQ ID:NO.6, the SEQ ID:NO.8 and the SEQ ID:NO.10.Further preferred described nucleotides sequence is classified the nucleotide sequence shown in nucleotide sequence shown in the nucleotide sequence shown in the nucleotide sequence shown in the nucleotide sequence shown in the SEQ ID:NO.2, the SEQID:NO.4, the SEQ ID:NO.6, the SEQ ID:NO.8 and the SEQ ID:NO.10 as.

More preferably described virus vector comprises that also a kind of coding has the nucleotide sequence of the aminoacid sequence that promotes virus vector propagation function, described nucleotide sequence is selected from the nucleotide sequence shown in the nucleotide sequence shown in the SEQ ID:NO.12, the SEQ ID:NO.14, and the nucleotide sequence shown in described SEQ ID:NO.12 or the SEQ ID:NO.14 is carried out that one or several Nucleotide replaces and in the constant nucleotide sequence of the proteins encoded that obtains one or more.

Wherein, the nucleotide sequence shown in the described SEQ ID:NO.12 is carried out that one or several Nucleotide replaces and the constant nucleotide sequence of proteins encoded that obtains can be selected among the SEQ ID:NO.12 the 102nd and is VITAMIN B4 (A), the nucleotide sequence of thymus pyrimidine (T) or guanine (G), the 306th is A among the SEQ ID:NO.12, the nucleotide sequence of T or cytosine(Cyt) (C), the 570th is the nucleotide sequence of G among the SEQ ID:NO.12, the 612nd is T among the SEQ ID:NO.12, the nucleotide sequence of G or C, the 652nd is the nucleotide sequence of T among the SEQ ID:NO.12, the 654th is A among the SEQ ID:NO.12, the nucleotide sequence of T or G, the 729th is A among the SEQ ID:NO.12, the nucleotide sequence of G or C, the 843rd is A among the SEQ ID:NO.12, the nucleotide sequence of T or G, among the SEQ ID:NO.12 the 1053rd be among the nucleotide sequence of G and the SEQ ID:NO.12 the 1080th be A, in the nucleotide sequence of T or C one or more.Nucleotide sequence shown in the described SEQID:NO.14 is carried out that one or several Nucleotide replaces and the constant nucleotide sequence of proteins encoded that obtains can be selected among the SEQ ID:NO.14 the 108th and is T, the nucleotide sequence of G or C, the 465th is A among the SEQ ID:NO.14, the nucleotide sequence of T or G, the 519th is A among the SEQ ID:NO.14, the nucleotide sequence of T or C, the 534th is the nucleotide sequence of T among the SEQ ID:NO.14, the 535th is the nucleotide sequence of A among the SEQ ID:NO.14, the 537th is A among the SEQ ID:NO.14, the nucleotide sequence of T or C, the 540th is A among the SEQ ID:NO.14, the nucleotide sequence of T or G, the 588th is T among the SEQ ID:NO.14, the nucleotide sequence of G or C, the 618th is A among the SEQ ID:NO.14, the 1149th is A among the nucleotide sequence of T or C and the SEQ ID:NO.14, in the nucleotide sequence of the nucleotide sequence of T or G one or more.

Further preferred described virus vector comprises that also a kind of coding has the nucleotide sequence of the aminoacid sequence that promotes virus vector propagation function, and described nucleotides sequence is classified the nucleotide sequence shown in nucleotide sequence shown in the SEQ ID:NO.12 and/or the SEQ ID:NO.14 as.

The hsv that is used for preparing virus vector of the present invention can have the hsv of 99.5% homology for the nucleotide sequence of the I herpes simplex virus type 17+ of nucleotide sequence and NCBI ID:NC_001806, and the difference of the two is as shown in table 1." variation position " in the table 1 is the base numbering of complete sequence Nucleotide of the I herpes simplex virus type 17+ of ID:NC_001806.

Table 1

The variation position	2351	2352-2353	2538	5730	6067	6385	7412	7604	9663	9980	10085
												17+	G	CT	C	G	G	C	C	C	C	T	G
CL-1	A	TG	T	A	Disappearance	Disappearance	A	G	T	C	Disappearance

Continuous table 1

The variation position	Between 10109 and 10110	10431	10508	10656	10723	10861	11123	11142	11195
										17+	-	A	T	C	G	G	G	A	T
CL-1	Add G	C	C	T	A	T	T	G	C

Continuous table 1

The variation position	111680-111681	11684-11685	11774-11775	11782	11945	11952	12168	12305	13065
										17+	CC	GC	--	T	C	A	G	A	C
CL-1	AT	Disappearance	Add AG	G	T	G	T	G	A

Continuous table 1

The variation position	13331	13353	13787	13995	14520	14934	15209	15229	15873	15908	16094
												17+	T	G	A	C	G	C	G	C	G	T	T
CL-1	C	A	C	T	A	T	C	G	A	C	C

Continuous table 1

The variation position	16148	16218	16442	16694	17098	17105	17174	17442	17540	17667	17737
												17+	A	G	A	T	A	A	T	T	C	C	C
CL-1	G	T	C	C	G	G	C	C	A	A	T

Continuous table 1

The variation position	17775	17814	17847	17916	17929	18109	18114	18118	18136	18145	18148
												CL-1	T	T	A	T	G	T	A	C	A	G	T
17+	C	G	G	G	T	G	G	G	G	Disappearance	A

Continuous table 1

The variation position	18284	18458	18515	18580	18646	18722	18850	18852	19081	19253
											CL-1	T	A	A	C	C	A	G	C	C	A
17+	G	G	G	A	A	G	C	G	T	G

Continuous table 1

The variation position	Between 20574 and 20575	20856	20967	21093	21237	21345	21525	22011	22014	22422
											CL-1		T	A	A	C	A	C	G	C	G
17+	G	C	G	G	T	G	T	A	A	C

Continuous table 1

The variation position	22452	22651	22905	23232	23343	23519	23694	23813	23823	23850	23933
												CL-1	T	G	C	C	T	C	A	C	T	A	A
17+	C	A	T	T	C	T	G	T	C	C	T

Continuous table 1

The variation position	23967	23989	24159	24171	24524	24541	24549	24719-24720	24726	Between 24761 and 24762
											CL-1	A	C	C	T	C	A	G	TT	A	-
17+	C	A	T	C	A	G	T	CC	C	A

Continuous table 1

The variation position	24790	24864	24895	24932	24991	25116	26049	26316	26349	26715	27256
												CL-1	C	A	C	A	A	C	T	G	T	C	G
17+	T	G	T	C	G	T	C	A	G	T	A

Continuous table 1

The variation position	27343	27346	27811	27911	28015	28132	28217	28336	28387	28401	28938
												CL-1	A	A	A	G	G	A	T	C	T	T	A
17+	G	C	G	A	A	G	C	A	G	C	C

Continuous table 1

The variation position	29125	29203	29367	29446	29521	29824	30328	30856	30888	31199	31272
												CL-1	A	G	A	C	T	A	A	G	T	G	T
17+	C	T	C	T	C	G	G	T	Disappearance	A	G

Continuous table 1

The variation position	31315	31397	31942	31994	32147	32460	32477	32508	32534	32554	32624
												CL-1	T	A	G	A	G	C	T	A	T	A	G
17+	G	C	A	C	T	A	C	G	G	G	T

Continuous table 1

The variation position	32663	32666	32738	33145	33230	Between 33437 and 33438	33453	33469	33634	33816
											CL-1	A	G	C	T	A	-	A	A	C	C
17+	C	T	T	C	C	C	C	Disappearance	T	A

Continuous table 1

The variation position	33865	33999	34215	34296	34416	34449	34596	34650	34683	34725	34797
												CL-1	C	A	T	A	C	G	C	G	G	C	C
17+	A	C	C	G	A	C	T	A	T	T	T

Continuous table 1

The variation position	34811	34863	Between 34880 and 34881	34916	35018	35047	Between 35068 and 35069	35076	35238	35267
											CL-1	A	C	--	A	G	G	-	A	G	C
17+	C	T	GG	G	A	T	C	C	A	T

Continuous table 1

The variation position	35331	35463	36121	36129	36222	36228	36253	36266	36336	36494	36613
												CL-1	G	G	A	A	T	C	A	C	G	G	T
17+	T	A	G	G	G	A	G	T	Disappearance	A	C

Continuous table 1

The variation position	37115	37236	37280	38141	38225	38231	38312	38390	38516	38672	40069
												CL-1	T	C	A	G	C	T	G	T	T	T	T
17+	G	G	G	A	T	C	A	C	G	G	C

Continuous table 1

The variation position	40919	40942	40967	41401	41425	41682	41885	42054	42249	42677	42978
												CL-1	A	T	T	T	A	A	G	C	G	G	A
17+	G	C	G	C	G	G	A	T	C	A	C

Continuous table 1

The variation position	43402	43678	43697	43705	43744	Between 43744 and 43745	43752	43857	44289	44478
											CL-1	A	C	G	C	A	--	A	C	C	G
17+	G	A	A	T	G	GG	G	A	T	A

Continuous table 1

The variation position	44781	45043	45123	46023	46049	46649	46828	46864	47004	47080	47235
												CL-1	C	A	G	A	A	C	G	G	T	G	A
17+	A	G	A	G	G	T	A	A	C	A	G

Continuous table 1

The variation position	47251	47526	47626	47729	47738	47904	48303	48304	48402	48406	48445
												CL-1	T	G	A	C	A	G	G	A	A	C	G
17+	C	A	G	T	G	A	T	G	C	T	A

Continuous table 1

The variation position	48701	48706	Between 48719 and 48720	48785	48970	49414	49444	49457	49522	49555	49598
												CL-1	T	T	-	G	G	G	C	T	A	T	T
17+	G	C	C	T	A	T	A	G	C	C	G

Continuous table 1

The variation position	49819	50353	50588	50762-50774	51397	52281	52326	52518	52521-52822
										CL-1	C	C	G	TTTTTTTTTTTTT	A	A	G	A	TT
17+	T	T	A	Disappearance	C	G	A	G	Disappearance

Continuous table 1

The variation position	52833	52870	52889	Between 52897 and 52898	52915	52960	52976-52977	52985	53009-53010
										CL-1	G	T	T	--	A	G	AT	T	CA
17+	C	C	G	GG	G	A	Disappearance	C	Disappearance

Continuous table 1

The variation position	53029	53033-53034	53046	53067	53091	53245	53277	53611	53710	54294	54397
												CL-1	A	AA	G	A	G	C	T	G	T	G	T
17+	C	Disappearance	A	G	A	A	G	A	C	T	G

Continuous table 1

The variation position	54646	54942	55571	55589	55598	55623	55626	55663	55895	56027	56684
												CL-1	G	G	G	T	C	C	G	A	G	T	T
17+	A	A	T	C	T	G	C	G	T	C	C

Continuous table 1

The variation position	57074	58332	58952	59105	59279	59324	59528	60005	60023	60071	60389
												CL-1	A	T	C	T	C	G	A	G	A	T	T
17+	G	C	T	C	A	A	G	A	G	C	C

Continuous table 1

The variation position	60396	60428	60497	60563	60569	60642	60806	60890	60999	61023	61061
												CL-1	A	A	G	C	G	C	T	A	T	C	G
17+	G	G	T	T	A	G	C	G	G	A	A

Continuous table 1

The variation position	61150	61175	61205	61388	61394	61475	61721	61805	61936	61949	62071-62072
												CL-1	G	A	A	A	A	A	G	T	C	C	CC
17+	C	G	G	G	G	G	A	G	A	T	TT

Continuous table 1

The variation position	62088	62126	62163-62167	62174	62187	62191	62220	Between 62238 and 62239	Between 62253 and 62254
										CL-1	A	G	GGGGG	A	A	G	A	--	-
17+	G	A	Disappearance	C	Disappearance	T	C	CC	C

Continuous table 1

The variation position	62271	62276	62329	62342	62759	62784	62786	62788	62793	63273	63459
												CL-1	A	G	C	A	G	C	C	C	C	T	T
17+	G	Disappearance	T	G	T	A	A	T	Disappearance	C	C

Continuous table 1

The variation position	63654	63811	63812	64897	65493	65536	65537	65772	65808	65835	66445
												CL-1	C	C	G	C	A	A	C	A	A	A	G
17+	T	G	C	A	C	G	T	C	G	C	A

Continuous table 1

The variation position	73198	73761	80715	80827	80839	80857	80890	80942	81165	81216	81408
												CL-1	G	G	G	T	A	T	G	C	T	A	A
17+	T	A	T	C	G	C	A	A	C	G	G

Continuous table 1

The variation position	81417	81716	81834	81870	82065	82101	82215	82575	82694	82695	82766
												CL-1	A	T	G	A	A	G	A	C	G	A	C
17+	G	C	T	G	G	A	G	T	A	C	T

Continuous table 1

The variation position	83172	83175	83643	83856	83857	Between 84505 and 84506	84535	84611	84629	84685
											CL-1	C	T	C	T	G	----	T	C	G	T
17+	G	C	A	G	T	CTCCC	G	A	A	G

Continuous table 1

The variation position	84920	85091	85340	85409	85892	85942	86018	86144	86256	Between 86334 and 86335	86469
												CL-1	C	C	T	G	C	A	A	C	T	-	C
17+	T	A	C	A	T	C	G	T	C	C	A

Continuous table 1

The variation position	86573	86663	86703	86817	86883	86884	86943	86997	87060	87353	87538
												CL-1	G	G	A	T	A	G	C	C	C	T	T
17+	A	A	C	G	C	A	T	A	G	C	G

Continuous table 1

The variation position	87548	87705	87732	87816	87975	88146	88881	89852	89923	89930	89980
												CL-1	A	A	T	C	C	A	T	C	G	C	A
17+	C	G	C	T	T	G	C	T	T	T	T

Continuous table 1

The variation position	89986	89997	90353	90392	90432	90455	90479	90626	90961	91107	91179
												CL-1	G	C	T	C	C	T	C	T	G	A	T
17+	A	A	C	T	T	C	T	C	T	C	C

Continuous table 1

The variation position	91244	91495	91498	92657	92964	93140	93141	93783	94133	94158	94253
												CL-1	G	C	C	G	A	C	A	A	T	A	C
17+	A	G	T	A	G	G	C	C	C	G	T

Continuous table 1

The variation position	94255	94257	94296	94336	94605	94636	94693	94709	94764	94771	95190
												CL-1	T	C	A	T	A	G	G	T	C	C	T
17+	C	T	C	G	G	Disappearance	A	Disappearance	T	Disappearance	C

Continuous table 1

The variation position	95196	95325	95365	95418	95427	95451	95458	95459	95473	95483	95513
												CL-1	G	T	T	C	G	C	G	T	G	A	A
17+	A	C	C	T	T	T	A	C	C	G	T

Continuous table 1

The variation position	95514	95646	96020	Between 96178 and 96179	96190	96261	96264	96444	96501	96589
											CL-1	C	C	C	--	C	T	G	A	A	C
17+	T	T	T	GC	T	Disappearance	Disappearance	G	G	Disappearance

Continuous table 1

The variation position	96919	97191	97381	97471-97473	97690	97865	97893	97903	Between 97910 and 97911
										CL-1	G	A	C	GCA	G	G	G	T	-
17+	A	C	T	CAT	A	A	T	G	C

Continuous table 1

The variation position	97984	98639	99122	Between 99218 and 99219	99347	99427	99460	99511	99522-99524
										CL-1	C	C	G	---	A	C	C	G	GGC
17+	A	T	C	TCG	C	T	T	T	Disappearance

Continuous table 1

The variation position	99550	99640	99642	99646	99735	99941	99992	100217	100600	101222
											CL-1	T	G	A	C	C	A	C	T	C	A
17+	G	T	G	T	T	G	G	C	A	G

Continuous table 1

The variation position	101238	102054	102177	102195	102210	102290	102646	102811	103220
										CL-1	C	A	A	C	T	T	T	C	A
17+	A	G	C	A	C	C	G	T	G

Continuous table 1

The variation position	Between 103273 and 103274	103532	103572	103732	104418	104683	104724	104776	104820
										CL-1	-	T	G	A	G	C	C	G	A
17+	A	Disappearance	T	C	A	A	T	T	G

Continuous table 1

The variation position	104832	104938	104989	105057	105194	105203	105293	105411	105502	106256
											CL-1	A	C	A	C	A	T	C	A	T	G
17+	G	T	G	T	Disappearance	C	A	C	Disappearance	T

Continuous table 1

The variation position	106263	106859	106927	107025	107181	107253	107278	107286	107510	107240
											CL-1	C	C	T	C	C	T	T	A	C	A
17+	A	T	C	G	T	C	G	C	A	C

Continuous table 1

The variation position	107554	107988	108126	108146	108152	108187	108212	108264	108499	108509
											CL-1	C	T	C	T	G	T	C	G	G	G
17+	A	C	T	C	T	G	A	A	T	C

Continuous table 1

The variation position	108587	108754	108909	109695	109705	109908	109927	110128	110524	110563
											CL-1	G	G	A	C	G	A	C	T	T	C
17+	A	A	G	T	T	G	T	C	C	T

Continuous table 1

The variation position	110599	110604	110606	110611	110842-110844	111237	112978	113225	113239
										CL-1	A	A	A	G	AAA	G	A	A	G
17+	G	G	C	A	GGG	Disappearance	C	G	T

Continuous table 1

The variation position	Between 113276 and 113277	113328	113443	113474	113856	114214	114268	114282	114284
										CL-1	-	T	T	T	C	C	G	A	C
17+	G	C	G	C	A	T	T	C	G

Continuous table 1

The variation position	114288	114289	114337	114366	114896	115493	118977	132759	132963	133229
											CL-1	G	C	A	C	G	A	G	G	A	A
17+	C	G	C	A	A	G	T	T	G	C

Continuous table 1

The variation position	133271	133312	133387	Between 133410 and 133411	133501	133711	133739	133943	133953
										CL-1	A	T	C	-	G	A	G	T	A
17+	Disappearance	Disappearance	T	C	A	G	A	C	C

Continuous table 1

The variation position	Between 134041 and 134042	134072	134077	134411	134418	135132	135155	135232	135258
										CL-1	-	C	C	T	T	T	A	A	T
17+	G	A	-	G	C	G	G	G	Disappearance

Continuous table 1

The variation position	Between 135279 and 135280	135307	135383	135392	135868	135958	136066	136321	136693
										CL-1	-	A	A	C	C	C	G	C	G
17+	G	G	C	A	T	G	A	G	T

Continuous table 1

The variation position	136705	136736	136769	136869	136989	137018-137020	137031	137088	137095
										CL-1	C	C	C	G	C	AGG	T	T	G
17+	Disappearance	T	A	A	T	Disappearance	C	C	T

Continuous table 1

The variation position	137106	137108	137112	137114	137149	137156	137193	137213	137219	137235
											CL-1	C	G	T	A	C	G	A	G	A	A
17+	T	A	C	T	T	A	C	T	G	C

Continuous table 1

The variation position	137246	137251	137262	137384	137467	Between 137495 and 137496	137498	137512	137516
										CL-1	A	C	G	T	C	-	T	C	T
17+	G	A	A	G	T	G	G	T	G

Continuous table 1

The variation position	137539	137542	137558	137586	137605	137610	137664	137763	137825	137952
											CL-1	C	G	G	G	T	G	G	T	T	G
17+	T	T	A	A	C	Disappearance	A	C	G	A

Continuous table 1

The variation position	138512	138528	139261	139309	139387	139402	139533	139539	139545-139546
										CL-1	G	C	T	A	G	C	A	G	GG
17+	A	T	G	G	A	A	G	A	AA

Continuous table 1

The variation position	Between 139634 and 139635	139717	139783	Between 139783 and 139784	140021	140072	140175	140207	140214
										CL-1	-	C	C	-	T	G	G	G	G
17+	C	T	T	T	G	A	C	A	A

Continuous table 1

The variation position	140220	140259	140265	140308	140338	140420	140443	140464	140465	140467
											CL-1	T	G	A	A	C	C	G	G	C	T
17+	G	T	G	G	T	A	A	A	T	C

Continuous table 1

The variation position	140470	140472	140529	140544	140652	140724	140748	140904	140924	140947
											CL-1	A	C	C	C	T	C	A	G	T	T
17+	G	T	T	T	C	T	G	T	C	C

Continuous table 1

The variation position	140978	140997	141021	141079-141081	141087-141090	141193	141194	141600
									CL-1	G	G	A	TCC	CCCC	G	A	C
17+	T	A	C	Disappearance	Disappearance	C	C	G

Continuous table 1

The variation position	142037	142147	142159	142564	143054	143189	143298	143452	143510	143582
											CL-1	G	A	T	G	A	T	T	T	G	C
17+	T	C	C	A	G	C	A	Disappearance	T	T

Continuous table 1

The variation position	143653-143654	143929	143999	144005	144009	144011-144032
							CL-1	CT	C	C	T	C	TGGGAGATGGGCCCACCGTCCC
17+	Disappearance	T	Disappearance	A	G	Disappearance

Continuous table 1

The variation position	144047	144085	144184	144276	144278	After 152311
							CL-1	G	G	G	A	A	---
17+	Disappearance	A	A	G	T	GGC

Herpes simplex virus vector of the present invention not only strengthens aspect the ability that infects anthous's host cell, and when being used for the multiple tumour cells of other ethnic groups, stronger to the dissolving power of tumour cell.

The present invention also provides a kind of recombinant virus, and described recombinant virus comprises virus vector and goal gene, and wherein, described virus vector is a herpes simplex virus vector of the present invention.Herpes simplex virus vector of the present invention not only can act on the cracking killing tumor cell separately, but also can be by transmitting goal gene and/or cracking killing tumor cell.Herpes simplex virus vector of the present invention can carry the goal gene of 0.1-50kb, preferably carries the goal gene of 10-40kb.Described goal gene can be the gene of anti-tumor activity, one or more in the gene of the gene of the prodrug activator of for example encoding, the gene of codes for tumor arrestin, Codocyte antiapoptotic factors (pro-apoptotic factors) precursor and the proteic gene of coding immunostimulation.Described immunostimulation albumen can be for self having Cytotoxic albumen, can stimulating/strengthen the albumen of anti-tumor immune response.Certain virus vector of the present invention also can be used for one or more goal gene are passed in the cell that needs its expression, this cell can be a for example neurocyte of non-tumor cell, described one or more goal gene can be replied or the gene of the polypeptide of relieve chronic pain pain stimulation for coding changes, described polypeptide for example can completely cut off for example albumen, Substance P and other neuropeptide of nerve growth factor, other regulating pain neurotrophic factor, neurotrophic factor sample molecule.Described one or more goal gene also can stimulate injured nerve regrowth in the degenerative disease or prevent the neural further gene of the polypeptide of sex change for coding.

Described goal gene can also comprise regulating and controlling sequence, for example the promotor of described one or more destination gene expressions, terminator and enhanser.Described goal gene can comprise that also marker gene (for example, the gene of coding beta-galactosidase, green fluorescent protein or other fluorescin) or its product regulate the gene of other genetic expression.

Described goal gene can also be mRNA, tRNA or rRNA except that being the DNA, can also comprise the associated retroviral regulating and controlling sequence relevant with transcription sequence, for example transcription termination signal, polyadenylation site and downstream enhancer element usually.

The present invention also provides a kind of infection virulent host cell, and wherein, described virus is herpes simplex virus vector of the present invention and/or recombinant virus.Herpes simplex virus vector can be defined as the hsv of one or several gene in the gene of the gene of gene, coding infected cell polypeptides 6 of disappearance coding infected cell polypeptides 34.5 and coding infected cell polypeptides 47, the same with normal hsv, also need finish in host cell its life history, therefore going down to posterity of described virus vector and recombinant virus bred and activated and need carry out in host cell.And the host cell of herpes simplex virus vector of the present invention and/or recombinant virus is arranged in Infection in Vitro, also can be used as gene therapy medicine and import in the body.Described host cell can be the various host cells that can cultivate virus vector of the present invention and/or recombinant virus, for example African green monkey kidney cell (Vero cell), former generation rabbit kidney cell, chick-embryo cell, amnion cell, human cervical carcinoma cell (Hela cell) and human embryonic lung diploid fibroblast (WI-38 cell).

The present invention also provides a kind of pharmaceutical composition, and wherein, described pharmaceutical composition comprises herpes simplex virus vector of the present invention and/or recombinant virus.Herpes simplex virus vector of the present invention can use the cracking killing tumor cell separately; Can also carry goal gene and prepare recombinant virus, described recombinant virus uses separately by transmitting goal gene and/or cracking killing tumor cell.Herpes simplex virus vector of the present invention and recombinant virus of the present invention also can use simultaneously.Herpes simplex virus vector of the present invention, recombinant virus of the present invention and their mixture all can also comprise medicine acceptable carrier or vehicle, use with the form of pharmaceutical composition.

Described medicine acceptable carrier or vehicle refer to nontoxic solid-state, semi-solid state or liquid weighting agent, thinner, coating material or other pharmaceutical adjuncts, for example, include but not limited to salt solution, buffering saline solution, glucose, water, glycerine, ethanol and composition thereof.Described pharmaceutical composition is suitable in parenteral, hypogloeeis, the brain pond, in the intravaginal, internal rectum, cheek, in the tumour or the epidermis administration.

Parenteral admin comprises that intravenously, intramuscular, intraperitoneal, breastbone are interior, subcutaneous, intra-articular injection and infusion.The pharmaceutical composition that is suitable for parenteral admin comprises aseptic aqueous solution or non-aqueous solution, dispersion liquid, suspension or emulsion, and is used for before facing use in sterile injectable solution or dispersion liquid powder formulated.Suitable water-based or non-aqueous carrier, thinner, solvent or vehicle comprise water, ethanol, glycerine, interior glycol, polyoxyethylene glycol, carboxymethyl cellulose, vegetables oil and injectable organic ester such as ethyl oleate.These compositions can also contain sanitas, wetting agent, emulsifying agent, protective material and dispersion agent adjuvant, for example inositol, sorbyl alcohol and sucrose.Preferred adding osmotic pressure regulator such as carbohydrate, sodium-chlor, Repone K.

The epidermis administration is included on skin, the mucous membrane and in lung and the surperficial administration of eye.Such pharmaceutical composition comprises pulvis, ointment, drops, transdermal patch, Iontophoretic device and inhalation etc.The composition of rectum or vagina administration is preferably suppository, it can be by being mixed with carrier of the present invention and suitable non-irritating excipient or carrier such as theobroma oil, polyoxyethylene glycol or suppository wax, described vehicle or carrier are solid-state in room temperature, be liquid under body temperature, therefore fusing and discharge active compound in rectum or vaginal canal.

Preferred described pharmaceutical composition is an injection liquid, and described injection liquid comprises pharmaceutically acceptable carrier and herpes simplex virus vector provided by the invention and/or recombinant virus, contains 10 in every milliliter of described injection liquid ²-10 ¹⁰Plaque forms several described virus vector and/or recombinant virus.Described pharmaceutically acceptable carrier can be the phosphoric acid buffer of 4.0-9.0 for the pH value.Described injection liquid also contains protective material and/or osmotic pressure regulator; With described injection liquid is benchmark, and described protectant content is 0.01-30 weight %, and described protective material is selected from one or more in inositol, sorbyl alcohol and the sucrose; It is 200-700 m osmole/kilogram that the content of described osmotic pressure regulator makes the osmotic pressure of described injection liquid, and described osmotic pressure regulator is sodium-chlor and/or Repone K.When using described injection liquid to carry out, the virus quantity scope that gives is 10 ³-10 ¹⁰Plaque forms number (pfu), preferred 10 ⁵-10 ⁸Pfu, more preferably 10 ⁶-10 ⁸Pfu.When injection medicinal compositions of the present invention, the injection consumption can be this area dosage commonly used, 500 microlitres, general 1-200 microlitre, preferred 1-10 microlitre at the most; But, also can use 10 milliliters dosage at the most according to described tumour and inoculation position.Because those skilled in the art can easily determine best route of administration and dosage, so described route of administration and dosage are for reference only.Described dosage can be according to various parameters, especially determine according to the severity and the route of administration of patient's age to be treated, body weight and illness, disease or illness.In addition, be to be injected directly in the tumour for the preferred route of administration of cancer patients.Medicine composition injection of the present invention also can be administered systemically, and also medicine composition injection of the present invention can be expelled to the intravascular administration into tumor feeding.Most preferred route of administration depends on the position and the size of described tumour.

Further specify the present invention below in conjunction with embodiment, unless stated otherwise, the used reagent of the present invention, substratum are the commercial goods.

Embodiment 1

The preparation of present embodiment explanation herpes simplex virus vector of the present invention.

(1) Bing Du collection

The Chinese male of growing up, 37 years old, Han nationality, the feverblister medical history of showing effect repeatedly repeatedly, no other diseases is the clinical manifestation of typical I herpes simplex virus type recurrent infection---and bicker bleb sample bubble occurs on every side and takes a sample two days later.

Get 15 milliliters aseptic centrifuge tube, fill 3 milliliters of aseptic phosphate buffered saline buffers that contain 100 mcg/ml kantlex (PBS), contain the NaCl of 9 grams per liters, the KH of 0.21 grams per liter in the described damping fluid ₂PO ₄And the Na of 0.97 grams per liter ₂HPO ₄.12H ₂O; Flow out with aseptic cotton carrier extruding hydroa herpetiforme to faint yellow secretory product, dip in cotton swab then and get this secretory product, an end that the gained cotton swab is had secretory product is rinsed in above-mentioned PBS damping fluid and was washed for 10 seconds.Take out cotton swab, with the sterilization micro sample adding appliance that the damping fluid pressure-vaccum that gained contains secretory product is even.

(2) Bing Du inoculation, cultivation and purifying

With the DMEM substratum that contains 10% foetal calf serum, on six porocyte culture plates with 5 * 10 ⁵The density of individual cells/well inoculation African green monkey kidney cell (Vero cell), under 37 ℃ at 5%CO ₂Cultivated 24 hours in the incubator, extremely every hole Vero cell covers with 80%.Under gnotobasis, (1) that adds 200 microlitres in every hole of above-mentioned six porocyte culture plates obtains containing the PBS damping fluid (sample and finished inoculation in back 1 hour) of secretory product then.Continuation is at 5%CO ₂Cultivate down after 24 hours for 37 ℃ in the incubator, under gnotobasis, the magnification with 100 times under opticmicroscope is observed the Vero cell, finds viral plaque; Draw one viral plaque 10 microlitres with the sterilization micro sample adding appliance, the liquid that 10 microlitres are drawn is sneaked in the DMEM substratum of 100 microlitres, and with micro sample adding appliance that the DMEM substratum pressure-vaccum that gained contains virus is even.

Under gnotobasis, in covering with every hole of six porocyte culture plates of 80%Vero cell, another one adds the above-mentioned DMEM substratum that obtains containing purified virus, infect this Vero cell.At 5%CO ₂Cultivate the hsv of the present invention that obtains purifying down for 37 ℃ in the incubator.

(3) Bing Du biological property analysis

As shown in Figure 1, the virus of observing (2) purifying under 52000 times of Electronic Speculum has typical hsv form: capsid is the icosahedron symmetry, and diameter is about 100 nanometers.The outer tunicle by gage distortion of capsid covers.The virus outermost layer is typical double-layer of lipoid cyst membrane, and the viral diameter that comprises cyst membrane is 150 to 200 nanometers.

The contriver entrusts the big genome company of Hangzhou China also the virus of (2) purifying to be carried out genome sequencing in addition, sequencing result is shown in above-mentioned table 1, and the sequence homology that is numbered the I herpes simplex virus type 17+ of ID:NC_001806 among gained virus and the NCBI is 99.5%.The present inventor analyzes the whole genome sequence that obtains, obtain ID:NO.2 as SEQ, SEQ ID:NO.4, SEQ ID:NO.6, SEQ ID:NO.8, and the gene nucleotide series of the coding envelope protein shown in the SEQ ID:NO.10, and obtain as SEQ ID:NO.1 (viral glycoprotein B) by described nucleotide sequence, SEQID:NO.3 (viral glycoprotein C), SEQ ID:NO.5 (viral glycoprotein D), SEQ ID:NO.7 (viral glycoprotein G), and the aminoacid sequence of the envelope protein shown in the SEQ ID:NO.9 (viral glycoprotein M).By comparing, find that there is variation in the gene nucleotide series of the purified virus coding envelope protein that (2) obtain with the corresponding gene of ID:NC_001806.Obtained the nucleotide sequence of the immediate early gene of the coding infected cell polypeptides shown in SEQID:NO.12 and SEQ ID:NO.14 in addition, and obtained as SEQ ID:NO.11 (infected cell polypeptides α 22) and SEQ ID:NO.13 (infected cell polypeptides α 27) by described nucleotide sequence.

(4) knocking out in the gene of the gene of the gene of coding infected cell polypeptides 34.5, coding infected cell polypeptides 6 and coding infected cell polypeptides 47.

Method according to CN 1283803C record, knock out respectively the coding infected cell polypeptides 34.5 gene, the coding infected cell polypeptides 6 gene and the coding infected cell polypeptides 47 gene in one or several gene, obtain one group of herpes simplex virus vector as shown in table 2.

Table 2

The virus vector numbering	1	2	3	4	5	6	7
								Missing gene	ICP34.5	ICP6	ICP47	ICP34.5 and ICP6	ICP34.5 and ICP47	ICP6 and ICP47	ICP34.5, ICP6 and ICP47

Embodiment 2

Present embodiment illustrates the dissolving power of herpes simplex virus vector of the present invention to the KB cell (CNE-1) of anthous's pilosity.

(1) mensuration of herpes simplex virus vector titre

With the DMEM substratum that contains 10% foetal calf serum, on 7 six porocyte culture plates with 5 * 10 ⁵The density of individual cells/well inoculation African green monkey kidney cell (Vero cell) (U.S. ATCC), under 37 ℃ at 5%CO ₂Cultivated in the incubator 24 hours, and covered with 80% standby to every hole Vero cell.

Under the aseptic condition, collect and to cultivate the supernatant nutrient solution that the Vero cell culture of 7 kinds of herpes simplex virus vectors shown in embodiment 1 table 2 is arranged respectively, with the DMEM substratum that does not contain serum respectively gradient dilution become 1 * 10 ²Times liquid, 1 * 10 ³Times liquid, 1 * 10 ⁴Times liquid, 1 * 10 ⁵Times liquid, 1 * 10 ⁶Times liquid and 1 * 10 ⁷Times liquid, every kind of each 100 microlitre of diluent.

Under the aseptic condition, discard the DMEM substratum that contains 10% foetal calf serum on the above-mentioned six porocyte culture plates in the cultured Vero cell culture, every then hole adds 1 milliliter of the DMEM substratum that does not contain serum of above-mentioned dilution usefulness, then a kind of virus vector diluent with above-mentioned 6 concentration that make adds in 6 holes every hole 100 microlitres respectively.Every kind of virus vector is added on one the six porocyte culture plate, obtains 7 six porocyte culture plates that are added with virus vector altogether.Transfection has Vero cell six well culture plates of virus vector to place 5%CO ₂Cultivated 1 hour down for 37 ℃ in the incubator, discard the substratum in the hole under the aseptic condition, add 2 milliliters of carboxymethyl cellulose substratum in every hole (with the carboxymethyl cellulose powder with after PBS solution mixes according to weightmeasurement ratio 2:125, preserved 12 hours at 4 ℃ of refrigerators, the back fully 121.3 ℃ of sterilizations of dissolving 30 minutes, under the aseptic condition, by volume 1:2 is mixed with the carboxymethyl cellulose PBS solution of the aseptic 1.6 bulking value % of gained and the DMEM that contains 10%FBS).Place 5%CO ₂Cultivate after 48 hours down for 37 ℃ in the incubator, discard nutrient solution, with cell rinse 2 times, discard PBS solution, add 2 milliliters of PBS solution that contain the glutaraldehyde (U.S. Sigma) of 0.1 volume %, placed 10 minutes down for 25 ℃ with PBS solution.Once more cell is used PBS solution rinse twice, discarded PBS solution, add the crystal violet solution (preparing as solvent) of 1 milliliter of 0.1 bulking value %, placed 10 minutes down for 25 ℃ with 20 volume % ethanol.With pure water rinse cell twice, dry the water at the six orifice plate back sides with thieving paper, six orifice plates are placed under 100 times of opticmicroscopes observe, the counting plaque.Calculate the plaque number that every milliliter of virus vector stoste as shown in table 3 forms, i.e. the titre of virus vector stoste, unit is plaque forming unit/milliliter (pfu/ml).

Table 3

The virus vector numbering	1	2	3	4	5	6	7
								Titre (pfu/ml)	5×10 7	5×10 7	7×10 7	3×10 7	5×10 7	5×10 7	4×10 7

(2) cultivation of KB cell

Under 37 ℃ at 5%CO ₂In the incubator with 6 milliliters of DMEM substratum that contain 10% foetal calf serum, cultivation is seeded in the CNE-1 cell (available from Shanghai cell research institute of the Chinese Academy of Sciences) 48 hours in 25 square centimeters the culturing bottle, is in logarithmic phase with the inverted microscope CNE-1 cell that amplifies 100 times.Under the aseptic condition, add 1 milliliter in 0.25% trypsinase, at 37 ℃ of described CNE-1 cells that are in logarithmic phase of digestion 5 minutes down.With inverted microscope observe the CNE-1 cell in culture medium solution free after, add fresh culture and be diluted to 1 * 10 ⁴The cell suspension of individual/milliliter, microsyringe piping and druming evenly back adds in 96 orifice plates, and every hole adds 100 microlitre cell suspensions, at 37 ℃, 5%CO ₂Continue in the incubator to cultivate 24 hours.

(3) mensuration of the transfection of virus vector and KB cell survival rate

With the herpes simplex virus vector stoste of the step (1) of known titre, (multiplicity of infection MOI) is the CNE-1 cell of the above-mentioned cultivation of 0.1 transfection with infection multiplicity according to the method for step (1).Wherein control wells adds and the isopyknic 1% calf serum DMEM substratum that contains of virus stock solution used.Control wells CNE-1 cell and transfected CNE-1 cell are all at 37 ℃ of following 5%CO ₂Cultivate in the incubator, and (concrete grammar is documented in " measuring the foundation of the MTT method of cell survival and propagation ", people such as Zheng Yongtang with mtt assay 24 hours, 48 hours and 72 hours after transfection respectively, Journal of Immunology, 1992, the 8th volume, the 4th phase, the 266-269 page or leaf) the mensuration cell survival rate.With model is that the enzyme linked immunological instrument (manufacturing of East China Electronics Co., Ltd pipe factory) of DG-3022 is measured the OD value under 570 nanometers, and cell survival rate is calculated by following formula:

Cell survival rate=(transfection hole absorbance value/control wells absorbance value) * 100%.

The test result of cell survival rate sees Table 5.

Comparative Examples 1

The herpes simplex virus vector of this Comparative Examples explanation prior art is to the dissolving power of the KB cell (CNE-1) of anthous's pilosity.

According to the method for embodiment 1, with 7 kinds of herpes simplex virus vectors of herpes simplex virus 1 7+ preparation, the missing gene situation is as shown in table 4.

Table 4

The virus vector numbering	A	B	C	D	E	F	G
								Missing gene	ICP34.5	ICP6	ICP47	ICP34.5 and ICP6	ICP34.5 and ICP47	ICP6 and ICP47	ICP34.5, ICP6 and ICP47

Method according to embodiment 2, KB cell (CNE-1) (available from Shanghai cell research institute of the Chinese Academy of Sciences) with the herpes simplex virus 1 7+ transfection anthous pilosity of identical virus vector titre, under same condition, cultivate the CNE-1 cell of transfection, and measure the survival rate of CNE-1 cell according to the method for embodiment 2, measurement result sees Table 5.

Table 5

As can be seen from Table 5, the survival rate of the CNE-1 cell of transfection herpes simplex virus vector of the present invention is significantly less than the survival rate of the CNE-1 cell of transfection prior art herpes simplex virus 1 7+ carrier, and the CNE-1 cell is the tumour cell of the multiple human nasopharyngeal carcinoma of the typical anthous, virus vector of the present invention is described, for the herpes simplex virus 1 7+ carrier of prior art, specificity is stronger to the dissolving power of xanthous tumour cell.

Embodiment 3

Present embodiment illustrates the dissolving power of herpes simplex virus vector of the present invention to general tumour cell.

Method according to embodiment 2, descend transfection human breast cancer cell MCF-7, human colon cancer cell HT-29 and human lung adenocarcinoma cell A549 (available from No.2 Research Institute of Military Medical Science Institute) in two kinds of different infection multiplicities (MOI=0.1 and MOI=1) respectively with herpes simplex virus vector of the present invention, and the survival number of different time points tumour cell after the test transfection, the result is as shown in table 6.

Comparative Examples 2

The herpes simplex virus 1 7+ carrier of this Comparative Examples explanation prior art is to the dissolving power of general tumour cell.

Method according to embodiment 2, descend transfection MCF-7 MCF-7, CCL188 HT-29 and human lung adenocarcinoma cell line A549 in two kinds of different infection multiplicities (MOI=0.1 and MOI=1) respectively with herpes simplex virus 1 7+ carrier, and the survival number of different time points tumour cell after the test transfection, the result is shown in table 6 and table 7.

Table 6

Table 7

From table 6 and table 7 as can be seen, no matter hanging down under the infection multiplicity (MOI=0.1) or the situation of high infection multiplicity (MOI=1), the survival rate of three kinds of tumor cell lines of 24 hours of transfection herpes simplex virus vector of the present invention all is significantly less than the survival rate of three kinds of tumor cell lines of transfection prior art herpes simplex virus 1 7+ carrier, illustrates that virus vector of the present invention also is better than the herpes simplex virus 1 7+ carrier of prior art to the dissolving power of general tumour cell.In addition, Fig. 2 has showed that normal human mammary cancerous cell line MCF-7 cultivates 96 hours growing state optical microscope photograph (amplifying 400 times), and as can be seen from Figure 2, normal human mammary cancerous cell line MCF-7 cultivated after 96 hours, cellularstructure is complete, and intensive growth is arranged; Fig. 3 has showed that cultivation MCF-7 cell is after 48 hours, by the ratio (MOI) of virus activity particle/cell count is to cultivate 48 hours growing state optical microscope photograph (amplifying 400 times) again behind the 0.1 transfection virus vector of the present invention, as can be seen from Figure 3, most cellularstructures are destroyed, and cell number significantly reduces.From two photo contrasts as can be seen, herpes simplex virus vector of the present invention all has stronger dissolving power to general tumour cell.

Embodiment 4

Present embodiment illustrates recombinant virus provided by the invention and preparation method thereof.

Method according to CN 1283803C record, in the virus vector 7 that in embodiment 1, obtains, (infected cell polypeptides, insertion is by the gene that inserts the coding red fluorescent protein that is guided by the RSV promotor on the gene location of insertion by the gene of the gene of the encoding green fluorescent protein of MMLV promotor guiding and the infected cell polypeptides 47 of encoding on the gene location of the human GM-CSF gene of the IE promotor guiding of hCMV, the infected cell polypeptides 6 of encoding on gene location ICP34.5) at coding infected cell polypeptides 34.5 respectively.The sequence of described gene can be found in ncbi database, with the method for the recombinant virus that obtains according to embodiment 2, is 0.1 transfection KB cell with infection multiplicity.The KB cell of expressing green fluorescent protein can be observed as shown in Figure 6 in 24 hours after the transfection under 100 times of opticmicroscopes.

Collect after the transfection supernatant liquor in the six porocyte culture plates of 24 hours, 48 hours and 72 hours, with model is that the enzyme linked immunological instrument (manufacturing of East China Electronics Co., Ltd pipe factory) of DG-3022 is under 450 nanometers, according to ELISA test kit specification sheets (BD OptEIA set human GM-CSF, Catalog No:555126, green fluorescent protein test kit and red fluorescent protein test kit), measure human GM-CSF, green fluorescent protein and the red fluorescent protein expression amount in KB cell respectively, the result is as shown in table 8.

Comparative Examples 3

According to embodiment 4 described methods, different is to obtain herpes simplex virus 1 7+ carrier G with Comparative Examples 2 to prepare recombinant virus, collected after the transfection 24 hours, supernatant liquor in the six porocyte culture plates of 48 hours and 72 hours, with model is that the enzyme linked immunological instrument (manufacturing of East China Electronics Co., Ltd pipe factory) of DG-3022 is under 450 nanometers, according to ELISA test kit specification sheets (BD OptEIA set human GM-CSF, Catalog No:555126, green fluorescent protein test kit and red fluorescent protein test kit), measure human GM-CSF respectively, green fluorescent protein (GFP) and the expression amount of red fluorescent protein (RFP) in KB cell, the result is as shown in table 8.

Table 8

As can be seen from Table 8, the expression amount of goal gene in anthous's tumour cell of 24 hours of transfection recombinant herpes simplex virus of the present invention, the expression amount that all is much higher than transfection prior art recombinant herpes simplex virus 17+ illustrates that the ability of recombinant virus infection of the present invention anthous tumour cell is stronger.

Embodiment 5

The present embodiment explanation contains pharmaceutical composition of virus vector of the present invention and preparation method thereof.

(1) preparation of injection liquid

To prepare one group of phosphate buffered saline buffer respectively according to the dosage shown in the table 9, sterilize 60 minutes down for 121 ℃.Under aseptic condition, herpes simplex virus vector 7 stostes with the known titre of step (1) of 0.45 micron filtering with microporous membrane embodiment 2, perhaps remove cell debris according to the insertion on the gene location of herpes simplex virus vector 7 coding ICP34.5 of embodiment 4 described methods by the reconstitution cell stoste (titre of reconstitution cell stoste is measured according to the method for embodiment 2) of the human GM-CSF gene of the IE promotor guiding of hCMV with 0.45 micron filtering with microporous membrane, collect filtrate to aseptic centrifuge tube, 8000 rev/mins centrifugal 1 hour, supernatant discarded, according to the virus titer shown in the table 9, gained virus vector or recombinant virus precipitation are dispersed in the phosphoric acid buffer behind the above-mentioned high-temperature sterilization, promptly get two groups of (comprising virus vector and recombinant virus respectively) injection liquids of the present invention.

Table 9

Medicine	Prescription	1	Prescription 2	Prescription 3	Prescription 4	Prescription 5	Prescription 6	Prescription 7
									Phosphoric acid buffer (weight %)	99	95	90	85	80	75	70
Inositol (weight %)	1	0	0	10	15	0	10
								Sorbyl alcohol (weight %)	0	5	0	5	0	15	15
Sucrose (weight %)	0	0	10	0	5	10	5
								Osmotic pressure regulator and concentration thereof (mol)	Sodium-chlor 0.9	Repone K 0.5	Sodium-chlor 0.9	Repone K 0.5	Sodium-chlor 0.9	Repone K 0.5	Sodium-chlor 0.9
Osmotic pressure (m osmole/kilogram)	200	300	400	450	500	600	700

In the present embodiment, the negative control medicine is not for containing the ditalimfos acid buffer of virus; The positive control medicine is Cyclophosphamide for injection (CTX), lot number: 050202, and 200 milligrams/of specifications, Hualian Pharmaceutical Co., Ltd., Shanghai produces.

(2) cell levels pharmacodynamic experiment

According to the method for embodiment 2, with the KB cell (CNE-1) of the virus injection liquid inductance yellow colouration ethnic group pilosity of infection multiplicity MOI=1.The result is as shown in table 10.

Table 10

As can be seen from Table 10, injection liquid of the present invention has significant lethal effect to the CNE-1 cell of anthous's pilosity, positive control drug can be in 24 hours the kill tumor cell, but positive control drug is also very big to Normocellular toxicity.In addition, it can also be seen that from table 10, recombinant virus is better than the kill capability of virus vector to tumour cell to the kill capability of tumour, and then illustrate that the pharmaceutical composition that contains recombinant virus of the present invention not only has oncolysis, and can in by the recombinant virus cells transfected, express goal gene.

(3) the restraining effect pharmacodynamic experiment of human colon adenocarcinoma HT-29 transplanted tumor in nude mice growth

Human colon adenocarcinoma HT-29 transplanted tumor in nude mice is available from institute of Materia Medica,Chinese Academy of Medical Sciences, the Balb/c nude mice, and 4-6 age in week, the 16-20 gram, female, available from Chinese Academy of Medical Sciences's Experimental Animal Center.

When the mice with tumor Subcutaneous tumor that goes down to posterity grew to the about 2-3 of diameter centimetre, aseptic condition took out the knurl piece down, according to the ratio of every gram tumor tissues 3-4 ml physiological saline, makes tumour cell homogenate, gives 0.2 milliliter of every mouse right fore armpit subcutaneous vaccination; Perhaps the knurl piece is cut into 1 cubic centimetre tubercle piece, it is subcutaneous to be inoculated into nude mice right side armpit with trochar.

The tumor growth for the treatment of the inoculation of each treated animal is when animal body surface can be observed the lump of 0.6 centimetre of about 0.6 cm x, divide 16 groups (the present invention fill a prescription 14 groups, positive controls, negative control group) at random, 7 every group begin with local injection administration in the virus injection liquid of the present invention of step (1) and positive control medicine, the negative control medicine tumour knurl body.In the 1st day, the 4th day and the 7th day intratumor injection, volumetric injection was 100 microlitres.The dosage of step of the present invention (1) virus vector or recombinant virus is 2.5 * 10 ⁷Pfu/kg, positive control drug are endoxan, and the dosage of positive control drug is 100mg/kg, and the negative control medicine is and the isopyknic phosphoric acid buffer of virus injection liquid of the present invention.After the last administration, weigh weekly, measure the observed gross tumor volume of animal body surface energy, continue to observe about 2 weeks, the gross tumor volume change curve is seen Fig. 5 (virus vector 7+ prescription 2 of the present invention), and animal is put to death in the neck dislocation then, peels off taking-up knurl piece and weighs, can draw the average knurl piece weight of tumor control rate=100% * virus injection liquid group of the present invention or the positive control drug group/average knurl piece of negative control medicine weight, the results are shown in Table 11.The negative contrast medicine of Fig. 4 (first row), positive control drug (second row), virus vector of the present invention 7 prescription 2 injection liquids (the third line) and the recombinant virus of the present invention knurl piece photo that 2 injection liquids (fourth line) are taken out of filling a prescription, the dead mouse of blank position.

Table 11

From table 11 and Fig. 4, Fig. 5 as can be seen, growth has the obvious suppression effect to human colon adenocarcinoma HT-29 transplanted tumor in nude mice for virus vector of the present invention and recombinant virus, of the present invention group inhibiting rate scope is 28.0%-77.0%, though the inhibiting rate of positive control drug to the restraining effect of tumour also clearly, but the mortality ratio of positive control drug is very high, thereby the injection liquid of virus vector of the present invention or recombinant virus is safer.In addition, it can also be seen that the injection liquid that contains recombinant virus has been expressed antineoplastic GM-CSF, so its kill capability to tumour is better than the injection liquid that contains virus vector from table 11.

SEQUENCE?LISTING

＜110〉Beijing OrienGene Biotechnology Ltd.

＜120〉herpes simplex virus vector and recombinant virus and host cell and pharmaceutical composition thereof

<130>I71990YH

<160>14

<170>PatentIn?version?3.4

<210>1

<211>904

<212>PRT

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>1

<210>2

<211>2715

<212>DNA

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>2

<210>3

<211>423

<212>PRT

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>3

<210>4

<211>1537

<212>DNA

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>4

<210>5

<211>394

<212>PRT

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>5

<210>6

<211>1185

<212>DNA

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>6

<210>7

<211>239

<212>PRT

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>7

<210>8

<211>720

<212>DNA

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>8

<210>9

<211>473

<212>PRT

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>9

<210>10

<211>1422

<212>DNA

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>10

<210>11

<211>420

<212>PRT

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>11

<210>12

<211>1264

<212>DNA

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>12

<210>13

<211>512

<212>PRT

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>13

<210>14

<211>1539

<212>DNA

＜213〉herpes simplex virus I-type (Herpes Simplex Virus Type I)

<400>14

Claims (12)

1, a kind of herpes simplex virus vector, the gene of described virus vector disappearance coding infected cell polypeptides 34.5, one or several gene in the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47, described virus vector has envelope protein, it is characterized in that, described envelope protein comprises a kind of aminoacid sequence that this virus vector of promotion infects the host cell function that has, described aminoacid sequence is selected from the aminoacid sequence shown in the SEQ ID:NO.1, aminoacid sequence shown in the SEQ ID:NO.3, aminoacid sequence shown in the SEQ ID:NO.5, aminoacid sequence shown in the SEQ ID:NO.7, aminoacid sequence shown in the SEQ ID:NO.9, and to described SEQ ID:NO.1, SEQ ID:NO.3, SEQ ID:NO.5, aminoacid sequence shown in SEQ ID:NO.7 or the SEQ ID:NO.9 carries out one or several aminoacid replacement, add or disappearance and having of obtaining promote virus vector to infect one or more in the aminoacid sequence of host cell function.

2, virus vector according to claim 1, wherein, described aminoacid sequence is selected from one or more in the aminoacid sequence shown in aminoacid sequence shown in the aminoacid sequence shown in the aminoacid sequence shown in the aminoacid sequence shown in the SEQ ID:NO.1, the SEQ ID:NO.3, the SEQ ID:NO.5, the SEQ ID:NO.7 and the SEQ ID:NO.9.

3, a kind of herpes simplex virus vector, the gene of described virus vector disappearance coding infected cell polypeptides 34.5, one or several gene in the gene of the gene of coding infected cell polypeptides 6 and coding infected cell polypeptides 47, described virus vector has the gene of coding envelope protein, it is characterized in that, described envelope protein comprises a kind of aminoacid sequence that this virus vector of promotion infects the host cell function that has, described aminoacid sequence is selected from the aminoacid sequence shown in the SEQ ID:NO.1, aminoacid sequence shown in the SEQ ID:NO.3, aminoacid sequence shown in the SEQ ID:NO.5, aminoacid sequence shown in the SEQ ID:NO.7, aminoacid sequence shown in the SEQ ID:NO.9, and to described SEQ ID:NO.1, SEQ ID:NO.3, SEQ ID:NO.5, aminoacid sequence shown in SEQ ID:NO.7 or the SEQ ID:NO.9 carries out one or several aminoacid replacement, add or disappearance and having of obtaining promote virus vector to infect one or more in the aminoacid sequence of host cell function.

4, virus vector according to claim 3, wherein, described aminoacid sequence is selected from one or more in the aminoacid sequence shown in aminoacid sequence shown in the aminoacid sequence shown in the aminoacid sequence shown in the aminoacid sequence shown in the SEQ ID:NO.1, the SEQ ID:NO.3, the SEQ ID:NO.5, the SEQ ID:NO.7 and the SEQ ID:NO.9.

5, virus vector according to claim 3, wherein, the gene of described coding envelope protein comprises that a kind of coding has the nucleotide sequence that the promotion virus vector infects the aminoacid sequence of host cell function, described nucleotide sequence is selected from the nucleotide sequence shown in the SEQ ID:NO.2, nucleotide sequence shown in the SEQ ID:NO.4, nucleotide sequence shown in the SEQ ID:NO.6, nucleotide sequence shown in the SEQ ID:NO.8, nucleotide sequence shown in the SEQ ID:NO.10, and to described SEQ ID:NO.2, SEQ ID:NO.4, SEQ ID:NO.6, nucleotide sequence shown in SEQ ID:NO.8 or the SEQ ID:NO.10 carries out that one or several Nucleotide replaces and in the constant nucleotide sequence of the proteins encoded that obtains one or more.

6, virus vector according to claim 5, wherein, the gene of described coding envelope protein comprises that a kind of coding has the nucleotide sequence that the promotion virus vector infects the aminoacid sequence of host cell function, and described nucleotide sequence is selected from one or more in the nucleotide sequence shown in nucleotide sequence shown in the nucleotide sequence shown in the nucleotide sequence shown in the nucleotide sequence shown in the SEQ ID:NO.2, the SEQ ID:NO.4, the SEQ ID:NO.6, the SEQ ID:NO.8 and the SEQ ID:NO.10.

7, a kind of recombinant virus, described recombinant virus comprises virus vector and goal gene, it is characterized in that, described virus vector is any described virus vector among the claim 1-6.

8, the virulent host cell of a kind of infection is characterized in that, described virus is any described virus vector and/or the described recombinant virus of claim 7 among the claim 1-6.

9, a kind of pharmaceutical composition is characterized in that, described pharmaceutical composition comprises any described virus vector and/or the described recombinant virus of claim 7 among the claim 1-6.

10, pharmaceutical composition according to claim 9, wherein, described pharmaceutical composition is an injection liquid, described injection liquid comprises any described virus vector and/or the described recombinant virus of claim 7 among pharmaceutically acceptable carrier and the claim 1-6, contains 10 in every milliliter of described injection liquid ²-10 ¹⁰Plaque forms several described virus vector and/or recombinant virus.

11, pharmaceutical composition according to claim 10, wherein, described pharmaceutically acceptable carrier is the phosphoric acid buffer of pH value for 4.0-9.0.

12, pharmaceutical composition according to claim 10, wherein, described injection liquid also contains protective material and/or osmotic pressure regulator; With described injection liquid is benchmark, and described protectant content is 0.01-30 weight %, and described protective material is selected from one or more in inositol, sorbyl alcohol and the sucrose; It is 200-700 m osmole/kilogram that the content of described osmotic pressure regulator makes the osmotic pressure of described injection liquid, and described osmotic pressure regulator is sodium-chlor and/or Repone K.

Images