CN102121049B - Loop-mediated isothermal amplification technology-based quick campylobacter jejunii detection kit and using method thereof - Google Patents
Loop-mediated isothermal amplification technology-based quick campylobacter jejunii detection kit and using method thereof Download PDFInfo
- Publication number
- CN102121049B CN102121049B CN201010017296XA CN201010017296A CN102121049B CN 102121049 B CN102121049 B CN 102121049B CN 201010017296X A CN201010017296X A CN 201010017296XA CN 201010017296 A CN201010017296 A CN 201010017296A CN 102121049 B CN102121049 B CN 102121049B
- Authority
- CN
- China
- Prior art keywords
- primer
- concentration
- detection kit
- dna
- loop
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a loop-mediated isothermal amplication technology-based quick campylobacter jejunii detection kit and a using method thereof. The kit consists of (1) reaction solution, (2) a primer group, (3) sample pretreatment solution and (4) positive contrast solution, wherein the primer group is one of the following eight primer groups, and each primer group comprises a pair of primers, namely an internal primer and an external primer; and a calcein manganese complex is added in advance in the reaction, the manganese is combined with pyrophosphate radical ions separated by dNTP to release the calcein, the released calcein can be observed and identified by naked eyes, the positive result is yellow green, and the negative result is light yellow. The kit has the advantages of strong specificity, short reaction time, high sensitivity and the like.
Description
Technical field
The present invention relates to biological detection reagent, be specifically related to its using method of detection kit for loop-mediated isothermal amplification technique test sample campylobacter jejuni.
Background technology
Campylobacter jejuni is one of campylobacter member, belong to Gram-negative bacteria, be the infecting both domestic animals and human cause of disease bacterium that recent domestic is extensively paid attention to, mainly cause mankind's heating, acute enteritis, acute infection polyradiculoneuropathy, i.e. Guillain Barre syndrome.This bacterium can pass through in animal carrier or patient's ight soil entered environment, and " the non-cultivation (the viable but noncultureable; the VBNC) resting stage of state; the bacterium that is in the VBNC state can recover under given conditions, and has pathogenic that lives that enters a kind of being called in water surrounding.The contact animal carrier, or take in the main path that the poultry product, water source and the milk that are polluted are this bacterium infection human bodies.
Because the campylobacter jejuni culture condition is harsh, do not grow at 25 ℃, 42 ℃ of well-growns, but easily enter the VBNC state, make conventional separation and Culture and biochemical identification time and effort consuming, sensitivity not high, required time is hidden, and the quick diagnosis when being unfavorable for Outbreak does not meet analysis of clinic pathogenic microorganism yet and detects desired principle fast and accurately.Therefore, set up a kind of fast, letter, detection method is very necessary reliably.
Ring mediated isothermal amplification (Loop-mediated isothermal amplication, LAMP) be that Notomi etc. is in the constant temperature nucleic acid amplification method of a kind of novelty of exploitation in 2000, its principle is 4 Auele Specific Primers of 6 zone design for goal gene, utilize a kind of strand displacement archaeal dna polymerase (Bst DNApolymerase) in 65 ℃ of left and right of isothermal, dozens of minutes can realize the efficient amplification of nucleic acid.Article 4, the identification in 6 of the primer pair target sequence distinguished sequence zones has guaranteed the high degree of specificity of LAMP amplification.LAMP does not need the thermally denature of template, and long-time temperature cycle increases under isothermal condition, can not cause waste of time because of temperature change.The white precipitate that has or not macroscopic magnesium pyrophosphate becomes the simplest method that judges whether nucleic acid increases.Loop-mediated isothermal amplification technique has lot of advantages on the cause of disease nucleic acid detection technique, use but yet there are no method and the detection kit that loop-mediated isothermal amplification technique detects campylobacter jejuni.
Summary of the invention
An object of the present invention is to provide a kind of loop-mediated isothermal amplification technique campylobacter jejuni quick detection kit of (Loop-mediatedisothermal amplicatio of DNA is called for short LAMP), can be widely used in the fields such as food, animal doctor.
To achieve these goals, the present invention adopts following technical scheme:
The present invention is by (1) reaction solution; (2) primer sets; (3) sample pretreatment liquid; (4) positive control solution forms, and described primer sets can be comprised of the arbitrary primer sets in following eight cover primer sets, and every cover primer sets comprises that two pairs of Auele Specific Primers are that inner primer, outer primer form, and is as follows respectively:
Primer sequence is as follows:
Primer sets one:
Inner primer 1:
TGTGCCTACTTTTATATTCTCATCTTTTTCCTCAATCTCGCTTTGGGA
Inner primer 2:
CACGGAAAAAGTATCAATTCTGAATTTTGCCTAAGATGACATTTCTATCAACA
Outer primer 1:ACAAAATTTCAGCCTTTGGT
Outer primer 2:CCTTGAGCACGTTCTTTG
Or primer sets two:
Inner primer 1:
TCCGTGTGTGCCTACTTTTATTTTATTCACGATGTTTTAGGGATTAACG
Inner primer 2:
TGTTGATAGAAATGTCATCTTAGGCTTTTCGACAAGTGCATTATCGAGTA
Outer primer 1:CAGCCTTTGGTCCTCAA
Outer primer 2:TTTGCGCTGCTTTGGTT
Or primer sets three:
Inner primer 1:
TGTGCCTACTTTTATATTCTCATCTTTTTGCTTTGGGATTATTCACGAT
Inner primer 2:
CACGGAAAAAGTATCAATTCTGAATTTTGCCTAAGATGACATTTCTATCAACA
Outer primer 1:CAGCCTTTGGTCCTCAA
Outer primer 2:CATTATCGAGTATGCCTTGAG
Or primer sets four:
Inner primer 1:
CGGTCGATTTTGTTCCAAATTATGATTTTAACCCTAGAAGGTAAAACATCAG
Inner primer 2:
TGCTTCAGTATAACGCATCGCTTTTACAAGGCAACTTTGGATCT
Outer primer 1:AGCTATACCACTTGAACCATT
Outer primer 2:CTATGAGATATCCAAGTATTACAGG
Or primer sets five:
Inner primer 1:
GAACGGCTAAAGGAAAAGCAGTGTTTTATAGCCATGATTTTTTCTTCAGC
Inner primer 2:
CTGTCCACGATCTGTTACAAACATTTTATAGAAAGTTTCTTTACGGCAA
Outer primer 1:CATCAAAATCCGTGGTTGG
Outer primer 2:CCGTTACGACTTATGATGATGA
Or primer sets six:
Inner primer 1:
CGTGAGGCTATGAGTGAAATTGTTTTTTTTTGCCAACATAATCACACC
Inner primer 2:
ACAACGCGGATTCCTTCTTTATTTTTGCAGAGCTTGTTAAAGAAAGG
Outer primer 1:CCAACAAAGAGAAAATTTTAGGTTC
Outer primer 2:GCTAGGCTTATAGAGCAGAT
Or primer sets seven:
Inner primer 1:
GTCGATGTGAATTTTAATGCGGTATTTTGTCAAGCACAACTATTCCTC
Inner primer 2:
AGCATTTAAAACCTTTTGCCCTTCTTTTTCACTTTAGACACTGGTATTGC
Outer primer 1:ACATAAGGTGAATTTTGATCGTT
Outer primer 2:CAATGTTGTGCCAATAAACG
Or primer sets eight:
Inner primer 1:
AGGGCAAAAGGTTTTAAATGCTAAATTTTAATACCGCATTAAAATTCACATC
Inner primer 2:
CAAAGCAATACCAGTGTCTAAAGTGTTTTGGGCTTTTATACATTAGCGATG
Outer primer 1:CTCTAGCTTCAAGTTCTTGTT
Outer primer 2:GGTGGTTTTGAAGCAAAGA
Preferably, described reaction solution is Tris-HCl (pH 8.8), the KCl that concentration is 50mM, (NH4) that concentration is 50mM of 100mM by concentration
2SO4, concentration are that the Bst archaeal dna polymerase of 1.6U, trimethyl-glycine that concentration is 4M, the dNTP that concentration is 6mM-8mM, the MgSO4 that concentration is 30mM-40mM, the fluorexon manganese complex that concentration is 0.01mM-0.1mM form.
Preferably, described sample pretreatment liquid comprises lysate and neutralizer.
Preferably, described lysate is 25mmol/L by concentration NaOH forms.
Preferably, described neutralizer is 1M by concentration Tris-HCl (pH8.0) forms.
The using method of detection kit of the present invention comprises the following steps:
[1] preparation of DNA profiling: get the enrichment liquid of incubated overnight of a transfering loop in the 1.5mL centrifuge tube, add 50 μ L lysate mixings, 100 ℃ of water-bath 10min, add 4 μ L neutralizers, 4 ℃ 20 of suspension, the centrifugal 5min of 000g, go precipitation, supernatant is as DNA profiling.
[2] compound method of campylobacter jejuni amplifing reagent is as follows: get 5 μ L reaction solutions, 2 μ L primer sets, 16 μ LddH2O in an aseptic PCR reaction tubes, add the template 2 μ L that prepared.
[3] loop-mediated isothermal amplification technique reaction process: add 2 μ L DNA profilings to be checked in the reaction tubes that 23 μ L reaction solutions are housed, in 65 ℃ of incubation 60min, 80 ℃ of deactivation 10min stopped reactions.
[4] result is observed: the positive control pipe sends yellow-green fluorescence, and it is positive that sample hose and positive control are homochromy, otherwise negative.
The present invention has set up the campylobacter jejuni LAMP detection kit of improvement, this test kit according to the design of campylobacter jejuni conserved regions inner primer, outer primer.Loop-mediated isothermal amplification is combined from the manganese of pyrophosphate ion in the middle of the fluorexon manganese complex that dNTP separates out, and discharges fluorexon, can pass through the colour-change observations.The loop-mediated isothermal amplification technique that the present invention adopts, have the characteristics such as high specificity, the reaction times is short, sensitivity is high, and the fluorexon manganese complex dyestuff that uses has simply, facilitates, cheaply, product is not easy the characteristics such as pollution, can be widely used in the fields such as food, animal doctor
The invention has the beneficial effects as follows that (1) does not need special reagent and equipment; (2) high specific: use 6 zones, two pairs of primers, the existence that just can judge target substance according to whether increasing whether (3) fast, efficient amplification: 60min left and right detection time (4) is identified easy: result needn't be observed with gel electrophoresis method, add in advance the fluorexon manganese complex in reaction, the tetra-sodium that manganese and dNTP separate out discharges fluorexon with ionic bond, can identify by visual inspection, positive findings is yellow-green colour, and negative findings is light yellow.
The below provides specific examples further to set forth technical scheme of the present invention and beneficial effect, but technology of the present invention application is not limited to example.
Embodiment
Embodiment one
The present invention adopts following technical scheme:
The present invention is by (1) reaction solution; (2) primer sets; (3) sample pretreatment liquid; (4) positive control solution forms, and described primer sets comprises that two pairs of Auele Specific Primers are that inner primer, outer primer form, and is as follows respectively:
Primer sequence is as follows:
Inner primer 1
TGTGCCTACTTTTATATTCTCATCTTTTTCCTCAATCTCGCTTTGGGA
Inner primer 2:
CACGGAAAAAGTATCAATTCTGAATTTTGCCTAAGATGACATTTCTATCAACA
Outer primer 1:ACAAAATTTCAGCCTTTGGT
Outer primer 2:CCTTGAGCACGTTCTTTG
Preferably, described reaction solution is Tris-HCl (pH 8.8), the KCl that concentration is 50mM, (NH4) that concentration is 50mM of 100mM by concentration
2SO4, concentration are that the Bst archaeal dna polymerase of 1.6U, trimethyl-glycine that concentration is 4M, the dNTP that concentration is 6mM-8mM, the MgSO4 that concentration is 30mM-40mM, the fluorexon manganese complex that concentration is 0.01mM-0.1mM form.
Preferably, described sample pretreatment liquid comprises lysate and neutralizer.
Preferably, described lysate is 25mmol/L by concentration NaOH forms.
Preferably, described neutralizer is 1M by concentration Tris-HCl (pH8.0) forms.
The using method of detection kit of the present invention comprises the following steps:
[1] preparation of DNA profiling: get the enrichment liquid of incubated overnight of a transfering loop in the 1.5mL centrifuge tube, add 50 μ L lysate mixings, 100 ℃ of water-bath 10min, add 4 μ L neutralizers, 4 ℃ 20 of suspension, the centrifugal 5min of 000g, go precipitation, supernatant is as DNA profiling.
[2] compound method of campylobacter jejuni amplifing reagent is as follows: get 5 μ L reaction solutions, 2 μ L primer sets, 16 μ LddH2O in an aseptic PCR reaction tubes, add the template 2 μ L that prepared.
[3] loop-mediated isothermal amplification technique reaction process: add 2 μ L DNA profilings to be checked in the reaction tubes that 23 μ L reaction solutions are housed, in 65 ℃ of incubation 60min, 80 ℃ of deactivation 10min stopped reactions.
[4] result is observed: the positive control pipe sends yellow-green fluorescence, and it is positive that sample hose and positive control are homochromy, otherwise negative.
Embodiment two
The present invention adopts following technical scheme:
The present invention is by (1) reaction solution; (2) primer sets; (3) sample pretreatment liquid; (4) positive control solution forms, and described primer sets comprises that two pairs of Auele Specific Primers are that inner primer, outer primer form, and is as follows respectively:
Primer sequence is as follows:
Inner primer 1:
TCCGTGTGTGCCTACTTTTATTTTATTCACGATGTTTTAGGGATTAACG
Inner primer 2:
TGTTGATAGAAATGTCATCTTAGGCTTTTCGACAAGTGCATTATCGAGTA
Outer primer 1:CAGCCTTTGGTCCTCAA
Outer primer 2:TTTGCGCTGCTTTGGTT
Preferably, described reaction solution is Tris-HCl (pH 8.8), the KCl that concentration is 50mM, (NH4) that concentration is 50mM of 100mM by concentration
2SO4, concentration are that the Bst archaeal dna polymerase of 1.6U, trimethyl-glycine that concentration is 4M, the dNTP that concentration is 6mM-8mM, the MgSO4 that concentration is 30mM-40mM, the fluorexon manganese complex that concentration is 0.01mM-0.1mM form.
Preferably, described sample pretreatment liquid comprises lysate and neutralizer.
Preferably, described lysate is 25mmol/L by concentration NaOH forms.
Preferably, described neutralizer is 1M by concentration Tris-HCl (pH8.0) forms.
The using method of detection kit of the present invention comprises the following steps:
[1] preparation of DNA profiling: get the enrichment liquid of incubated overnight of a transfering loop in the 1.5mL centrifuge tube, add 50 μ L lysate mixings, 100 ℃ of water-bath 10min, add 4 μ L neutralizers, 4 ℃ 20 of suspension, the centrifugal 5min of 000g, go precipitation, supernatant is as DNA profiling.
[2] compound method of campylobacter jejuni amplifing reagent is as follows: get 5 μ L reaction solutions, 2 μ L primer sets, 16 μ LddH2O in an aseptic PCR reaction tubes, add the template 2 μ L that prepared.
[3] loop-mediated isothermal amplification technique reaction process: add 2 μ L DNA profilings to be checked in the reaction tubes that 23 μ L reaction solutions are housed, in 65 ℃ of incubation 60min, 80 ℃ of deactivation 10min stopped reactions.
[4] result is observed: the positive control pipe sends yellow-green fluorescence, and it is positive that sample hose and positive control are homochromy, otherwise negative.
Embodiment three
The present invention adopts following technical scheme:
The present invention is by (1) reaction solution; (2) primer sets; (3) sample pretreatment liquid; (4) positive control solution forms, and described primer sets comprises that two pairs of Auele Specific Primers are that inner primer, outer primer form, and is as follows respectively:
Primer sequence is as follows:
Inner primer 1:
TGTGCCTACTTTTATATTCTCATCTTTTTGCTTTGGGATTATTCACGAT
Inner primer 2:
CACGGAAAAAGTATCAATTCTGAATTTTGCCTAAGATGACATTTCTATCAACA
Outer primer 1:CAGCCTTTGGTCCTCAA
Outer primer 2:CATTATCGAGTATGCCTTGAG
Preferably, described reaction solution is Tris-HCl (pH 8.8), the KCl that concentration is 50mM, (NH4) that concentration is 50mM of 100mM by concentration
2SO4, concentration are that the Bst archaeal dna polymerase of 1.6U, trimethyl-glycine that concentration is 4M, the dNTP that concentration is 6mM-8mM, the MgSO4 that concentration is 30mM-40mM, the fluorexon manganese complex that concentration is 0.01mM-0.1mM form.
Preferably, described sample pretreatment liquid comprises lysate and neutralizer.
Preferably, described lysate is 25mmol/L by concentration NaOH forms.
Preferably, described neutralizer is 1M by concentration Tris-HCl (pH8.0) forms.
The using method of detection kit of the present invention comprises the following steps:
[1] preparation of DNA profiling: get the enrichment liquid of incubated overnight of a transfering loop in the 1.5mL centrifuge tube, add 50 μ L lysate mixings, 100 ℃ of water-bath 10min, add 4 μ L neutralizers, 4 ℃ 20 of suspension, the centrifugal 5min of 000g, go precipitation, supernatant is as DNA profiling.
[2] compound method of campylobacter jejuni amplifing reagent is as follows: get 5 μ L reaction solutions, 2 μ L primer sets, 16 μ LddH2O in an aseptic PCR reaction tubes, add the template 2 μ L that prepared.
[3] loop-mediated isothermal amplification technique reaction process: add 2 μ L DNA profilings to be checked in the reaction tubes that 23 μ L reaction solutions are housed, in 65 ℃ of incubation 60min, 80 ℃ of deactivation 10min stopped reactions.
[4] result is observed: the positive control pipe sends yellow-green fluorescence, and it is positive that sample hose and positive control are homochromy, otherwise negative.
Embodiment four
The present invention adopts following technical scheme:
The present invention is by (1) reaction solution; (2) primer sets; (3) sample pretreatment liquid; (4) positive control solution forms, and described primer sets comprises that two pairs of Auele Specific Primers are that inner primer, outer primer form, and is as follows respectively:
Primer sequence is as follows:
Inner primer 1:
CGGTCGATTTTGTTCCAAATTATGATTTTAACCCTAGAAGGTAAAACATCAG
Inner primer 2:
TGCTTCAGTATAACGCATCGCTTTTACAAGGCAACTTTGGATCT
Outer primer 1:AGCTATACCACTTGAACCATT
Outer primer 2:CTATGAGATATCCAAGTATTACAGG
Preferably, described reaction solution is Tris-HCl (pH 8.8), the KCl that concentration is 50mM, (NH4) that concentration is 50mM of 100mM by concentration
2SO4, concentration are that the Bst archaeal dna polymerase of 1.6U, trimethyl-glycine that concentration is 4M, the dNTP that concentration is 6mM-8mM, the MgSO4 that concentration is 30mM-40mM, the fluorexon manganese complex that concentration is 0.01mM-0.1mM form.
Preferably, described sample pretreatment liquid comprises lysate and neutralizer.
Preferably, described lysate is 25mmol/L by concentration NaOH forms.
Preferably, described neutralizer is 1M by concentration Tris-HCl (pH8.0) forms.
The using method of detection kit of the present invention comprises the following steps:
[1] preparation of DNA profiling: get the enrichment liquid of incubated overnight of a transfering loop in the 1.5mL centrifuge tube, add 50 μ L lysate mixings, 100 ℃ of water-bath 10min, add 4 μ L neutralizers, 4 ℃ 20 of suspension, the centrifugal 5min of 000g, go precipitation, supernatant is as DNA profiling.
[2] compound method of campylobacter jejuni amplifing reagent is as follows: get 5 μ L reaction solutions, 2 μ L primer sets, 16 μ LddH2O in an aseptic PCR reaction tubes, add the template 2 μ L that prepared.
[3] loop-mediated isothermal amplification technique reaction process: add 2 μ L DNA profilings to be checked in the reaction tubes that 23 μ L reaction solutions are housed, in 65 ℃ of incubation 60min, 80 ℃ of deactivation 10min stopped reactions.
[4] result is observed: the positive control pipe sends yellow-green fluorescence, and it is positive that sample hose and positive control are homochromy, otherwise negative.
Embodiment five
The present invention adopts following technical scheme:
The present invention is by (1) reaction solution; (2) primer sets; (3) sample pretreatment liquid; (4) positive control solution forms, and described primer sets comprises that two pairs of Auele Specific Primers are that inner primer, outer primer form, and is as follows respectively:
Primer sequence is as follows:
Inner primer 1:
GAACGGCTAAAGGAAAAGCAGTGTTTTATAGCCATGATTTTTTCTTCAGC
Inner primer 2:
CTGTCCACGATCTGTTACAAACATTTTATAGAAAGTTTCTTTACGGCAA
Outer primer 1:CATCAAAATCCGTGGTTGG
Outer primer 2:CCGTTACGACTTATGATGATGA
Preferably, described reaction solution is Tris-HCl (pH 8.8), the KCl that concentration is 50mM, (NH4) that concentration is 50mM of 100mM by concentration
2SO4, concentration are that the Bst archaeal dna polymerase of 1.6U, trimethyl-glycine that concentration is 4M, the dNTP that concentration is 6mM-8mM, the MgSO4 that concentration is 30mM-40mM, the fluorexon manganese complex that concentration is 0.01mM-0.1mM form.
Preferably, described sample pretreatment liquid comprises lysate and neutralizer.
Preferably, described lysate is 25mmol/L by concentration NaOH forms.
Preferably, described neutralizer is 1M by concentration Tris-HCl (pH8.0) forms.
The using method of detection kit of the present invention comprises the following steps:
[1] preparation of DNA profiling: get the enrichment liquid of incubated overnight of a transfering loop in the 1.5mL centrifuge tube, add 50 μ L lysate mixings, 100 ℃ of water-bath 10min, add 4 μ L neutralizers, 4 ℃ 20 of suspension, the centrifugal 5min of 000g, go precipitation, supernatant is as DNA profiling.
[2] compound method of campylobacter jejuni amplifing reagent is as follows: get 5 μ L reaction solutions, 2 μ L primer sets, 16 μ L ddH2O in an aseptic PCR reaction tubes, add the template 2 μ L that prepared.
[3] loop-mediated isothermal amplification technique reaction process: add 2 μ L DNA profilings to be checked in the reaction tubes that 23 μ L reaction solutions are housed, in 65 ℃ of incubation 60min, 80 ℃ of deactivation 10min stopped reactions.
[4] result is observed: the positive control pipe sends yellow-green fluorescence, and it is positive that sample hose and positive control are homochromy, otherwise negative.
Embodiment six
The present invention adopts following technical scheme:
The present invention is by (1) reaction solution; (2) primer sets; (3) sample pretreatment liquid; (4) positive control solution forms, and described primer sets comprises that two pairs of Auele Specific Primers are that inner primer, outer primer form, and is as follows respectively: (each primer has or not concentration requirement)
Primer sequence is as follows:
Inner primer 1:
CGTGAGGCTATGAGTGAAATTGTTTTTTTTTGCCAACATAATCACACC
Inner primer 2:
ACAACGCGGATTCCTTCTTTATTTTTGCAGAGCTTGTTAAAGAAAGG
Outer primer 1:CCAACAAAGAGAAAATTTTAGGTTC
Outer primer 2:GCTAGGCTTATAGAGCAGAT
Preferably, described reaction solution is Tris-HCl (pH 8.8), the KCl that concentration is 50mM, (NH4) that concentration is 50mM of 100mM by concentration
2SO4, concentration are that the Bst archaeal dna polymerase of 1.6U, trimethyl-glycine that concentration is 4M, the dNTP that concentration is 6mM-8mM, the MgSO4 that concentration is 30mM-40mM, the fluorexon manganese complex that concentration is 0.01mM-0.1mM form.
Preferably, described sample pretreatment liquid comprises lysate and neutralizer.
Preferably, described lysate is 25mmol/L by concentration NaOH forms.
Preferably, described neutralizer is 1M by concentration Tris-HCl (pH8.0) forms.
The using method of detection kit of the present invention comprises the following steps:
[1] preparation of DNA profiling: get the enrichment liquid of incubated overnight of a transfering loop in the 1.5mL centrifuge tube, add 50 μ L lysate mixings, 100 ℃ of water-bath 10min, add 4 μ L neutralizers, 4 ℃ 20 of suspension, the centrifugal 5min of 000g, go precipitation, supernatant is as DNA profiling.
[2] compound method of campylobacter jejuni amplifing reagent is as follows: get 5 μ L reaction solutions, 2 μ L primer sets, 16 μ LddH2O in an aseptic PCR reaction tubes, add the template 2 μ L that prepared.
[3] loop-mediated isothermal amplification technique reaction process: add 2 μ L DNA profilings to be checked in the reaction tubes that 23 μ L reaction solutions are housed, in 65 ℃ of incubation 60min, 80 ℃ of deactivation 10min stopped reactions.
[4] result is observed: the positive control pipe sends yellow-green fluorescence, and it is positive that sample hose and positive control are homochromy, otherwise negative.
Embodiment seven
The present invention adopts following technical scheme:
The present invention is by (1) reaction solution; (2) primer sets; (3) sample pretreatment liquid; (4) positive control solution forms, and described primer sets comprises that two pairs of Auele Specific Primers are that inner primer, outer primer form, and is as follows respectively:
Primer sequence is as follows:
Inner primer 1:
GTCGATGTGAATTTTAATGCGGTATTTTGTCAAGCACAACTATTCCTC
Inner primer 2:
AGCATTTAAAACCTTTTGCCCTTCTTTTTCACTTTAGACACTGGTATTGC
Outer primer 1:ACATAAGGTGAATTTTGATCGTT
Outer primer 2:CAATGTTGTGCCAATAAACG
Preferably, described reaction solution is Tris-HCl (pH 8.8), the KCl that concentration is 50mM, (NH4) that concentration is 50mM of 100mM by concentration
2SO4, concentration are that the Bst archaeal dna polymerase of 1.6U, trimethyl-glycine that concentration is 4M, the dNTP that concentration is 6mM-8mM, the MgSO4 that concentration is 30mM-40mM, the fluorexon manganese complex that concentration is 0.01mM-0.1mM form.
Preferably, described sample pretreatment liquid comprises lysate and neutralizer.
Preferably, described lysate is 25mmol/L by concentration NaOH forms.
Preferably, described neutralizer is 1M by concentration Tris-HCl (pH8.0) forms.
The using method of detection kit of the present invention comprises the following steps:
[1] preparation of DNA profiling: get the enrichment liquid of incubated overnight of a transfering loop in the 1.5mL centrifuge tube, add 50 μ L lysate mixings, 100 ℃ of water-bath 10min, add 4 μ L neutralizers, 4 ℃ 20 of suspension, the centrifugal 5min of 000g, go precipitation, supernatant is as DNA profiling.
[2] compound method of campylobacter jejuni amplifing reagent is as follows: get 5 μ L reaction solutions, 2 μ L primer sets, 16 μ LddH2O in an aseptic PCR reaction tubes, add the template 2 μ L that prepared.
[3] loop-mediated isothermal amplification technique reaction process: add 2 μ L DNA profilings to be checked in the reaction tubes that 23 μ L reaction solutions are housed, in 65 ℃ of incubation 60min, 80 ℃ of deactivation 10min stopped reactions.
[4] result is observed: the positive control pipe sends yellow-green fluorescence, and it is positive that sample hose and positive control are homochromy, otherwise negative.
Embodiment eight
The present invention adopts following technical scheme:
The present invention is by (1) reaction solution; (2) primer sets; (3) sample pretreatment liquid; (4) positive control solution forms, and described primer sets comprises that two pairs of Auele Specific Primers are that inner primer, outer primer form, and is as follows respectively: (each primer has or not concentration requirement)
Primer sequence is as follows:
Inner primer 1:
AGGGCAAAAGGTTTTAAATGCTAAATTTTAATACCGCATTAAAATTCACATC
Inner primer 2:
CAAAGCAATACCAGTGTCTAAAGTGTTTTGGGCTTTTATACATTAGCGATG
Outer primer 1:CTCTAGCTTCAAGTTCTTGTT
Outer primer 2:GGTGGTTTTGAAGCAAAGA
Preferably, described reaction solution is Tris-HCl (pH 8.8), the KCl that concentration is 50mM, (NH4) that concentration is 50mM of 100mM by concentration
2SO4, concentration are that the Bst archaeal dna polymerase of 1.6U, trimethyl-glycine that concentration is 4M, the dNTP that concentration is 6mM-8mM, the MgSO4 that concentration is 30mM-40mM, the fluorexon manganese complex that concentration is 0.01mM-0.1mM form.
Preferably, described sample pretreatment liquid comprises lysate and neutralizer.
Preferably, described lysate is 25mmol/L by concentration NaOH forms.
Preferably, described neutralizer is 1M by concentration Tris-HCl (pH8.0) forms.
The using method of detection kit of the present invention comprises the following steps:
[1] preparation of DNA profiling: get the enrichment liquid of incubated overnight of a transfering loop in the 1.5mL centrifuge tube, add 50 μ L lysate mixings, 100 ℃ of water-bath 10min, add 4 μ L neutralizers, 4 ℃ 20 of suspension, the centrifugal 5min of 000g, go precipitation, supernatant is as DNA profiling.
[2] compound method of campylobacter jejuni amplifing reagent is as follows: get 5 μ L reaction solutions, 2 μ L primer sets, 16 μ L ddH2O in an aseptic PCR reaction tubes, add the template 2 μ L that prepared.
[3] loop-mediated isothermal amplification technique reaction process: add 2 μ L DNA profilings to be checked in the reaction tubes that 23 μ L reaction solutions are housed, in 65 ℃ of incubation 60min, 80 ℃ of deactivation 10min stopped reactions.
[4] result is observed: the positive control pipe sends yellow-green fluorescence, and it is positive that sample hose and positive control are homochromy, otherwise negative.
Inner primer in above each embodiment, the concentration of outer primer are that inner primer: 12 μ M-20 μ M, outer primer concentration are 2 μ M-5 μ M.
Sequence table
<110〉Jiangsu Inst. of Fowls Science
<120〉based on campylobacter jejuni quick detection kit and the using method thereof of loop-mediated isothermal amplification technique
<160>32
<170>PatentIn?version?3.2
<210>1
<211>48
<212>DNA
<213〉artificial sequence
<400>1
Inner primer FIP:TGTGCCTACTTTTATATTCTCATCTTTTTCCTCAATCTCGCTTTGGGA
<210>2
<211>53
<212>DNA
<213〉artificial sequence
<400>2
Inner primer BIP:CACGGAAAAAGTATCAATTCTGAATTTTGCCTAAGATGACATTTCTATCAAC A
<210>3
<211>20
<212>DNA
<213〉artificial sequence
<400>3
Outer primer F3:ACAAAATTTCAGCCTTTGGT
<210>4
<211>19
<212>DNA
<213〉artificial sequence
<400>4
Outer primer B3:CCTTGAGCACGTTCTTTG
<210>5
<211>49
<212>DNA
<213〉artificial sequence
<400>5
Inner primer FIP:TCCGTGTGTGCCTACTTTTATTTTATTCACGATGTTTTAGGGATTAACG
<210>6
<211>50
<212>DNA
<213〉artificial sequence
<400>6
Inner primer BIP:TGTTGATAGAAATGTCATCTTAGGCTTTTCGACAAGTGCATTATCGAGTA
<210>7
<211>17
<212>DNA
<213〉artificial sequence
<400>7
Outer primer F3:CAGCCTTTGGTCCTCAA
<210>8
<211>17
<212>DNA
<213〉artificial sequence
<400>8
Outer primer B3:TTTGCGCTGCTTTGGTT
<210>9
<211>49
<212>DNA
<213〉artificial sequence
<400>9
Inner primer FIP:TGTGCCTACTTTTATATTCTCATCTTTTTGCTTTGGGATTATTCACGAT
<210>10
<211>53
<212>DNA
<213〉artificial sequence
<400>10
Inner primer BIP:CACGGAAAAAGTATCAATTCTGAATTTTGCCTAAGATGACATTTCTATCAAC A
<210>11
<211>17
<212>DNA
<213〉artificial sequence
<400>11
Outer primer F3:CAGCCTTTGGTCCTCAA
<210>12
<211>21
<212>DNA
<213〉artificial sequence
<400>12
Outer primer B3:CATTATCGAGTATGCCTTGAG
<210>13
<211>52
<212>DNA
<213〉artificial sequence
<400>13
Inner primer FIP:CGGTCGATTTTGTTCCAAATTATGATTTTAACCCTAGAAGGTAAAACATCAG
<210>14
<211>44
<212>DNA
<213〉artificial sequence
<400>14
Inner primer BIP:TGCTTCAGTATAACGCATCGCTTTTACAAGGCAACTTTGGATCT
<210>15
<211>21
<212>DNA
<213〉artificial sequence
<400>15
Outer primer F3:AGCTATACCACTTGAACCATT
<210>16
<211>25
<212>DNA
<213〉artificial sequence
<400>16
Outer primer B3:CATTATCGAGTATGCCTTGAG
<210>17
<211>50
<212>DNA
<213〉artificial sequence
<400>17
Inner primer FIP:GAACGGCTAAAGGAAAAGCAGTGTTTTATAGCCATGATTTTTTCTTCAGC
<210>18
<211>49
<212>DNA
<213〉artificial sequence
<400>18
Inner primer BIP:CTGTCCACGATCTGTTACAAACATTTTATAGAAAGTTTCTTTACGGCAA
<210>19
<211>19
<212>DNA
<213〉artificial sequence
<400>19
Outer primer F3:CATCAAAATCCGTGGTTGG
<210>20
<211>22
<212>DNA
<213〉artificial sequence
<400>20
Outer primer B3:CCGTTACGACTTATGATGATGA
<210>21
<211>48
<212>DNA
<213〉artificial sequence
<400>21
Inner primer FIP:CGTGAGGCTATGAGTGAAATTGTTTTTTTTTGCCAACATAATCACACC
<210>22
<211>47
<212>DNA
<213〉artificial sequence
<400>22
Inner primer BIP:ACAACGCGGATTCCTTCTTTATTTTTGCAGAGCTTGTTAAAGAAAGG
<210>23
<211>25
<212>DNA
<213〉artificial sequence
<400>23
Outer primer F3:CCAACAAAGAGAAAATTTTAGGTTC
<210>24
<211>20
<212>DNA
<213〉artificial sequence
<400>24
Outer primer B3:GCTAGGCTTATAGAGCAGAT
<210>25
<211>48
<212>DNA
<213〉artificial sequence
<400>25
Inner primer FIP:GTCGATGTGAATTTTAATGCGGTATTTTGTCAAGCACAACTATTCCTC
<210>26
<211>50
<212>DNA
<213〉artificial sequence
<400>26
Inner primer BIP:AGCATTTAAAACCTTTTGCCCTTCTTTTTCACTTTAGACACTGGTATTGC
<210>27
<211>23
<212>DNA
<213〉artificial sequence
<400>27
Outer primer F3:ACATAAGGTGAATTTTGATCGTT
<210>28
<211>20
<212>DNA
<213〉artificial sequence
<400>28
Outer primer B3:CAATGTTGTGCCAATAAACG
<210>29
<211>53
<212>DNA
<213〉artificial sequence
<400>29
Inner primer FIP:AGGGCAAAAGGTTTTAAATGCTAAATTTTAATACCGCATTAAAATTCACATC
<210>30
<211>51
<212>DNA
<213〉artificial sequence
<400>30
Inner primer BIP:CAAAGCAATACCAGTGTCTAAAGTGTTTTGGGCTTTTATACATTAGCGATG
<210>31
<211>21
<212>DNA
<213〉artificial sequence
<400>31
Outer primer F3:CTCTAGCTTCAAGTTCTTGTT
<210>32
<211>19
<212>DNA
<213〉artificial sequence
<400>32
Outer primer B3:GGTGGTTTTGAAGCAAAGA
Claims (5)
1. campylobacter jejuni quick detection kit based on loop-mediated isothermal amplification technique is by (1) reaction solution; (2) primer sets; (3) sample pretreatment liquid; (4) positive control solution forms, and it is characterized in that, described primer sets is comprised of the following primer group, and primer sets comprises that two pairs of Auele Specific Primers are that inner primer, outer primer form, and is as follows respectively:
Primer sequence is as follows:
Inner primer 1:CGGTCGATTTTGTTCCAAATTATGATTTTAACCCTAGAAGGTAAAACATCAG
Inner primer 2:TGCTTCAGTATAACGCATCGCTTTTACAAGGCAACTTTGGATCT
Outer primer 1:AGCTATACCACTTGAACCATT
Outer primer 2:CTATGAGATATCCAAGTATTACAGG.
2. quick detection kit according to claim 1, is characterized in that, described reaction solution is that 100mM, pH value are 8.8 Tris-HCl, the KCl that concentration is 50mM, (NH4) that concentration is 50mM by concentration
2SO4, concentration are that the Bst archaeal dna polymerase of 1.6U, trimethyl-glycine that concentration is 4M, the dNTP that concentration is 6mM-8mM, the MgSO4 that concentration is 30mM-40mM, the fluorexon manganese complex that concentration is 0.01mM-0.1mM form.
3. quick detection kit according to claim 1, is characterized in that, described sample pretreatment liquid comprises lysate and neutralizer.
4. quick detection kit according to claim 3, is characterized in that, the NaOH that described lysate is 25mmol/L by concentration forms.
5. quick detection kit according to claim 3, is characterized in that, described neutralizer is that 1M, pH value are that 8.0 Tris-HCl forms by concentration.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201010017296XA CN102121049B (en) | 2010-01-08 | 2010-01-08 | Loop-mediated isothermal amplification technology-based quick campylobacter jejunii detection kit and using method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201010017296XA CN102121049B (en) | 2010-01-08 | 2010-01-08 | Loop-mediated isothermal amplification technology-based quick campylobacter jejunii detection kit and using method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102121049A CN102121049A (en) | 2011-07-13 |
CN102121049B true CN102121049B (en) | 2013-05-15 |
Family
ID=44249717
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201010017296XA Expired - Fee Related CN102121049B (en) | 2010-01-08 | 2010-01-08 | Loop-mediated isothermal amplification technology-based quick campylobacter jejunii detection kit and using method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102121049B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106367516B (en) * | 2016-09-28 | 2019-08-23 | 扬州大学 | Detect the loop-mediated isothermal amplification kit and detection method of campylobacter jejuni |
CN111020039B (en) * | 2019-12-30 | 2022-12-09 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Campylobacter jejuni species specific molecular target and rapid detection method thereof |
-
2010
- 2010-01-08 CN CN201010017296XA patent/CN102121049B/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN102121049A (en) | 2011-07-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102286633B (en) | Avian infectious bronchitis virus quick detection kit based on loop-mediated isothermal amplification technology and application method thereof | |
CN106434885A (en) | Method and primer for fast detecting vibrio cholerae group O1 at constant temperature and application | |
CN106498087B (en) | Clostridium perfringens dry pulverization LAMP (loop-mediated isothermal amplification) rapid detection kit and use method thereof | |
Yang et al. | Development and evaluation of a loop-mediated isothermal amplification assay for the rapid detection of Staphylococcus aureus in food | |
CN101880709B (en) | Salmonella enteritidis detection reagent kit and method based on loop-mediated isothermal amplification technology | |
CN106367413A (en) | Nucleic acid amplification method and application | |
US9670478B2 (en) | Method for modifying nucleic acids | |
CN102827925A (en) | Non-diagnostic method for detecting Vibrio vulnificus through TaqMan probe fluorescence RT-PCR | |
CN102367475A (en) | M-PCR (multiplex-polymerase chain reaction) detection kit for different serotype vibrio cholerae and detection method thereof | |
CN107164497A (en) | Loop-mediated isothermal amplification technique detects the primer and kit of pseudomonas aeruginosa | |
CN104372099B (en) | A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method | |
CN101368203B (en) | Primer, reagent kit and detection method for monotonic increasing Listeria hymenial veil mediated isothermality amplification technique fast detection | |
CN102094090A (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
CN101565753B (en) | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
CN102121049B (en) | Loop-mediated isothermal amplification technology-based quick campylobacter jejunii detection kit and using method thereof | |
CN101368204B (en) | Fast detection primer and reagent kit for enterobacter sakazakii hymenial veil mediated isothermality amplification technique | |
CN101555529B (en) | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof | |
CA2597835A1 (en) | Method for detecting viable cells in a sample by using a virus | |
CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
CN103014156B (en) | Loop mediated isothermal amplification detection primer group, detection method and kit for enterococcus faecalis | |
CN102220424B (en) | Rapid detection method for enterococcus, detection primer group and detection kit | |
CN101875967A (en) | Method for quickly testing food-borne pathogenic bacteria | |
CN106434900A (en) | Method for conducting rapid constant-temperature detection on vibrio vulnificus and vibrio cholerae simultaneously, primer and kit | |
Charoenpanich et al. | A pH sensitive, loop-mediated isothermal amplification assay for detection of Salmonella in food | |
CN102140519B (en) | Salmonella detection kit based on fimY gene |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130515 Termination date: 20150108 |
|
EXPY | Termination of patent right or utility model |