CN102121029B - Plant expression vector and construction method thereof, and method for producing chicken alpha interferon by utilizing crowtoe as bioreactor - Google Patents
Plant expression vector and construction method thereof, and method for producing chicken alpha interferon by utilizing crowtoe as bioreactor Download PDFInfo
- Publication number
- CN102121029B CN102121029B CN2010105791735A CN201010579173A CN102121029B CN 102121029 B CN102121029 B CN 102121029B CN 2010105791735 A CN2010105791735 A CN 2010105791735A CN 201010579173 A CN201010579173 A CN 201010579173A CN 102121029 B CN102121029 B CN 102121029B
- Authority
- CN
- China
- Prior art keywords
- milligrams
- root
- expression vector
- stem
- value
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to a plant expression vector and a construction method thereof, and a method for producing chicken alpha interferon by utilizing crowtoe as a bioreactor, belonging to the technical field of biology. The plane expression vector pSFRLH is shown as the figure 1 in the specification. In the invention, main stem sections, rachis stem sections and tender leaves of crowtoe are used as explants, and a constructed plane expression vector chicken alpha interferon gene ChIFN-alpha is subjected to genetic transformation and regeneration and then subjected to PCR (Polymerase Chain Reaction), RT-PCR (Reverse Transcription-Polymerase Chain Reaction), Southern blot, Western blot and ELISA (Enzyme-Linked Immuno Sorbent Assay). Proved by a detection result, the ChIFN-alpha gene is integrated into a crowtoe chromosome genome and correctly transcribed, translated and expressed, and recombinant protein can be neutralized by a ChIFN-alpha antibody. The invention lays the foundation for producing animal medical protein by utilizing crowtoe pasture grass as a bioreactor and provides a new thinking for the control of animal epidemic diseases.
Description
Technical field
Biotinylated biomolecule technical transform of the present invention field, particularly relating to a kind of is the method that bio-reactor is produced the pharmaceutical protein chicken alpha-interferon with Root or stem of Littleleaf Indianmulberry herbage.
Background technology
IFN-(Alpha interferon, IFN-α) is one type and has powerful and the cytokine broad-spectrum disease resistance toxic action, is the important composition of animal body system of defense, finds at chick chorioallantoic membrane when studying flu virus interference in nineteen fifty-seven.Chicken alpha-interferon (chicken alpha interferon, ChIFN-α) all has restraining effect to bird flu (AIV), newcastle disease (NDV), infectious bursal disease (IBDV), infectious bronchitis (IBV), Marek (MDV) and rous sarcoma viruses such as (RSV).These virus diseases are important transmissible diseases of harm aviculture development, usually cause great financial loss, are the chicken virus of representative in the last few years with the high pathogenic avian influenza even are also threatening human beings'health.Although the clinical value of Interferon, rabbit is high, but seriously restricting the widespread use of Interferon, rabbit in aviculture with the sky high cost of microbial fermentation and zooblast production.
The plant production system is becoming the significant concern object of biological technical field in recent years with its effective expression to recombinant protein, low cost and security.Research shows to have human interferon gene (the HuIFN-α/β) in plants such as cucumber, pumpkin, lettuce and paddy rice, can correctly be expressed of BA.Contain the forage plant of foreign interferon through directly feeding, not only can reduce labour intensity, and the chicken crowd that can also avoid vaccination to cause stress wait problem.It is active constant that ChIFN-α still keeps when pH2.0, Heat stability is good, and the herbage that contains ChIFN-α can also be used for the processing of ensilage etc. in theory.Therefore carry out an Interferon, rabbit production alternative approach beyond doubt with plant as bio-reactor.Root or stem of Littleleaf Indianmulberry (Lotus cirniculatus L.) is perennial high-quality legume forage; Extensive management, herbaceous stem is delicate, good palatability; Protein contnt is high, uses Root or stem of Littleleaf Indianmulberry can when quality protein is provided, reach the purpose of improving body's immunity as recipient plant.
Summary of the invention
This research imports good southern leguminous forage Leo Root or stem of Littleleaf Indianmulberry through agrobacterium-mediated transformation with functional protein gene (chicken ChIFN-α gene); Resistant plant to obtaining carries out PCR, RT-PCR, Southern blot, Western blot and ELISA check and analysis; The proof functional gene has obtained correctly to transcribe and accurate translation in acceptor herbage, for the transgenic Root or stem of Littleleaf Indianmulberry of strengthening immunity behind the cultivation animal edible provides basic basis.This research has certain meaning to the new way of preventing and treating of exploring virus diseases such as bird flu with the safety in production that guarantees poultry.
This research purpose is to express through the Root or stem of Littleleaf Indianmulberry plant bioreactor to produce animal pharmaceutical protein chicken alpha-interferon, greatly reduces production costs, and when to animal quality protein being provided, improves the collection immunity of organisms.
A kind of plant expression vector is characterized in that: be inserted with the gene fragment of coding chicken alpha-interferon in the skeleton carrier, its promotor is the CaMV35S constitutive promoter.
Said skeleton carrier is pSH737, and the gene fragment of coding chicken alpha-interferon is inserted between the XbaI and KpnI restriction enzyme site of skeleton carrier.
Said plant expression vector is pSFRLH, and its structure is as shown in Figure 1.
The construction process of above-mentioned plant expression vector comprises the steps:
(1) synthesize like the described ChIFN-α of SEQ ID NO1 gene order, be building up on the pBSK (+), obtain the pBSK-BNANSI plasmid,
(2) be template with plasmid pBSK-BNANSI, use P
IFNA1/ P
IFNA-LHThe primer expansion contains histidine-tagged ChIFN-alpha gene fragment,
P
IFNA1：5′-GT
TCTAGAATGGCTGTTCCAGCTTCTC-3′；
P
IFNA-LH：5′-CG
GGTACCCTATTAGTGGTGGTGGTGGTGGTGGGATCCAGATCCTCCCTAGGTCCTGGTGTTTCCG-3′，
(3) amplified production and carrier pSH737 reclaim ChIFN-α gene small segment and the big fragment of pSH737 plasmid respectively through XbaI and KpnI double digestion, connect with the T4DNA ligase enzyme, make up the ChIFN-α plant expression vector of CaMV35S promoters driven.
Utilize the method for Root or stem of Littleleaf Indianmulberry, it is characterized in that: with the above-mentioned plant statement of agriculture bacillus mediated employing carrier idling Root or stem of Littleleaf Indianmulberry for the bio-reactor chicken alpha-interferon.
Said method comprises the steps:
A, conversion host: above-mentioned recombinant vectors changes agrobacterium tumefaciens EHA105 over to freeze-thaw method,
The preparation of B, agrobacterium tumefaciens: the fresh Agrobacterium bacterium liquid that carries above-mentioned recombinant vectors is inoculated in and is cultured to the growth logarithmic phase in the YEP liquid nutrient medium, the resuspended thalline of centrifugal back MS,
C, dip-dye and screening: the Root or stem of Littleleaf Indianmulberry explant drops in the resuspended bacterium liquid of MS, and fully contact is infected the back and cultivated altogether in the dark place, and explant changes over to and takes off bacterium culture medium and take off bacterium and cultivate behind the 2d, screens callus and evoking adventive bud afterwards,
D, break up, take root, transplant: when the differentiation resistant buds grows to 3-4cm, downcut and go to the root media root induction, transplant behind the well developed root system.
Said resuspended thalline OD600 is 0.1-0.2, and time of infection 8 minutes was cultivated 2 days altogether.
Wherein 1L YEP cultivates to concentrate and comprises: 5.0g peptone, 5.0g yeast extract, 2.5gNaCl, 45.0mg kantlex, 20mg Rifampin, pH value 7.20.。
Wherein comprise in the 1L MS substratum: 1900 milligrams in saltpetre (KN03), 1650 milligrams in an ammonium nitrate (NH4NO3), 440 milligrams in calcium chloride (CaCl22H2O), 370 milligrams in sal epsom (MgSO47H2O); 170 milligrams of potassium primary phosphates (KH2PO4), 22.3 milligrams of manganous sulfates (MnSO44H2O), 8.6 milligrams in zinc sulfate (ZnSO47H2O), 6.2 milligrams of boric acid (H2BO3); 0.83 milligram of potassiumiodide (KI), 0.25 milligram of Sodium orthomolybdate (Na2MoO42H2O), 37.25 milligrams of EDTA Disodiums (Na2-EDTA.2H2O), 27.8 milligrams in ferrous sulfate (FeSO47H2O); 0.025 milligram in copper sulfate (CuSO45H2O), 0.025 milligram of NSC 51149 (COCl26H2O), 100 milligrams of inositols; 0.5 milligram in nicotinic acid, 0.1 milligram of vitamin (dimension B1), 0.5 milligram of pyridoxine hydrochloride (dimension B6); 2 milligrams of glycocoll, pH value 5.80
Wherein contain Syringylethanone and the 30g/L sucrose of 4.3g/L MS, 200 μ M in the resuspended substratum of MS, the pH value is 6.0.
Contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 300mg/L cephamycin, 30g/L sucrose and 6g/L agar in the said callus inducing medium; Contain Syringylethanone, 30g/L sucrose and the 6g/L agar of 4.3g/L MS, 200 μ M altogether in the substratum, the pH value is 6.0; Take off and contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 350mg/L cephamycin, 30g/L sucrose and 6g/L agar in the bacterium culture medium; Contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 300mg/L cephamycin, 30g/L sucrose and 6g/L agar in the division culture medium, the pH value is 6.0; Contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 300mg/L cephamycin, 45.0mg/L kantlex, 30g/L sucrose and 6g/L agar in the screening culture medium, the pH value is 6.0; Contain in the root media; 2.15g/L MS, 0.2mg/L second diindyl butyric acid, 300mg/L cephamycin, 30g/L sucrose and 6g/L agar, the pH value is 6.0.
The culture condition in each stage of plant tissue culture is: callus induction is dark cultivation with cultivating altogether; Differentiation, screen and take root and be that illumination cultivation, light intensity are 3800lux, 16h/d.Said explant is Root or stem of Littleleaf Indianmulberry stem, scape or tender leaf.
The present invention contains KpnI/SalI and XhoI restriction enzyme site according to chicken interferon sequences Design and synthetic ChIFN-α genes of SEQ ID NO1 in the sequence, composition sequence is building up on the pBSK (+), obtains the pBSK-BNANSI plasmid.MCS according to subcloning vector pBSK (+) and expression vector pSH737 designs and synthesizes following primer: P
IFNA1: 5 '-GT
TCTAGAATGGCTGTTCCAGCTTCTC-3 '; P
IFNA-LH: 5 ' CG
GGTACCCTATTAGTGGTGGTGGTGGTGGTGGGATCCAGATCCTCCCTAGGTCCTGGTGTTTC CG-3 ', primer sequence add XbaI and KpnI restriction enzyme site and 2 protection bases.With plasmid pBSK-BNANSI is template; Use above-mentioned primer amplification to contain histidine-tagged ChIFN-alpha gene fragment; Amplified production and expression vector pSH737 are respectively behind the XbaI/KpnI double digestion; Electrophoresis reclaims ChIFN-α gene small segment and the big fragment of pSH737 plasmid, connects with the T4DNA ligase enzyme, makes up the ChIFN-α plant expression vector of CaMV35S promoters driven.The pSFRLH plant expression vector that obtains is transformed A.tumefaciens EHA105, bacterium colony PCR screening positive clone through freeze-thaw method.
Further, the present invention imports southern leguminous forage Root or stem of Littleleaf Indianmulberry through agrobacterium-mediated transformation with chicken ChIFN-α gene, makes it express pharmaceutical protein chicken ChIFN-IFN-as bio-reactor.The contriver utilizes Root or stem of Littleleaf Indianmulberry stem, scape stem section, tender leaf fragment to carry out genetic transformation and obtain transfer-gen plant; Show through PCR, RT-PCR, Southern blot, Western blot and ELISA detected result: ChIFN-α gene integration is in Root or stem of Littleleaf Indianmulberry genome group; And obtain correct transcribing and accurate translation, transgenic Root or stem of Littleleaf Indianmulberry successful expression ChIFN-α albumen.
Root or stem of Littleleaf Indianmulberry is perennial leguminous forage, extensive management, and herbaceous stem is delicate; The green grass phase is long, good palatability, and protein contnt is high; Compared with prior art the present invention produces pharmaceutical protein with Root or stem of Littleleaf Indianmulberry as bio-reactor; Directly, not only the animal interferon production cost can be greatly reduced, and the purpose of improving body's immunity can be when quality protein is provided, reached as feed.
Description of drawings
Fig. 1 is the physical map of plant expression vector pSFRLH,
Wherein, IFNRLH is the chicken alpha interferon gene fragment of carrying the His label, utilizes gus::npt to serve as a mark and screening-gene.
Fig. 2 A is the PCR detected result of carrier pSFRLH
Fig. 2 B is that the enzyme of carrier pSFRLH is cut qualification result.
Fig. 3 is the procurement process of transgenic Root or stem of Littleleaf Indianmulberry,
Wherein a is the callus induction of blade, and b is from the callus induction indefinite bud, and c is the resistant buds after the microbiotic Kan screening, and d is the non-resistance albefaction bud after the Kan screening, and e is taking root of resistant buds seedling.
Fig. 4 is that transgenic Root or stem of Littleleaf Indianmulberry GUS histological chemistry is detected,
Wherein the wild-type blade does not have any blue appearance among the A, and transgenic Root or stem of Littleleaf Indianmulberry blade appears positive blue among the B.
Fig. 5 is transgenic hundred arteries and veins and contrast Root or stem of Littleleaf Indianmulberry plant,
Wherein T1 and T2 are transfer-gen plant; CK is the wild-type plant.
The PCR of Fig. 6 transgenic Root or stem of Littleleaf Indianmulberry detects,
Wherein M is the DL2000DNA molecular weight standard, and 1 is pSFRLH plasmid positive control, and 2 are no template negative control, and 3 is non-transgenic plant negative control, and 4-11 is the GUS positive plant.
Fig. 7 is that the RT-PCR of transfer-gen plant detects,
Wherein M is a dna molecular amount standard, and T1 is different transfer-gen plants with T2, and C is a pSFRLH plasmid positive control, M
0For water is the negative control of template, M
1Be non-transgenic plant, M
2Negative control for no reversed transcriptive enzyme (MLV).Fig. 8 is that the Southern blot of transfer-gen plant detects,
Wherein 1 is the non-transgenic contrast, and 2-5 is different transfer-gen plant.
Fig. 9 is that the proteic Western blot of ChIFN-alpha expression analyzes in the transgenic Root or stem of Littleleaf Indianmulberry,
Wherein 1 and 2 is different commentaries on classics ChIFN-α gene plants, and the expressing protein molecular weight is about 29.51kD.
Figure 10 is that the proteic ELISA of recombinant C hIFN-alpha expression detects in the Root or stem of Littleleaf Indianmulberry herbage,
Wherein CK is a non-transgenic Root or stem of Littleleaf Indianmulberry adjoining tree, and T1 is different commentaries on classics ChIFN-α gene plants with T2
Embodiment
Below in conjunction with embodiment the present invention is done further detailed description.
Embodiment 1: make up recombinant vectors pSFRLH
(1) material and method
1. plasmid and bacterial strain
Plasmid pbluescriptK (pBSK) purchases the JaRa biotech firm to Shanghai; Plasmid pSH737, coli strain DH5 α and agrobacterium strains EHA105; Equal public reported; Can buy or other open channels acquisitions through company, in case of necessity also can be to Guizhou Province's agro-biological engineering emphasis obtainable post-free.
2. acceptor material
Leo Root or stem of Littleleaf Indianmulberry (Lotus corniculatus L.) seed broadcasts sowing behind stone sand friction scratch kind of skin, carries out field management to the florescence to begin to utilize.
3. plant expression vector construction
(GenBank No:U07868) designs and synthesizes ChIFN-α gene according to the chicken alpha-interferon sequence, and sequence contains KpnI/SalI and XhoI restriction enzyme site, and composition sequence is building up on the pBSK (+), obtains the pBSK-BNANSI plasmid.MCS according to subcloning vector pBSK (+) and expression vector pSH737 designs and synthesizes following primer: P
IFNA1: 5 '-GT
TCTAGAATGGCTGTTCCAGCTTCTC-3 '; P
IFNA-LH: 5 ' CG
GGTACCCTATTAGTGGTGGTGGTGGTGGTGGGATCCAGATCCTCCCTAGGTCCTGGTGTTTC CG-3 ', primer sequence add XbaI and KpnI restriction enzyme site and 2 protection bases.
With plasmid pBSK-BNANSI is template; Use above-mentioned primer amplification to contain histidine-tagged ChIFN-alpha gene fragment; Amplified production and expression vector pSH737 are respectively behind the XbaI/KpnI double digestion; Electrophoresis reclaims ChIFN-α gene small segment and the big fragment of pSH737 plasmid, connects with the T4DNA ligase enzyme, makes up the ChIFN-α plant expression vector of CaMV35S promoters driven.To connect product pSFRLH Transformed E .coli TG1 competent cell.Bacterium colony PCR screening positive clone extracts the pSFRLH plasmid and carries out the evaluation of XbaI/KpnI double digestion.The pSFRLH plant expression vector that obtains is transformed A.tumefaciens EHA105, bacterium colony PCR screening positive clone through freeze-thaw method.
The result:
The physical map of plant expression vector pSFRLH is seen Fig. 1.Identify that through XbaI/KpnI double digestion expression plasmid pSFRLH and bacterium colony PCR it is consistent with the expection fragment to obtain band, obtain to make up correct plant expression vector pSFRLH (seeing Fig. 2 A, Fig. 2 B).
Embodiment 2: agriculture bacillus mediated Root or stem of Littleleaf Indianmulberry transforms and regeneration
(1) bacterium liquid is prepared
The fresh Agrobacterium bacterium liquid that carries plant expression vector pSFRLH was inoculated in the YEP liquid nutrient medium by 1: 100 and (adds Km100mg/L; Rif20mg/L); In 28 ℃ of shaking culture 8h (185rpm/min) to the logarithmic phase of growing, behind 4 ℃ of centrifugal (6500rpm/min) 15min with subsequent use behind MS plant liquid substratum (As of additional 200 μ M) resuspended thalline (OD600=0.1-0.2) 2h.
(2) infect conversion
The full-bloom stage Root or stem of Littleleaf Indianmulberry branches and leaves of fine fresh harvesting after flowing water washes down, soak 30s with 75% medical alcohol; 0.1% mercuric chloride solution sterilization 3min, aseptic water washing repeatedly after, with Root or stem of Littleleaf Indianmulberry stem, scape and tender leaf respectively after segment or the stripping and slicing; Add ready resuspended bacterium liquid; Slightly rock and make explant and the abundant contact action 8min of bacterium liquid, fully blot its surperficial bacterium liquid with sterilization filter paper then, and insert training cultivation altogether and cultivate based on 26 ℃ of dark places; Taking off bacterium, callus and bud behind the 2d induces and screens; Per 3 all subcultures 1 time go to the root media root induction with its cutting-out when bud to be broken up grows to 3-4cm, behind about 4-5 week well developed root system regeneration plant are transplanted to greenhouse flowerpot soil.
(3) substratum and culture condition
Wherein comprise in the 1L MS substratum: 1900 milligrams in saltpetre (KNO3), 1650 milligrams in an ammonium nitrate (NH4NO3), 440 milligrams in calcium chloride (CaCl22H2O), 370 milligrams in sal epsom (MgSO47H2O); 170 milligrams of potassium primary phosphates (KH2PO4), 22.3 milligrams of manganous sulfates (MnSO44H2O), 8.6 milligrams in zinc sulfate (ZnSO47H2O), 6.2 milligrams of boric acid (H2BO3); 0.83 milligram of potassiumiodide (KI), 0.25 milligram of Sodium orthomolybdate (Na2MoO42H2O), 37.25 milligrams of EDTA Disodiums (Na2-EDTA.2H2O); 27.8 milligrams in ferrous sulfate (FeSO47H2O), 0.025 milligram in copper sulfate (CuSO45H2O), 0.025 milligram of NSC 51149 (COCl26H2O); 100 milligrams of inositols, 0.5 milligram in nicotinic acid, 0.1 milligram of vitamin (dimension B1); 0.5 milligram of pyridoxine hydrochloride (dimension B6), 2 milligrams of glycocoll, pH value 5.80.
1L YEP cultivates to concentrate and comprises: 5.0g peptone, 5.0g yeast extract, 2.5gNaCl, pH value 7.20.
Contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 300mg/L cephamycin, 30g/L sucrose and 6g/L agar in the callus inducing medium; The Syringylethanone, 30g/L sucrose and the 6g/L agar that contain 4.3g/L MS, 200 μ M altogether in the substratum; The Syringylethanone and the 30g/L sucrose that contain 4.3g/L MS, 200 μ M in the resuspended substratum of MS; Take off and contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 350mg/L cephamycin, 30g/L sucrose and 6g/L agar in the bacterium culture medium; Contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 300mg/L cephamycin, 30g/L sucrose and 6g/L agar in the division culture medium; Contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 300mg/L cephamycin, 45.0mg/L kantlex, 30g/L sucrose and 6g/L agar in the screening culture medium; Contain in the root media; 2.15g/L MS, 0.2mg/L second diindyl butyric acid, 300mg/L cephamycin, 30g/L sucrose and 6g/L agar.Root media is the 1/2MS substratum in the experiment, and all the other substratum are the conventional substratum of MS, and each medium pH value is 6.0.
Each stage culture condition of plant tissue culture is: callus induction is cultivated with training altogether to dark; Differentiation, bud propagation, screen and take root and be that illumination cultivation, intensity of illumination are 3000lux, 16h/d.
(4) transfer-gen plant detects
1) the GUS histochemical method is identified
Get plants transformed children browse, add GUS dye liquor (50mM NaCl; 100mM Tris-HCl (pH 7.5); The 2mM Tripotassium iron hexacyanide; 1mM X-gluc and 20% (v/v) methyl alcohol) submergence and vacuumize the back and hatch 24h in 37 ℃ of dark uses 90% (v/v) ethanol decolorization to observe then.
2) pcr amplification of genomic dna
The genomic dna that extracts GUS evaluation positive plant carries out the PCR detection of ChIFN-α goal gene as template, with batch negative contrast of non-conversion tissue culture regeneration seedling together.Use to detect primer 5 '-GCTGTTCCAGCTTCTCCAC-3 ' and 5 ' CCTGGTGTTTCCGGTAAGG-3 ' are as upstream and downstream primer testing goal gene, reaction conditions is: 94 ℃ of 5min; 94 ℃ of 40sec, 56 ℃ of 40sec, 72 ℃ of 40sec, 5cycles; 94 ℃ of 40sec, 58 ℃ of 40sec, 72 ℃ of 40sec, 25cycles; 72 ℃ of 8min.Amplified production carries out electrophoresis detection with the sepharose of 1.0% (W/V).
3) RT-PCR detects
Fresh sample adds the Trizol extracting solution after with liquid nitrogen grinding and extracts total RNA.Use an one step RT-PCR method; With the total RNA of 1.0 μ g (20 μ L reaction system) is template; Use primer to 5 '-GTTCTAGAATGGCTG TTCCAGCTTCTC-3 ' and 5 '-GGGGTACCCTATTACTA GGTCCTGGTG-3 ' detects ChIFN-α gene transcription as the upstream and downstream primer, the pcr amplification condition is: preparatory 94 ℃ of 5min of sex change; 94 ℃ of 40sec then, 57 ℃ of 40sec, 72 ℃ of 40sec, 5 circulations; 94 ℃ of 40sec, 59 ℃ of 40sec, 72 ℃ of 40sec, 25 circulations; Last 72 ℃ are extended 8min.The PCR product is electrophoresis detection on 1.0% (W/V) sepharose.It is the negative control of template that plasmid positive control and non-transgenic plant and water are established in experiment respectively.
4) the Southern blot of transfer-gen plant detects
A) probe mark: use the pcr amplification method to carry out probe mark.Preparation feedback liquid on ice, reaction system (TV 20 μ L) is: 0.5 μ L forward primer, 0.5 μ L reverse primer; 1.0 μ L cDNA template; 2.0 μ L 10 * PCR Buffer, 2.0 μ L MgCl2,1.0 μ L Dig-dUTP mark mixtures; 12.5 μ L 2dH2O, 0.5 μ L Taq archaeal dna polymerase.The pcr amplification program is: 94 ℃ of 5min; 94 ℃ of 40sec, 54 ℃ of 40sec, 72 ℃ of 40sec, 5cycle; 94 ℃ of 40sec, 56 ℃ of 40sec, 72 ℃ of 40sec, 25cycle; 72 ℃ of 5min.Label probe is electrophoresis detection on the sepharose of 1.0% (W/V).
B) extracting genome DNA and enzyme are cut.0.1g fresh tobacco leaf, method is extracted tobacco gene group DNA in a small amount.
C) use KpnI and HindIII in 37 ℃ of double digestion tobacco gene group DNA 6h, enzyme is cut system (TV 400 μ L) and is: 40 μ L, 10 * M Buffer, 44 μ L genomic dnas (40 μ g), 3 μ L KpnI, 3 μ L HindIII, 310 μ L 2dH2O.Enzyme is cut after genomic dna deposition concentrates, by on the 20 μ g/well to 1.0% sepharose appearance hole.
D) electrophoresis and Gel Treatment.After using voltage (50V) the electrophoresis 7h of 2V/cm, gel is cleaned and the unnecessary edge that prunes away with distilled water, changes in the clean petridish, with 5 * volume sex change liquid vibration washing 20min, repeats 1 time; Behind the distilled water vibration washing 5min, add the neutralizer vibration washing 15min of 5 * volume, repeat 1 time.
E) changeing film and film handles., use capillary tube technique that DNA is spent the night and transfer on the nylon membrane as transfering buffering liquid with 20 * SSC.To remove the agarose vestiges, film dries rearmounted 80 ℃ of baking 2h with 5 * SSC vibration washing nylon membrane 5min, and 4 ℃ of preservations are subsequent use.
F) prehybridization and hybridization.Nylon membrane is placed hybridization bag, add the efficient hybridization solution 5mL of Hyb of 65 ℃ of preheatings, put 62 ℃ of vibration hybridization 1.5h in the hybridization case.The probe of mark is put 100 ℃ boiled after 10 minutes ice bath cooling immediately 10 minutes; Join in the efficient hybridization solution of Hyb by 3 μ l/ films (25ngmL-1); Drain the prehybridization solution in the hybridization bag, add the efficient hybridization solution of Hyb that 5mL contains probe, put 62 ℃ of shaken overnight hybridization 12h in the hybridization case.
G) wash film.With 2 * SSC (containing 0.1%SDS) room temperature vibration washing Hybond membrane twice of 20mL, each 5 minutes; With 50 ℃ of vibrations of 0.1 * SSC (containing 0.1%SDS) solution Hybond membrane washed twice of 50 ℃ of preheatings, each 15 minutes; Added 20mL lavation buffer solution vibration washing Hybond membrane 5 minutes.
H) hybridization detects.Hybond membrane soaked in lavation buffer solution 5 minutes, in 30mL blocking-up liquid, hatched 30 minutes, in the 20mL antibody liquid, hatched 30 minutes, and with 30mL washings washing 2 * 15 minutes, balance was 5 minutes in 15mL detection damping fluid.Film is placed on one deck preservative film; Add the freshly prepared luminous substrate liquid of 1mL, cover one deck preservative film then, the room temperature effect of leaving standstill is after 5 minutes; With X-ray sheet compressing tablet, exposure, the 3min that carries out 1min, 3min, 5min, 10min and 20min respectively develops, the 5min photographic fixing.
5) the transgenic plant expression product detects
(1) Western blot detects
A) specimen preparation.The Root or stem of Littleleaf Indianmulberry blade becomes to change over to behind the fine powder in the 1.5mL centrifuge tube with liquid nitrogen grinding and added protein extract by 1: 1, the 1min that vibrates on the vortex vibrator, and lixiviate 30min on ice, 4 ℃, 12, the centrifugal 10min of 000rpm/min, it is frozen subsequent use in-80 ℃ to get supernatant.
B) electrophoresis.Preparation SDS-PAGE gel consists of 10% separation gel 9mL (3mL separation gel stock solution (30%Acr-Bis), 2.25mL separation gel damping fluid, 0.09mL 10%SDS; The 3mL distilled water, 0.06mL 10% ammonium persulphate, 0.6mL TEMED), 5% concentrates glue 3mL, and (1.5mL concentrates the glue stock solution; 0.75mL concentrate the glue damping fluid, 0.03mL10%SDS solution, 0.45mL distilled water; 0.03mL 10% ammonium persulphate, 0.03mL 10% ammonium persulphate, 0.24mLTEMED).
C) sample preparation.Get-80 ℃ of frozen samples, add an amount of 2 * sds gel sample loading buffer after, boiling water bath heating made the abundant sex change of albumen be placed on cooled on ice 10min in 5 minutes.
D) go up appearance and electrophoresis.Protein sample is gone up a standard protein Marker by appearance on every hole 15 μ L simultaneously in the gel well.The 110V constant voltage stops electrophoresis behind the 10min outside tetrabromophenol sulfonphthalein is moved to gel.
E) change film.350mA changeed film 60 minutes, with the ponceau staining fluid film was dyeed and judged commentaries on classics film effect.
F) sealing.After changeing film and finishing, be placed into the NC film in the preprepared film washing liquid after rinsing 1-2 minute immediately, remove washings, add 4 ℃ of sealings of spending the night of confining liquid.
G) antibody incubation.Anti-by dilution in 1: 2,000 one with confining liquid, after room temperature was slowly shaken and hatched one hour, anti-by dilution in 1: 5,000 two with confining liquid, room temperature was slowly shaken and is hatched one hour.
H) Protein Detection.Rigorous washing adds freshly prepared DAB solution 5mL behind the film, and lucifuge colour developing 5-30min takes pictures with the zero(ppm) water color development stopping when background ideal trace occurring.
(2) ELISA detects
Get the 0.2g rotaring gene plant blade, add liquid nitrogen grinding Cheng Fenhou, add again and place lixiviate 30min on ice after 0.6mL protein extraction damping fluid grinds mixing, 4 ℃, 12, get supernatant behind the centrifugal 15min of 000rpm/min and carry out the ELISA detection.The quantitative employing Xylene Brilliant Cyanine G method of total protein.
ChIFN-α standard substance (RapidBioLab ChIFN-α ELISA kit) become the sample of series concentration by 0.5 times of doubling dilution with 1mL diluent redissolution back.Get the 100 μ L standard substance Root or stem of Littleleaf Indianmulberry sample different and place chicken IFN-α one anti-96 orifice plates that encapsulate with 100 μ L.Mixing 30s covers the shrouding film gently, 37 ℃ of incubation 90min.Add 350 μ L/well washingss and wash plate 5 times.Add 100 μ L/well, 1 * Biotin (biotin labeled is anti-), mixing 30s covers the shrouding film gently, 37 ℃ of incubation 60min.Add 350 μ L/well washingss and wash plate 5 times.Add 100 μ L/well, 1 * HRP (two of horseradish peroxidase-labeled resists), mixing 30s covers the shrouding film gently, 37 ℃ of incubation 30min.Add 100 μ L/wellTMB colour developing liquid, mixing 10s gently, 15min is hatched in 37 ℃ of dark places.Add 100 μ L/well stop buffers, mixing 30s measures the OD450 light absorption value on the inherent enzyme couplet of the 0.5h detector gently.With OD450 is ordinate zou, is X-coordinate with the sample concentration, the drawing standard curve, and according to typical curve calculation sample concentration.
The result:
Obtain the correct proteic transgenic Root or stem of Littleleaf Indianmulberry of chicken interferon of expressing.With Root or stem of Littleleaf Indianmulberry stem section is explant, and with ChIFN-α gene transformation Root or stem of Littleleaf Indianmulberry, through callus induction, differentiation adventitious buds, resistance screening, process (see figure 3) such as take root obtain 78 strain resistance seedlings through agrobacterium-mediated transformation.Identify that through the GUS histochemical method (see figure 4) obtains 13 strains of transgenic Root or stem of Littleleaf Indianmulberry plant (see figure 5); Further identify that through genome pcr amplification (see figure 6), RT-PCR (see figure 7) and Southern blot analyze (see figure 8), the confirmation goal gene is correctly transcribed in recipient plant and is integrated into Root or stem of Littleleaf Indianmulberry karyomit(e) with different copy numbers.Western blot (see figure 9) and ELISA (see figure 10) detected result show; Transfer-gen plant is correctly expressed interferon protein; Recombinant C hIFN-alpha expression amount differs bigger in different transfer-gen plants, and the proteic amount of recombinant C hIFN-alpha expression is respectively 6.4960 and 1.2992ng.Expressing protein is up to 64.96ngkg
-1Fresh weight (account for total soluble protein 0.0001%).
The present invention with interferon gene ChIFN-α genetic transformation with Root or stem of Littleleaf Indianmulberry; Can obtain can be by the expressing protein of interferon antibody identification; This lays a good foundation for using herbage to produce the animal pharmaceutical protein as bio-reactor, for the control of animal epidemic provides new thinking.
Claims (3)
1. the method for utilizing Root or stem of Littleleaf Indianmulberry to produce chicken alpha-interferon for bio-reactor is characterized in that: transform Root or stem of Littleleaf Indianmulberry with agriculture bacillus mediated employing plant expression vector, described plant expression vector is pSFRLH, and described method comprises the steps:
A, conversion host: plant expression vector changes agrobacterium tumefaciens EHA105 over to freeze-thaw method,
The preparation of B, agrobacterium tumefaciens: the fresh Agrobacterium bacterium liquid that carries plant expression vector is inoculated in and is cultured to the growth logarithmic phase in the YEP liquid nutrient medium, the resuspended thalline of centrifugal back MS,
C, dip-dye and screening: the Root or stem of Littleleaf Indianmulberry explant drops in the resuspended bacterium liquid of MS, and fully contact is infected after the back cultivates in the dark place altogether, explant is changed over to take off bacterium culture medium and take off bacterium and cultivate, and screens the indefinite bud of callus induction afterwards,
D, break up, take root, transplant: when the differentiation resistant buds grows to 3-4cm, downcut and go to the root media root induction, transplant behind the well developed root system;
Wherein comprise in the 1L YEP substratum: the 5.0g peptone, the 5.0g yeast extract, 2.5gNaCl, the 45.0mg kantlex, the 20.0mg Rifampin, pH value 7.20,
Wherein comprise in the 1L MS substratum: 1900 milligrams in saltpetre, 1650 milligrams in an ammonium nitrate, 440 milligrams in calcium chloride, 370 milligrams in sal epsom, 170 milligrams of potassium primary phosphates; 22.3 milligrams of manganous sulfates, 8.6 milligrams in zinc sulfate, 6.2 milligrams of boric acid, 0.83 milligram of potassiumiodide; 0.25 milligram of Sodium orthomolybdate, 37.25 milligrams of EDTA Disodiums, 27.8 milligrams in ferrous sulfate, 0.025 milligram in copper sulfate; 0.025 milligram of NSC 51149,100 milligrams of inositols, 0.5 milligram in nicotinic acid, 0.1 milligram of vitamin; 0.5 milligram of pyridoxine hydrochloride, 2 milligrams of glycocoll, pH value 5.80
Wherein contain Syringylethanone and the 30g/L sucrose of 4.3g/L MS, 200 μ M in the resuspended substratum of MS, the pH value is 6.0,
Wherein contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 300mg/L cephamycin, 30g/L sucrose and 6g/L agar in the callus inducing medium, the pH value is 6.0; Contain Syringylethanone, 30g/L sucrose and the 6g/L agar of 4.3g/L MS, 200 μ M altogether in the substratum, the pH value is 6.0; Take off and contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 350mg/L cephamycin, 30g/L sucrose and 6g/L agar in the bacterium culture medium, the pH value is 6.0; Contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 300mg/L cephamycin, 30g/L sucrose and 6g/L agar in the division culture medium, the pH value is 6.0; Contain 4.3g/L MS, 2.0mg/L 6-benzyl aminopurine, 0.1mg/L naphthylacetic acid, 300mg/L cephamycin, 45.0mg/L kantlex, 30g/L sucrose and 6g/L agar in the screening culture medium, the pH value is 6.0; Contain in the root media; 2.15g/L MS, 0.2mg/L second diindyl butyric acid, 300mg/L cephamycin, 30g/L sucrose and 6g/L agar, the pH value is 6.0;
Said explant is Root or stem of Littleleaf Indianmulberry stem, scape or tender leaf.
2. method according to claim 1, said resuspended thalline OD600 is 0.1-0.2, time of infection 8 minutes was cultivated 2 days altogether.
3. method according to claim 1, wherein plant tissue culture condition is: callus induction is dark cultivation with cultivating altogether; Differentiation, screen and take root and be that illumination cultivation, light intensity are 3800lux, 16h/d.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105791735A CN102121029B (en) | 2010-12-09 | 2010-12-09 | Plant expression vector and construction method thereof, and method for producing chicken alpha interferon by utilizing crowtoe as bioreactor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105791735A CN102121029B (en) | 2010-12-09 | 2010-12-09 | Plant expression vector and construction method thereof, and method for producing chicken alpha interferon by utilizing crowtoe as bioreactor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102121029A CN102121029A (en) | 2011-07-13 |
| CN102121029B true CN102121029B (en) | 2012-11-14 |
Family
ID=44249697
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105791735A Expired - Fee Related CN102121029B (en) | 2010-12-09 | 2010-12-09 | Plant expression vector and construction method thereof, and method for producing chicken alpha interferon by utilizing crowtoe as bioreactor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102121029B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102660613B (en) * | 2012-04-27 | 2016-01-27 | 天津生机集团股份有限公司 | For the high density fermentation culture medium and preparation method thereof of recombination chicken interferon alpha |
| CN104774867A (en) * | 2015-01-26 | 2015-07-15 | 长春格鲁斯特生物科技有限公司 | Method for producing chicken beta antibacterial peptide Gal-3 by using alfalfa as bioreactor |
| CN106922525B (en) * | 2017-02-20 | 2019-02-26 | 中国农业科学院作物科学研究所 | A method of genetically modified plants are quickly obtained by low light culture system |
| CN109234306A (en) * | 2018-09-25 | 2019-01-18 | 四川农业大学 | A kind of method for building up of diploid crowtoe transformation system |
| CN115232832B (en) * | 2022-06-30 | 2024-02-20 | 中国科学院华南植物园 | Molecular breeding method for obtaining new variety of transgenic Baimaigen from cutting seedlings |
-
2010
- 2010-12-09 CN CN2010105791735A patent/CN102121029B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| 孙艳香等.根癌农杆菌介导的百脉根遗传转化体系的优化研究.《南开大学学报（自然科学版）》.2006,第39卷(第2期), * |
| 宋莉等.鸡α干扰素基因遗传转化烟草研究.《云南植物研究》.2009,第31卷(第3期), * |
| 程星等.百脉根基因工程研究进展.《生物技术通报》.2009,(第4期), * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102121029A (en) | 2011-07-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102121029B (en) | Plant expression vector and construction method thereof, and method for producing chicken alpha interferon by utilizing crowtoe as bioreactor | |
| CN102485897B (en) | Method for changing petal colors by using cotton gene GbF3H | |
| CN104004768B (en) | A kind of Fructus actinidiae chinensis gene that can improve tamato fruit nutritional quality and application thereof | |
| CN1830237A (en) | Method of cultivating drought tolerance high fescue | |
| CN105585619B (en) | With rice grain grain length and grain weight GAP-associated protein GAP and its encoding gene GL3-3 and application | |
| CN105087598A (en) | Rice waterlogging stress response RS1 gene and application thereof | |
| CN100540665C (en) | Regulate the gene of plant branching, contain the carrier of this gene,, and utilize this microorganism to regulate the method for plant branching by this carrier microorganism transformed | |
| Liu et al. | Improving Agrobacterium tumefaciens− mediated genetic transformation for gene function studies and mutagenesis in cucumber (Cucumis sativus L.) | |
| CN102492721A (en) | Sesame genetic transformation method mediated by agrobacterium | |
| CN106967720A (en) | One adverse circumstance evoked promoter SlWRKY31P clone and application | |
| CN105255938A (en) | Agrobacterium rhizogenes mediated genetically modified Erigeron breviscapus hairy root transformation method | |
| CN106701783B (en) | Rice gene OsDF1 and application of disease-resistant regulation function | |
| CN110951776B (en) | Agrobacterium-mediated pepper genetic transformation method | |
| CN113481234A (en) | Method and device for transient expression of genes in tomato plants | |
| CN102533809A (en) | Jujube glutathione peroxidase gene | |
| CN107630021A (en) | The albumen and application of asparagus resistant gene of salt AoSOS2 and its coding | |
| CN105543251A (en) | Disease-resistance-related gene AtADH1 of arabidopsis thaliana as well as preparation method and disease-resistant application of disease-resistance-related gene AtADH1 | |
| CN105524930A (en) | Arabidopsis thaliana disease resistance-related gene AtIAA17 and preparation method and application thereof | |
| CN107641155A (en) | A kind of method of the recombinant Human Serum Albumin Expression in plant | |
| CN101831429B (en) | Promoter and expression mode identification of rice endosperm specific expression gene | |
| CN115786371B (en) | Application of tomato gene SlLyk4 in regulation and control of soil-borne disease resistance of crops | |
| CN109371060A (en) | A kind of quick transgene method of spindle tree | |
| CN108753816A (en) | The transgenic arabidopsis strain and its construction method of SYTA gene overexpressions | |
| CN103468682B (en) | Rice root specific expression promoter is excavated and application | |
| CN102329816B (en) | Agrobacterium-mediated method for transferring soybean from top end of epicotyl of longitudinally-cut seedling |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C53 | Correction of patent of invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhao Degang Inventor after: Li Yi Inventor after: Song Li Inventor after: Lu Lingxiao Inventor after: Li Yan Inventor before: Zhao Degang Inventor before: Song Li Inventor before: Lu Lingxiao Inventor before: Li Yan |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: ZHAO DEGANG SONG LI LU LINGXIAO LI YAN TO: ZHAO DEGANG LI YI SONG LI LU LINGXIAO LI YAN |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121114 Termination date: 20211209 |