CN103468682B - Rice root specific expression promoter is excavated and application - Google Patents
Rice root specific expression promoter is excavated and application Download PDFInfo
- Publication number
- CN103468682B CN103468682B CN201310465919.3A CN201310465919A CN103468682B CN 103468682 B CN103468682 B CN 103468682B CN 201310465919 A CN201310465919 A CN 201310465919A CN 103468682 B CN103468682 B CN 103468682B
- Authority
- CN
- China
- Prior art keywords
- root system
- sequence
- promoter
- root
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses the application in the special driving of root system of tri-the Oryza sativa L. endogenesis promoters of rRSP1, rRSP3, rRSP5.The invention provides in sequence table sequence 15 promoter and tissue activity thereof and expression pattern.The present invention test result indicate that, rRSP1, rRSP3, rRSP5 only specifically expressing in root system, rRSP2 and rRSP4 is the most active at root system and aerial tissues, has the highest activity, have more weak expression activity on the ground in tissue in root system.The present invention is researching plant root character, and root traits is correlated with breeding or breed improvement aspect has highly important theory and using value.
Description
Technical field
The present invention relates in biological technical field rice root specific expression gene analyze, promoter rRSP1-5 clone and
Its activity analysis.
Background technology
In genetic engineering research and application, the main promoter using composing type to drive, as (CaMV) 35S promoter,
Oryza sativa L. Actin (OsAct1, OsAct2) promoter, Maize Ubiquitin gene (ZmUbi1) promoter, Oryza sativa L. a-tubulin gene
(OsTubA1) promoter, Oryza sativa L. ubiquitin gene (RUBQ1, RUBQ2, rubi3) promoter etc., although constitutive promoter drives
Genes of interest high expressed in transgenic plant, but some gene can produce many unexpected benefits after overexpression, because of
This, in many research and application, need to use tissue specific promoter to express some gene in particular organization or organ
Obtain more preferable effect.
Root system of plant has fixing plant, absorbs moisture and nutrient, synthetically grown instrumentality that crop growth needs
The effect of matter.The most having identified and employed many root system specific promoters in different plants, they can drive root system
Specific expression gene is specifically expressing in root system.Owing to rolD promoter has and root system of plant specific promoter cis element class
As motif, therefore, researcher successfully make use of and derives from Agrobacterium rhizogenes rolD promoters driven glutamate synthetase, height
Nitrate transport protein gene specifically expressing in root system of plant of affinity.Domain A (upstream on CaMV35S
Being 290bp) second source identified and the root system specific promoter of non-plant, compared with rolD promoter, DomainA drives
The expression activity of GUS wants weak 5-15 times, and mainly expresses at the tip of a root.Nicotiana tabacum L. TobRB7 promoter is a kind of important plant source
Root system specific promoter, is widely used in genetic engineering research.About root system specifically expressing correlational study achieved with great
Progress: the basic element of cell division related gene of PYK10 promoters driven special high expressed in root system promotes arabidopsis and Nicotiana tabacum L.
The growth of root system and elongation；RCc3 promoters driven rice root special high expressed OsNAC10 substantially increase plant to arid,
The adaptation ability of high salt and low temperature.
Root system specific promoter is great for research root system specific expression gene correlation function and application value thereof, also obtains
Certain progress, but for whole period of duration root system specifically expressing aspect, especially for monocotyledon root system specifically expressing
The research of promoter is the most not enough.And the application that kindred plant root system specific promoter is in different plant species exist specificity,
The problems such as activity reduction, therefore excavate monocotyledon (Oryza sativa L.) endogenous root system specific promoter to research root system correlated traits tool
There is important using value.
Summary of the invention
It is an object of the invention to provide the root system specific expression promoter rRSP1 shown in sequence 1,3,5 in sequence table,
In rRSP3, rRSP5 and sequence table, the root system shown in 2,4 mainly expresses promoter rRSP2, rRSP4.
The invention provides promoter rRSP1 shown in sequence 1,2,3,4,5 in sequence table, rRSP2, rRSP3, rRSP4,
RRSP5 root system special or main express drive in application；Described promoter is following 1)-3) in arbitrary described sequence；
1) DNA molecular shown in sequence 1,2,3,4,5 in sequence table；
2) under strict conditions with 1) shown in the DNA molecular of DNA molecule hybridize；
3) with 1) or 2) described in DNA molecular have more than 90% the DNA molecular of homology.
Root system specifically expressing or master is being driven containing promoter recombinant expression carrier shown in sequence in ordered list 1,2,3,4,5
Application in expressing falls within protection scope of the present invention.
In the building process of described recombinant expression carrier, sequence 1,2,3,4,5 in insertion sequence table before Reporter gene GUS
Shown promoter, builds and obtains recombinant expression carrier.
Described plant is monocotyledon-Oryza sativa L., including dicotyledon.
The method of cultivation transgenic plant provided by the present invention, is by opening shown in sequence in sequence table 1,2,3,4,5
Mover drives the expression cassette of GUS to import in plant, obtains transgenic plant, and transgenic plant Reporter gene GUS is only in root system
Specifically expressing.
The present invention is composed by this laboratory existing Oryza sativa L. full-length genome spatial and temporal expression, has excavated 7 root system specifically expressings
Gene, utilizes Real-time PCR to carry out blade and root system and has carried out deep checking, cloned and construct 5 gene promoters
The GUS fusion expression vector of son (rRSP1, rRSP2, rRSP3, rRSP4, rRSP5), genetic transformation Oryza sativa L. Kitaake, and to turning
Gene plant carries out GUS histochemical stain analysis.Result shows rRSP1, rRSP3, rRSP5 only specifically expressing in root system,
RRSP2 and rRSP4 is the most active at root system and aerial tissues, but has the highest activity in root system, has on the ground in tissue
More weak expression activity, mainly expresses promoter for root system.The present invention is researching plant root character, and root traits is correlated with breeding
Or breed improvement aspect has highly important theory and using value.
Accompanying drawing explanation
Fig. 1 is that Motif is guarded in root system specific expression gene promoter region
Fig. 2 is that Semiquatitative RT-PCR assay detects R1-R7 tissue expression pattern and expression pattern is coerced in response
Fig. 3 is fluorescence quantitative PCR detection R1-R7 tissue expression pattern
Fig. 4 is that fluorescence quantitative PCR detection R1-R7 responds in root system and coerces expression pattern
Fig. 5 is transfer-gen plant PCR positive detection
Fig. 6 is transfer-gen plant GUS in seedling stage tissue staining
Detailed description of the invention
Experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
The special cance high-expression gene of embodiment 1, rice root is excavated and checking
(public can make from the Chinese Academy of Agricultural Sciences in Japan fine (Nipponbare, Oryza sativa ssp.japonica)
Thing Science Institute obtains, and the non-patent literature recording this material is: Yongqing Jiao, Yonghong Wang, Dawei
Xue, Jing Wang, Meixian Yan, Guifu Liu, Guojun Dong, Dali Zeng, Zefu Lu, Xudong Zhu,
Qian Qian and Jiayang Li(2010)Regulation of OsSPL14by OsmiR156defines ideal
Plant architecture in rice.Nature Genetics, 42,541-544)；
(public can be from Chinese Academy of Agricultural Sciences's crop science research for Kitaake (Oryza sativa ssp.japonica)
Being obtained, the non-patent literature recording this material is: (Kinoshita et al.1989；Takamure and
Kinoshita1993)。
1, Oryza sativa L. full-length genome spatial and temporal expression spectrum is utilized to excavate rice root specific expression gene
According to drought coerce lower Oryza sativa L. full-length genome spatial and temporal expression spectrum (Di Wang, Yajiao Pan, Xiuqin Zhao,
Linghua Zhu, Binying Fu, Zhikang Li, Genome-wide Temporal-spatial Gene
Expression Profiling of Drought Responsiveness in Rice.BMC Genomics2011,12:
149) Oryza sativa L. full-length genome class hour null representation spectrum (data are not delivered) and under salt stress, screening specifically expressing in root system, and be subject to
Drought is coerced and is expressed zero difference gene (fold change ＜ 2.0) with salt stress, has 462 genes；Then according to its signal
Value, selects cance high-expression gene in root system, picks 43 genes altogether.Then facing to 43 root system specific expression gene upstreams
1kb sequence carries out conservative Motif and analyzes, and finds 3 relatively conservative Motif (Fig. 1), and have selected 7 conservative Motif quantity
Most genes (preliminary designation is R1-R7, table 1) carries out next step analysis verification.
The information such as table 1 candidate gene and promoter thereof
2, express spectra is coerced in sxemiquantitative and Real-time PCR Analysis R1-R7 distribution expression pattern and response environment
The fine seed of Oryza sativa L. Japan is sterile-processed, room temperature seed soaking 2d, 37 DEG C of accelerating germination 1d, publishes the seed that bud is consistent after sprouting
It is sowed on plastic casing foam frame, 2, every hole, water planting before two leaves, after two leaves, uses Yoshida Solution culture method.In five leaf phases
Low temperature (4 DEG C), high salt (150mmol L-1NaCl) processing with osmotic stress (20%PEG), Japan is fine to be taken after Stress treatment 24h
Blade and root system, untreated as comparison；Take in quartz sand the rice leaf and root system in boot stage of plantation simultaneously, processing mode with
On, liquid nitrogen flash freezer ,-70 DEG C of cryopreservation, extract for RNA.
Use TRIZOL reagent to extract laboratory sample total serum IgE, and carry out the analysis of RNA purity: with 1% agarose gel electricity
Swim the integrity of total serum IgE of quick Detection and Extraction, the genomic DNA in DNase I digestion RNA, concrete grammar and step reference
Description.
Reverse transcription:
The synthesis reverse transcription of the first chain cDNA is with test kit (Promega company, Code no:A3500).
Semi-quantitative RT-PCR analysis: with Actin as reference gene, carries out homogenization process to cDNA.PCR response procedures:
95 DEG C of degeneration 30s, anneal 30s, 72 DEG C of extensions (1Kb/min)；After 25-30 circulation, 72 DEG C extend 10min, and 1% agarose coagulates
Gel electrophoresis detection (primer is shown in Table 2).
Real Time pcr analysis:
Real Time PCR analyze use TaKaRa SYBR Premix Ex Taq test kit (Code no:
DRR041A), the Real Time PCR amplification instrument of application is ABI7300, (primer is shown in Table 2), method with Actin as reference gene
See description.
RT-PCR primer used by table 2
Data analysis:
Genes of interest relative expression quantity Rel.Exp=2 is calculated by relative quantification method-ΔΔCt, wherein Δ Δ Ct=[(testing sample
The Ct of the Ct-testing sample house-keeping gene of genes of interest)-(Ct of the Ct-matched group house-keeping gene of matched group genes of interest)].
The calculating Excel of standard variance completes, and first calculates the S value of sample and comparison with statistical function STDEV, then by two
The calculation square of individual S value, calculates (S1 2+S2 2The value of)/3, and then calculate X=Power ((S1 2+S2 2)/3,0.5), finally calculate variance=(2(-ddct-x)-2(-ddct+x))/2。
Result shows R1, R2, R3, R5, R6, R7 high expressed in young root and matured root, and in spire and mature leaf
Do not express or only very small amount is expressed；R4 is high expressed in root system, also has part to express (Fig. 2-left side, Fig. 3) in blade.R1-
R7 is by PEG, Salt, low temperature effect change not quite (Fig. 2-right side, Fig. 4).R1, R4 express in young root and are significantly higher than ripe root system
(Fig. 3), and R2, R3, R5, R6, R7 express in ripe root system and are significantly higher than young root (Fig. 3).
Embodiment 2, the activity analysis of A2P, rRSP1, rRSP2, rRSP3, rRSP4, rRSP5 plant inner tissue
1, promoter clone and GUS fusion expression vector build
Design primer according to Japanese fine sequence, with genomic DNA as template, utilize high-fidelity enzymatic amplification to obtain
Actin2 gene (positive control), R1, R2, R3, R4, R5 upstream (start codon ATG upstream) about 2.5kb sequence, named
A2P, rRSP1, rRSP2, rRSP3, rRSP4, rRSP5, introduce attB1:GGGGACAAGTTTGTACAAAA at primer two ends
AAGCAGGCT/attB2:GGGGACCACTTTGTACAAGAAAGCTGGGTT joint sequence (table 3)；Utilize Gateway technology weight
Group enters pMDC162, and (public can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science, recorded the non-patent literature of this material
It is: Mark D.Curtis and Ueli Grossniklaus.A Gateway Cloning Vector Set for High-
Throughput Functional Analysis of Genes in Planta.Plant Physiol.200,133 (2):
462-469), GUS fusion expression vector, sequence verification, recombinant vector is named, pMDC162-A2P pMDC162-are built
rRSP1、pMDC162-rRSP2、pMDC162-rRSP3、pMDC162-rRSP4、pMDC162-rRSP5。
Table 3 promoter clone's the primer
Freeze-thaw method is by expression vector pMDC162-A2P, pMDC162-rRSP1, pMDC162-rRSP2, pMDC162-
RRSP3, pMDC162-rRSP4, pMDC162-rRSP5 proceed in Agrobacterium EHA105 competent cell that (public can be from China's agriculture
Industry academy of science crop science institute obtains, and the non-patent literature recording this material is: Ruifang Yang, Qicai
Tang, HuimeiWang, Xiaobo Zhang, Gang Pan, HongWang and Jumin Tu (2011) Analyses of
two rice(Oryza sativa)cyclin-dependent kinase inhibitors and effects of
Transgenic expression of OsiICK6on plant growth and development, Annals
OfBotany, 107:1087-1101), method is with reference to Molecular Cloning: A Laboratory guide.
2 genetic transformations
Use Agrobacterium-mediated genetic transformation method, with Kitaake as acceptor material, carry out genetic transformation (culture medium prescription
It is shown in Table 6), concrete grammar is as follows:
1) wound healing induction
Taking appropriate ripe rice paddy seed, after shelling, first with 70% alcohol washes sterilization 1min, period constantly sways,
30min (being placed on shaking table vibration) is processed again with the hypochlorite disinfectant of 15%；Finally rinse 4-5 time with sterile distilled water,
Inoculate after blotting the surface of the seed moisture with aseptic filter paper.Seed after disinfecting is inoculated in 2 containing 2.0mg/L, 4-D's
In inducing culture, 28 DEG C of light culture 30-40 days.Cultivate the wound healing amplification culture on subculture medium obtained, every 2 weeks subcultures
Once, until embryo callus subculture is formed.
2) Agrobacterium is infected
A) will carry expression plasmid carrier pMDC162-A2P, pMDC162-rRSP1, pMDC162-rRSP2,
The Agrobacterium of pMDC162-rRSP3, pMDC162-rRSP4, pMDC162-rRSP5 line containing antibiotic (50mg/L card that
Mycin, 25mg/l rifampicin) LB solid culture primary surface, 28 DEG C, 200r/min overnight incubation.
B) with sterilized toothpick picking monoclonal bacterium colony, it is inoculated into the YEB fluid medium that 5ml contains corresponding antibiotic
In, OD600=0.5 is cultivated in 28 DEG C of concussions.
C) take activated fresh bacterium solution be inoculated in YEB fluid medium identical for 25ml in the ratio of 1:100,
Cultivate to OD600=0.5 under the same terms.
D) bacterium solution is at 5000g, and at 4 DEG C, centrifugal 10min collects thalline, abandoning supernatant；Add the MgS0 of 25ml10mM4Outstanding
Floating thalline, and inhale gently to beat with liquid-transfering gun and make it fully suspend, at 5000g, at 4 DEG C, centrifugal 10min collects thalline again, discards
Supernatant.
E) AA-AS containing 200 μMs of acetosyringones (AS) with 25ml contaminates culture medium Eddy diffusion.
F) embryo callus subculture good for growth conditions is transferred to surface from subculture medium and is covered with the cultivation of aseptic filter paper
In ware (wound healing is cut into 0.3-0.4mm size), superclean bench air-dries 10-20rin.
G) dry embryo callus subculture being immersed 20min in the 50ml centrifuge tube containing above-mentioned bacterium solution, period shakes every 5rin
Swing once；Outwell bacterium solution afterwards, wound healing is taken out and is placed on aseptic filter paper air-dried 10-20min, be then transferred to surface and be covered with nothing
In the CC culture medium containing 200 μMs of acetosyringones (AS) of bacterium filter paper, under 25 DEG C of dark conditions, co-culture 3d.
H) collect surface and there is no the callus of obvious Agrobacterium, with the aseptic water washing 3 containing 600mg/1 cephamycin
Secondary, draw excessive moisture.
I) callus is proceeded to screening culture medium (the N6 culture medium containing 500mg/1 cephamycin and 50mg/1 hygromycin)
Upper continuation screening 2-3 time, each two weeks.Finally give well-grown foresythia Hygromycin resistant calli.
3, transformant plant regeneration takes the wound healing of fresh hygromycin resistance, callus is divided into the fritter of 2mm, is connected to
In pre-division culture medium, 28 DEG C of light culture 7 days, it is subsequently placed between illumination cultivation (12h illumination/12h is dark) and continues to cultivate 8-9 days
After by differentiated go out adventitious bud callus after proceed on regeneration culture medium (250mL tissue culture bottle), continue illumination cultivation.By the time
Adventitious bud is then transferred in root media after growing up to the seedling that 4-6cm is high, and at 28 DEG C, between illumination cultivation, (12h illumination/12h is black
Cultivate under the conditions of secretly) about 15 days, obtain transformant plant, move on to chamber planting (T0 generation), take blade after January and carry out the PCR positive
Identify (Hpt-F:5 '-CTATTTCTTTGCCCTCGGAC-3 ', Hpt-R:5 '-CCTGACCTATTGCATCTCCC-3 '), and receive
Obtain its positive plant seed (T1 generation).Fig. 5 is: transgenic and WT lines PCR positive identification, transfer-gen plant all obtains
Hpt specific band, and wild type control does not has amplified band.
Table 6 genetic transformation used medium and formula thereof
4, transfer-gen plant histochemical stain
Select T2For the seed that transgenic and wild type Japan are fine, being seeded in PCR plate after accelerating germination, every hole broadcasts one, training
Foster condition be illumination/dark be 16/8h, illumination condition 25 DEG C, dark condition 23 DEG C, light intensity 300001x.In 3 leaf phase and booting
Phase takes each tissue and carries out GUS staining analysis.
Result shows rRSP1, rRSP3, rRSP5 only specifically expressing in root system, and rRSP2 has at root system and aerial tissues
Activity, rRSP2 has the highest activity in root system, has more weak expression activity on the ground in tissue, and positive control A2P is at root
System and blade there is stronger activity (Fig. 6).The present invention is researching plant root character, and root traits is correlated with breeding or kind
Improvement aspect has highly important theory and using value.
Claims (5)
1. the application in rice root specifically expressing of the promoter DNA shown in sequence 5 in sequence table.
2. in plant, start genes of interest containing the recombinant expression carrier of the promoter DNA shown in sequence 5 in ordered list to transcribe
Application in expression；Described plant is Oryza sativa L..
Application the most according to claim 2, it is characterised in that: described recombinant expression carrier is for inserting institute before genes of interest
State what the promoter DNA shown in sequence 5 in sequence table obtained.
Application the most according to claim 3, it is characterised in that: in the building process of described recombinant expression carrier, described
Sequence table adds before the promoter DNA shown in sequence 5 enhancer or suppresses sub-element.
5. contain the expression vector of promoter DNA described in claim 1,2 or 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310465919.3A CN103468682B (en) | 2013-10-09 | 2013-10-09 | Rice root specific expression promoter is excavated and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310465919.3A CN103468682B (en) | 2013-10-09 | 2013-10-09 | Rice root specific expression promoter is excavated and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103468682A CN103468682A (en) | 2013-12-25 |
| CN103468682B true CN103468682B (en) | 2016-11-09 |
Family
ID=49793723
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310465919.3A Active CN103468682B (en) | 2013-10-09 | 2013-10-09 | Rice root specific expression promoter is excavated and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103468682B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058324B (en) * | 2017-06-15 | 2020-07-03 | 安徽省农业科学院水稻研究所 | Rice root specific expression promoter POsRO4 and corresponding rice cultivation method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154298A (en) * | 2011-03-24 | 2011-08-17 | 浙江大学 | Specific promoter Os023g37190 of rice root and application thereof |
| CN102242119A (en) * | 2011-03-25 | 2011-11-16 | 浙江大学 | Rice root-specific promoter Os03g01700 and application thereof |
-
2013
- 2013-10-09 CN CN201310465919.3A patent/CN103468682B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154298A (en) * | 2011-03-24 | 2011-08-17 | 浙江大学 | Specific promoter Os023g37190 of rice root and application thereof |
| CN102242119A (en) * | 2011-03-25 | 2011-11-16 | 浙江大学 | Rice root-specific promoter Os03g01700 and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 水稻CesA4 基因启动子与GUS基因融合表达;王文芳等;《现代生物医学进展》;20091231;1459-1461 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103468682A (en) | 2013-12-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Overexpression of rice NAC gene SNAC1 improves drought and salt tolerance by enhancing root development and reducing transpiration rate in transgenic cotton | |
| EP1968372B1 (en) | Promoter sequence obtained from rice and methods of use | |
| Hernandez-Garcia et al. | High level transgenic expression of soybean (Glycine max) GmERF and Gmubi gene promoters isolated by a novel promoter analysis pipeline | |
| BRPI0620312A2 (en) | monocotyledon plants with nitrogen efficiency | |
| CN103408648B (en) | Application of paddy rice BG1 proteins and encoding genes of paddy rice BG1 proteins to adjusting growth and development of plants | |
| Koyama et al. | Promoter of Arabidopsis thaliana phosphate transporter gene drives root-specific expression of transgene in rice | |
| An et al. | Agrobacterium-mediated genetic transformation and regeneration of transgenic plants using leaf midribs as explants in ramie [Boehmeria nivea (L.) Gaud] | |
| Hernandez-Garcia et al. | A novel cis-acting element in the GmERF3 promoter contributes to inducible gene expression in soybean and tobacco after wounding | |
| CN110408605A (en) | Rice Os GA2ox8 albumen and its encoding gene and recombinant vector are applied in enhancing plant drought resistance | |
| Jia et al. | Salt stress induced soybean GmIFS1 expression and isoflavone accumulation and salt tolerance in transgenic soybean cotyledon hairy roots and tobacco | |
| CN105838726B (en) | A kind of Salt Tolerance Gene in Alfalfa gene M sCDPK and its coding albumen and application | |
| Xun et al. | Analysis of expression characteristics of soybean leaf and root tissue-specific promoters in Arabidopsis and soybean | |
| CN105647940B (en) | The method and its application of OsGRF6 gene raising rice yield | |
| CN104004073B (en) | Derive from disease resistance associated protein TaCPK7-R of Semen Tritici aestivi and relevant biological material thereof and application | |
| CN103468682B (en) | Rice root specific expression promoter is excavated and application | |
| CN106591324A (en) | Millet siasr4 gene and application | |
| US10597670B2 (en) | PHD gene involved in development and formation of plant phloem | |
| CN104017061B (en) | Transcription factor ZmbZIP17 and encoding gene and its application in response adverse circumstance | |
| CN108359670A (en) | Improve microRNA genes and its application of arsenic stress rice tolerance | |
| CN103468740B (en) | Application of OsDRAP1 genes of rice in enhancing plant drought resistance | |
| CN104774826B (en) | A kind of histone deacetylase and its encoding gene and application | |
| CN101831429B (en) | Promoter and expression mode identification of rice endosperm specific expression gene | |
| CN104946663A (en) | Cotton draught-resistant gene GhSNAC1 and applications thereof | |
| CN103451193B (en) | Populus deltoidesx populus nigra PdHSP70 gene and application thereof | |
| CN103509820B (en) | Application OsDRUP1 gene of rice to reinforcement on drought resistance of plant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |