CN102061309A - Transgenic method for agrobacterium-mediated rice living body - Google Patents
Transgenic method for agrobacterium-mediated rice living body Download PDFInfo
- Publication number
- CN102061309A CN102061309A CN 201010560948 CN201010560948A CN102061309A CN 102061309 A CN102061309 A CN 102061309A CN 201010560948 CN201010560948 CN 201010560948 CN 201010560948 A CN201010560948 A CN 201010560948A CN 102061309 A CN102061309 A CN 102061309A
- Authority
- CN
- China
- Prior art keywords
- transgenic
- rice
- plant
- positive
- agrobacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a transgenic method for agrobacterium-mediated rice living body, and the method comprises the following steps: A) young ear transforming process: diluting an agrobacterium solution in a liquid LB (lysogeny broth) culture medium after measuring the concentration of the agrobacterium by using a spectrophotometer; B) screening phytocide for transgenic positive seedlings: screening the transgenic positive rice for the phytocide, and in the screening process, accelerating germination of the seeds acquired through Pcambia3301-uBi transformation and then seeding the seeds into a nutrition bowl; C) detection PCR (polymerase chain reaction) identification for transgenic positive strain: identifying that the screened transgenic positive rice is a position plant; and D) GUS (glucuronidase) detection for the transgenic positive plant: taking a fresh leave referring to 9311 and transgenic positive plant, directly soaking the fresh leave into the solution, expressing the GUS gene in the leave of the transgenic plant, dyeing the leave into dark blue leave, and if the exogenous gene expression of the transgenic rice is normal, proving that the rice is positive. The method has feasibility, has transformation efficiency reaching 0.33-1.59%, is simple and practical, breaks the bottleneck of the transgenosis operation for rice, especially for nonglutinous rice, and has a higher application value.
Description
Technical field
The present invention relates to paddy rice live body field of transgenic technology, more specifically relate to a kind of agriculture bacillus mediated paddy rice live body transgenic method, be applicable to long-grained nonglutinous rice and japonica rice, and variously can utilize agriculture bacillus mediated plasmid.
Background technology
Nineteen eighty-three, usefulness such as the botanist Zambryski of Washington, DC university cut into the agrobacterium tumefaciens (At) of tumor gene and have realized the transgenosis test of anti-kanamycin gene (npt II) on tobacco first, the tobacco of render transgenic has the characteristic (Wang Qinfang etc., 2000) of anti-kantlex.The new agrotechnique revolution of global transgenic plant research, development and utilization has been drawn back in the research of this initiative.As: U.S. Monsanto Company is incorporated into the toxin gene of coding Bacillus thuringiensis on the plants such as cotton, tobacco, cultivates Insect Resistant Cotton and pest-resistant tobacco new variety at first.Increasing example proves that transgenic plant not only can be improved crop yield, be improved quality; Also can be used for producing the exploitation of the Chemicals that are of value to the healthy food of people, medicine and promotion environment protection.Therefore, the developing transgenic plant research has broad application prospects.Since first genetically modified crops kind commercialization in 1996 plantation, the cultivated area of whole world genetically modified crops increases year by year, average growth rate per annum reaches 15% after 2000, and now existing genetically engineered soybean, corn, cotton and rape have entered the large-scale commercial applications application stage.To 2005, global genetically modified crops area reached 9,000 ten thousand hectares.With the transgenosis proterties, the area maximum be the antiweed genetically modified crops, secondly be the insect-resistant transgenic crop.Cultivated area as China's Insect Resistant Cotton accounts for more than 66% of the cotton total area (Huang Junying, 2007).Important farm crop such as transgenic paddy rice, tomato, potato, tobacco are also progressively entering commercialization stage now.
Paddy rice is most important in the world food crop, and therefore, the genetic improvement of paddy rice enjoys people to pay close attention to always, and it is significant to ensureing world food safety and improving people's living standard.But according to the literature, at present the transgenic method of paddy rice is mainly still by callus, and length not only consuming time, efficient are low, and are subjected to genotypic restriction (Qin Dynasty brocade etc., 2008).Especially long-grained nonglutinous rice is the bottleneck (Ning Yuese etc., 2007) of restriction paddy gene project scale application because the differentiation regeneration frequency of tissue culture is low always.Therefore, since transgenic technology was born, people were exploring the transgenic method that is fit to paddy rice always, improvement rice quality and output.Scientific research personnel's cooperation of " science " magazine in 2000 report Germany and Switzerland will contain 3 kinds of foreign genes (two from flower of Chinese Narcissus, from bacterium) rice transformation kind and obtain golden rice varieties, can produce provitamin A.2005, the scientist of Britain is by further effort, golden rice is further improved, having obtained can commercial golden rice varieties, the throughput of its Vitamin A reaches more than the 35mg/g, this plays important pushing effect (Tang, 2009) to improving Africa and Asia area teenager Vitamin A shortage.In addition, Biological Technology institute, Chinese Academy of Agricultural Sciences cooperates successfully to have obtained the trans Bt gene hybrid rice with the Hua Zhong Agriculture University, and the toxic effect of striped rice borer, yellow rice borer and Cnaphalocrocis medinali(rice leaf roller) is reached 95%.But the breakthrough that the progress of these rice genetic engineerings does not bring transgenic method to learn, therefore, the genetically modified research of paddy rice remains one of obstacle of rice genetic engineering.How to utilize external source beneficial gene improvement rice varieties in order to inquire into, for many years, people are carrying out various trials always, inquire into, study the high-efficiency genetic transforming method of paddy rice.
Through test and exploration for many years, we with specific heterogenous expression carrier as research object, adopt the Agrobacterium injection of solution to soak the young fringe in reduction division and tetrad period, infect the tender germinal tissue of children, with exogenous origin gene integrator in the genome of acceptor plant.Use for the ease of mass-producing, we adopt the double-tagging expression vector that carries GUS and Bar gene.Spray screening at the simple weedicide of process and can obtain the positive paddy rice of strain, and can be by the positive strain of further PCR molecule qualitative detection.
In our research, once injected up to a hundred spikes of rice, transformation efficiency reaches 0.33-1.59%.And be incorporated in the genome of acceptor paddy rice and normal expression through PCR and GUS dyeing double check proof exogenous plasmid.What is more important, this research adopt be rice variety 9311 as acceptor, fully proved this method Application feasibility in long-grained nonglutinous rice.Therefore, its success will make the conversion of long-grained nonglutinous rice no longer become the obstacle of rice genetic engineering, for China extensively the application of the biotechnology of the long-grained nonglutinous rice of cultivation started bright prospect.
Summary of the invention
The objective of the invention is to be to provide a kind of agriculture bacillus mediated paddy rice live body transgenic method, easy to implement the method, easy and simple to handle, this invention relates to produces long-grained nonglutinous rice and the japonica rice variety of going up plantation, and better transformation efficiency is all arranged.This method relates to the selection that transforms the Agrobacterium concentration range, with the OD of Agrobacterium solution
600Value was at 0.3～0.6 o'clock changing effect optimum.The exogenous plasmid that can be used for agriculture bacillus mediated genetic transformation paddy rice, plant expression plasmid by agriculture bacillus mediated can be effectively with exogenous origin gene integrator in rice genome.The selection of rice transformation developmental stage is no matter long-grained nonglutinous rice and japonica rice are the periods of the most effective conversion in paddy rice sporule meiophase and tetrad period.
To achieve these goals, the present invention relates to following technical measures:
A kind of agriculture bacillus mediated paddy rice live body transgenic method the steps include:
1, young fringe conversion processing:
After utilizing spectrophotometric determination Agrobacterium concentration, agrobacterium strains EH105A (available from the Beijing DingGuo ChangSheng Biology Technology Co., Ltd) solution is diluted to OD with liquid LB substratum
600Value 0.3～0.6 is divided in the 1.5ml centrifuge tube standby by 1ml then.
Injection treatment: according to the morphological feature that paddy rice grows, select sporule reduction division, hang up label, carry out mark to the tetrad young fringe in period.During injection, at first draw the 1ml Agrobacterium with syringe, the right hand is taken syringe, and left hand pinches the middle part of ear stem, and syringe is inserted gently from the middle and upper part sideling, and when feel arrived suddenly by the sensation of plug hole, expression syringe needle this moment had inserted the stem cavity.Pushing syringe is slowly slowly annotated agrobacterium liquid into fringe chamber then.If intravenous extravasation is arranged, illustrate and do not find the stem cavity accurately, need syringe is extracted insertion again.After the injection, bagging, list, and indicate kind, date, concentration and developmental stage at tag board.After the injection treatment 40～50 days, gather in the crops ripe spike of rice.
2, the herbicide screening of transgenic positive seedling:
Because transgene carrier pCAMBIA3301-ubi (buying from Bios Cambialab company) carries antiweed Glufosinate ammonium (Basta) gene, therefore, utilizes the weedicide Glufosinate ammonium can effectively screen the transgenic positive paddy rice.During screening, the seed ordinary method that the pCAMBIA3301-ubi conversion processing is obtained (Ding Ying chief editor, the rice in China cultivation, Chinese agriculture press, 1961) after the vernalization, all be seeded in the nutrition pot, with non-transgenic 9311 (asking for an interview the genetic resources table) is contrast, seedling stage, spraying concentration was the Glufosinate ammonium of 50mg/l during 2 leaves, 1 heart, sprayed continuously two days, once a day.After four days, most plant flavescence, after the week, except positive transgenosis seedling still green, other false positive young plant is all withered.These resistant plants of acting normally are transplanted to new Culture basin, be used for follow-up Molecular Detection.
3, the detection PCR of transgenic positive strain identifies:
In order further to verify the reliability of the positive plant that the antiweed Glufosinate ammonium filters out, total DNA that the applicant has extracted its blade again carries out the PCR detection.Ubi primer (the ubi-F:TGTTTCTTTTGTCGATGCTCACCC that this experiment is designed; Ubi-R:TTCTATCGCGGCTTAACGTAATTCA) the purpose clip size that amplifies is about 200bp, if amplify in the transfer-gen plant specificity, with purpose band 200bp band of the same size, the i.e. positive plant of transgenic paddy rice that filters out of explanation.And 9311 and negative control all without any amplified production.
4, the GUS of transgenic positive strain detects:
In order further to identify whether normal expression in the acceptor plant of foreign gene, the applicant adopts histochemical staining method to analyze the expression of gus gene in transfer-gen plant.Specifically promptly: get in X-Gluc (the 5-bromo-4 chloro-3-indoles glucosides) solution that contrast 9311 and the fresh blade of transgenic positive plant directly be immersed in 0.5mg/ml and handle 3h, observe the expression of gus gene in paddy rice in the transfer-gen plant.Coloration result shows that gus gene is strongly expressed in the blade of transfer-gen plant, and blade is coloured to mazarine; Make a sharp contrast for light color and positive paddy rice and contrast 9311 blade.Foreign gene normal expression in the presentation of results transgenic paddy rice proves that further it is positive.
Advantage of the present invention:
(1) the present invention does not need tissue culture, therefore, can avoid the low genotype restriction that brings of long-grained nonglutinous rice differentiation ratio in the rice tissue culturing process;
(2) the present invention has exempted the needed special culturing room of tissue culture, has simplified experiment condition, has reduced experimental expenses significantly;
(3) schedule of operation of the present invention is simple, convenient, and materials consumption is few, increases substantially transformation efficiency
(4) the present invention makes full use of weedicide and carries out scale selection in seedling stage, and the space is few, the time is short, and is simple, efficient low-consume.
Further the proof foreign gene has been incorporated in the genome of acceptor paddy rice.This studies have shown that paddy rice live body transgenic method has feasibility, and transformation efficiency reaches 0.33-1.59%.This method is easy, practical, has broken through the especially technical bottleneck of long-grained nonglutinous rice transgeneic procedure of paddy rice, has stronger using value.
Table 1. Agrobacterium live body conversion method and tissue culture transgenic method relative merits are relatively
| Characteristics | Tissue culture method | Agrobacterium live body conversion method |
| Tissue culture procedures | Need | Do not have |
| Experimental installation drops into | Greatly, need special tissue culture room, | Little, do not need tissue culture room |
| Transformation period | ＞April | 40～50 days |
| The scope of application | Japonica rice is main, the minority long-grained nonglutinous rice | Long-grained nonglutinous rice, japonica rice are unrestricted |
| Transformation efficiency | ～1％ | ～1.6％ |
| The conversion scale | Can only transform individual gene, small scale at every turn | High-throughput can transform a plurality of genes simultaneously, the incalculability restriction |
| Capital contribution | ＞100 yuan/seedling | ＜10 yuan/seedling |
Description of drawings
Fig. 1 is the screening synoptic diagram of a kind of transgenic positive plant.
Fig. 2 A is that PCR and the GUS of a kind of transgenic positive plant identifies synoptic diagram.
Fig. 2 B is that PCR and the GUS of a kind of transgenic positive plant identifies synoptic diagram.
Fig. 2 A:PCR identifies .DNA marker, DL2000; 1,9311; 2, negative control; 3-7, transfer-gen plant.
Fig. 2 B:GUS evaluation of dyeing.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Be to be understood that, these case study on implementation only are used to the present invention is described and are not used in restriction the scope of protection of present invention, unreceipted concrete experiment condition and method in the following example, usually according to normal condition as chief editors such as J. Sa nurse Brookers, Science Press, 1992, molecular cloning experiment guide (second edition); DL Spector etc., Science Press, 2001, cell experiment guide; Lv Hongsheng, Science Press, 1982; Or connect the condition of advising according to manufacturer.
A kind of agriculture bacillus mediated paddy rice live body transgenic method the steps include:
1, young fringe conversion processing:
After utilizing the concentration of spectrophotometric determination agrobacterium strains EH105A (available from the Beijing DingGuo ChangSheng Biology Technology Co., Ltd), Agrobacterium solution is diluted to OD with liquid LB substratum
600Value 0.3～0.6 is divided in the 1.5ml centrifuge tube standby by 1ml then.
Injection treatment: according to rice varieties 9311 or force (the seeing the genetic resources table) morphological feature of growing of educating round-grained rice No. 15, select reduction division, hang up label, carry out mark to the tetrad young fringe in period.During injection, at first syringe is drawn the 1ml Agrobacterium, and the right hand is taken syringe, and left hand pinches the middle part of ear stem, and syringe is inserted gently from the middle and upper part sideling, and when feel arrived suddenly by the sensation of plug hole, expression syringe needle this moment had inserted the stem cavity.Pushing syringe is slowly slowly annotated agrobacterium liquid into fringe chamber then.Find the stem cavity during injection accurately, guaranteeing does not have fluid seepage.After the injection, tag board write raise variety, date, concentration and developmental stage.108 9311 ripe spikes of rice that different Agrobacterium concentration gradients are handled have been gathered in the crops in this research altogether.Total as can be seen from Table 2 grain number and setting percentage and injection concentration are inversely proportional to, and along with the increase of Agrobacterium concentration, total grain number reduces gradually, and setting percentage reduces.Illustrate that Agrobacterium processing spike of rice can reduce the quantity of grain husk flower to a certain extent.(Agrobacterium is injected the investigation of 9311 spike of rice setting percentages and asks for an interview table 2)
Table 2. Agrobacterium is injected 9311 spike of rice setting percentages and investigates
2, the conversion processing of different genotype paddy rice:
In order to analyze susceptibility and the transformation efficiency of different paddy gene types to the transgenosis agroinfection, the applicant has selected rice variety 9311 and japonica rice variety force to educate round-grained rice No. 15, and (seeing the genetic resources table) two kinds are injected conversion respectively with the Agrobacterium solution of OD value 0.4 and 0.6 at tetrad period, each kind is injected 20 fringes, the mark of listing after the injection; Difference harvester for rice fringe when ripe.Wherein, when concentration of treatment was OD value 0.4, the setting percentage of two kinds was all above 60%, and when concentration of treatment was 0.6,9311 setting percentage was 38.5%, and it is 42.7% that force is educated 15 of round-grained rice.And the identification and analysis of transgenic positive paddy rice shows, 9311 transformation efficiency is 0.88-0.98%, and military transformation efficiency of educating round-grained rice 15 is 0.97-1.04%.Two interracial positive transgenic paddy rice ratios are more approaching, illustrate when utilizing this method to handle, and between the indica rice susceptibility of agroinfection and the transformation efficiency of foreign gene are more or less the same.(9311 and the transformation efficiency of No. 15, Wu Yu round-grained rice injection Agrobacterium relatively ask for an interview table 3)
The transformation efficiency of No. 15 injections of table 3.9311 and Wu Yu round-grained rice Agrobacterium relatively
3, seedling spraying Basta screening transgenic positive strain:
Because transgene carrier pCAMBIA3301-ubi (buying from Bios Cambialab company) carries antiweed Glufosinate ammonium (Basta) gene, therefore, utilizes the weedicide Glufosinate ammonium can effectively screen the transgenic positive paddy rice.During screening, with the seed that pCAMBIA3301-ubi conversion processing 9311 is obtained, all being seeded in the nutrition pot, is contrast with non-transgenic 9311 seedling, and seedling stages 2, leaf was the Basta of 50mg/L with spraying concentration during 1 heart stage, sprayed twice continuously, once a day.Sprayed the back the 4th day, most plant flavescence, after the week, except 27 seedling still green, other young plant all withered (Fig. 1).Wherein most effective with the rice conversion of OD value 0.5 processing, reach 1.59%, and minimum (table 4) of OD value 0.3.In the resistant plant that this 27 strain is acted normally, select 5 strains to transplant to new Culture basin at random, be used for follow-up Molecular Detection.
Table 4.9311 injection transforms the weedicide Basta screening (50mM) of positive plant
4, the detection ubi PCR of transgenic positive strain identifies
In order further to verify the reliability of the positive plant that antiweed filters out, the applicant has extracted wherein total DNA of the positive rice leaf of 5 strains again and has carried out PCR and detect.The purpose clip size that the designed ubi primer amplification of this experiment goes out is about 200bp, by Fig. 2 left side as can be seen, no matter 9311 or negative photograph, all without any amplified production, and in 5 transfer-gen plants a specific band of 200bp is arranged all, consistent with purpose band size; The positive plant of these transgenic paddy rices that proof filters out.
5, the GUS of transgenic positive strain detects
In order further to identify whether normal expression in the acceptor plant of foreign gene, the applicant adopts histochemical staining method to analyze the expression of gus gene in transfer-gen plant.Specifically promptly: get in X-Gluc (the 5-bromo-4 chloro-3-indoles glucosides) solution that contrast 9311 and the fresh blade of transgenic positive plant directly be immersed in 0.5mg/ml and handle 3h, observe the expression of gus gene in paddy rice in the transfer-gen plant.Coloration result shows that gus gene is strongly expressed in the blade of transfer-gen plant, and blade is coloured to mazarine; Make a sharp contrast for light color and positive paddy rice and contrast 9311 blade.Foreign gene normal expression in the presentation of results transgenic paddy rice proves that further it is positive.
Claims (1)
1. an agriculture bacillus mediated paddy rice live body transgenic method the steps include:
A, young fringe conversion processing: after utilizing spectrophotometric determination Agrobacterium concentration, Agrobacterium solution is diluted to OD600 value 0.3～0.6 with liquid LB substratum, is divided in the 1.5ml centrifuge tube standby by 1ml then;
Injection treatment: select reduction division to the tetrad young fringe in period, hang up label, carry out mark, during injection, at first syringe is drawn the 1ml Agrobacterium, syringe is inserted sideling pushing syringe from the middle and upper part, agrobacterium liquid is annotated into fringe chamber, after the injection, bagging, list, and indicate kind, date, concentration and developmental stage at tag board, after the injection treatment 40～50 days, gather in the crops ripe spike of rice;
B, the herbicide screening of transgenic positive seedling: transgene carrier pCAMBIA3301-ubi carries antiweed Glufosinate ammonium gene, utilize weedicide Glufosinate ammonium screening transgenic positive paddy rice, during screening, after the seed ordinary method vernalization that the pCAMBIA3301-ubi conversion processing is obtained, be seeded in the nutrition pot, with non-transgenic 9311 is contrast, seedling stage, spraying concentration was the Basta of 50mg/l during 2 leaves, 1 heart, sprayed continuously two days, once a day, after four days, most plant flavescence are after one week, except positive transgenosis seedling still green, other false positive young plant is all withered, and normal resistant plant is transplanted to new Culture basin, is used for follow-up Molecular Detection;
The detection PCR of C, transgenic positive strain identifies: in order further to verify the positive plant that antiweed filters out, the total DNA that has extracted its blade carries out PCR and detects designed ubi primer ubi-F:TGTTTCTTTTGTCGATGCTCACCC; The purpose clip size that ubi-R:TTCTATCGCGGCTTAACGTAATTCA amplifies is 200bp, amplify in the transfer-gen plant specificity, with purpose band 200bp band of the same size, the positive plant of the transgenic paddy rice that filters out;
The GUS of D, transgenic positive strain detects: in order further to identify foreign gene normal expression in the acceptor plant, adopt histochemical staining method to analyze the expression of gus gene in transfer-gen plant, get in the X-Gluc:5-bromo-4 chloro-3-indoles glucoside solution that contrast 9311 and the fresh blade of transgenic positive plant directly be immersed in 0.5 mg/ml and handle 3h, observe the expression of gus gene in paddy rice in the transfer-gen plant, coloration result shows, gus gene is expressed in the blade of transfer-gen plant, and blade is coloured to mazarine; The blade of contrast 9311 is that light color and positive paddy rice make a sharp contrast, and foreign gene normal expression in the transgenic paddy rice further proves the positive.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010560948 CN102061309A (en) | 2010-11-25 | 2010-11-25 | Transgenic method for agrobacterium-mediated rice living body |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010560948 CN102061309A (en) | 2010-11-25 | 2010-11-25 | Transgenic method for agrobacterium-mediated rice living body |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102061309A true CN102061309A (en) | 2011-05-18 |
Family
ID=43996815
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010560948 Pending CN102061309A (en) | 2010-11-25 | 2010-11-25 | Transgenic method for agrobacterium-mediated rice living body |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102061309A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110244005A (en) * | 2019-06-15 | 2019-09-17 | 吉林省农业科学院 | A kind of rapid detection method that soybean plant strain is drifted about by external source Bar gene |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0257472A2 (en) * | 1986-08-14 | 1988-03-02 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Transgenic monocotyledonous plants, seeds thereof and process for the preparation of the plants |
| CN1602672A (en) * | 2004-11-08 | 2005-04-06 | 安徽农业大学 | Easy and efficient agrobacterium tumefaciens induced corn gene transfer method |
| CN1687424A (en) * | 2005-05-13 | 2005-10-26 | 吉林省农业科学院 | Transgene method for plant |
| CN101717749A (en) * | 2009-12-22 | 2010-06-02 | 武汉大学 | Nonglutinous rice callus culture medium and genetic transformation method mediated by agrobacterium tumfaciens |
| CN101775409A (en) * | 2010-03-17 | 2010-07-14 | 吉林省农业科学院 | Method for obtaining transgenic corns by infecting young ears with agrobacterium |
-
2010
- 2010-11-25 CN CN 201010560948 patent/CN102061309A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0257472A2 (en) * | 1986-08-14 | 1988-03-02 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Transgenic monocotyledonous plants, seeds thereof and process for the preparation of the plants |
| CN1602672A (en) * | 2004-11-08 | 2005-04-06 | 安徽农业大学 | Easy and efficient agrobacterium tumefaciens induced corn gene transfer method |
| CN1687424A (en) * | 2005-05-13 | 2005-10-26 | 吉林省农业科学院 | Transgene method for plant |
| CN101717749A (en) * | 2009-12-22 | 2010-06-02 | 武汉大学 | Nonglutinous rice callus culture medium and genetic transformation method mediated by agrobacterium tumfaciens |
| CN101775409A (en) * | 2010-03-17 | 2010-07-14 | 吉林省农业科学院 | Method for obtaining transgenic corns by infecting young ears with agrobacterium |
Non-Patent Citations (2)
| Title |
|---|
| 《作物研究》 19970930 李绍清等 水稻遗传转化研究进展 , 第03期 * |
| 《分子植物育种》 20060328 胡利华等 利用农杆菌介导法将柠檬酸合成酶基因(CS)导入籼稻品种明恢86 , 第02期 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110244005A (en) * | 2019-06-15 | 2019-09-17 | 吉林省农业科学院 | A kind of rapid detection method that soybean plant strain is drifted about by external source Bar gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103266132B (en) | Tribactur cry1Ah/cry1Ie bivalent gene expression vector and application thereof | |
| CN100415890C (en) | Method for regeration of citrus internode stem and genetic transformation | |
| CN103205459A (en) | Agrobacterium-mediated sugarcane genetic transformation method with vacuum infiltration assistance | |
| Zhang et al. | A simple and efficient in planta transformation method for pommelo (Citrus maxima) using Agrobacterium tumefaciens | |
| CN105407708A (en) | Plants resistant to pathogenic microorganisms growing in vascular tissues | |
| Shamim et al. | Expression of drought tolerance in transgenic cotton | |
| CN107302915B (en) | Crop weed control method | |
| CN102433356A (en) | Agrobacterium-mediated transgenic method for mature seed embryos of corn | |
| CN103952439A (en) | Method for carrying out bacteriostatic culture after genetic transformation of arabidopsis thaliana | |
| CN108967182A (en) | A kind of selection of precocious, high ginning outturn cotton line | |
| CN106754925A (en) | A kind of abscisic acid rapid induction promoter and its application | |
| CN102337295A (en) | Agrobacterium-mediated melon seedling apex transformation method | |
| CN117187294A (en) | Application of BnaC5.ACBP4 gene in improving flooding resistance of plants | |
| CN104878039A (en) | Mulberry transgenic method based on agrobacterium tumefacien mediated hybernacle injection | |
| CN102851297B (en) | Myzuspersicae hunchback gene cDNA and application thereof | |
| CN101775409A (en) | Method for obtaining transgenic corns by infecting young ears with agrobacterium | |
| CN102174565A (en) | Method for fast genetic transformation of rice | |
| CN103589731B (en) | Evoked promoter and the application thereof of Whitfield's ointment SA and jasmonic JA induction can be responded simultaneously | |
| CN100413965C (en) | Phosphorus starvation induced gene promoter and its application | |
| CN103224954A (en) | Method for breeding transgenic soybeans through Agrobacterium tumefaciens mediated transformation | |
| CN102061309A (en) | Transgenic method for agrobacterium-mediated rice living body | |
| CN108165572A (en) | A kind of agriculture bacillus mediated needle thorn growing point transformed wheat method | |
| CN115725643A (en) | Application of NtMYB35 transcription factor in tobacco black shank resistance | |
| CN104726488A (en) | Method for culturing stress-resistance herbicide-resistance transgenic aerobic rice | |
| CN102533851A (en) | Corn gene normal position transformation method mediated by high throughput agrobacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110518 |