CN102051341A - Construction method of interrupted strain in acyB1 gene and method for converting interrupted strain into tylosin - Google Patents
Construction method of interrupted strain in acyB1 gene and method for converting interrupted strain into tylosin Download PDFInfo
- Publication number
- CN102051341A CN102051341A CN2009102108202A CN200910210820A CN102051341A CN 102051341 A CN102051341 A CN 102051341A CN 2009102108202 A CN2009102108202 A CN 2009102108202A CN 200910210820 A CN200910210820 A CN 200910210820A CN 102051341 A CN102051341 A CN 102051341A
- Authority
- CN
- China
- Prior art keywords
- gene
- acyb1
- tylosin
- heat
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a construction method of an interrupted strain in an acyB1 gene and a method for converting the interrupted strain into tylosin. The construction method comprises the following steps of: cloning a gene segment containing acyB1 genes from heat-resistant streptomyces coelicolor genome DNA (Deoxyribonucleic Acid) according to a reported gene sequence information design primer to obtain a recombinant vector containing the acyB1 gene segment; constructing a recombinant vector of which the acyB1 genes are broken through an SOE-PCR (Splicing Overlap Extension-Polymerase Chain Reaction) technology; introducing the vector into heat-resistant streptomyces coelicolor through conjugational transfer between colibacillus and streptomyces; obtaining a heat-resistant streptomyces coelicolor gene mutation strain of which the acyB1 genes are broken through homologous recombination, resistance screening, PCR (Polymerase Chain Reaction) verification and HPLC-MS (High Performance Liquid Chromatography-Mass Spectrometry) analysis; and converting the gene mutation strain into macrolide antibiotics to obtain acetyl macrolide antibiotics. The invention provides a platform for carrying out specific acylation transformation on the macrolide antibiotics.
Description
Technical field
The invention discloses a kind of heat-resisting streptomyces gene engineering bacteria, and to transform tylosin with this bacterium be the method for acetyl tylosin.According to the gene order information design primer of having reported, the gene fragment clone that will contain the acyB1 gene from heat-resisting streptomyces gene group DNA gets off, and obtains containing the recombinant vectors of acyB1 gene fragment; By SOE-PCR technique construction acyB1 gene destroyed recombinant vectors; Shift by engaging between intestinal bacteria-streptomyces, this carrier is imported in the heat-resisting streptomycete; Obtain the ruined heat-resisting streptomyces gene mutant strain of acyB1 gene by homologous recombination, resistance screening, PCR checking and HPLC-MS analysis; This transgenation strain is transformed macrolide antibiotics, obtain the acetyl macrolide antibiotics.This research work is that macrolide antibiotics carries out the transformation of specificity acylations and set up a platform.
Background technology
Heat-resisting streptomycete is a kind of streptomycete with extremely important industrial value, and its importance does not lie in its secondary metabolite Magnamycin A that produces, and is its bio-transformation tylosin production acetylisovaleryl tylosin (AIV).AIV is a kind of important tylosin derivative, is mainly used in the mycoplasma infection diseases of treatment livestock and poultry.Existingly studies show that respectively the gene of being responsible for ethanoylization and isovaleryl function is acyA gene and acyB1 gene, and the positive regulator gene acyB2 of acyB1.Acy and acyB1-B2 are in succession in heterologous host, as expressing in muta lead mycillin and streptomyces fradiae.In streptomyces fradiae, expressed the acyA-acyB1-acyB2 gene by plasmid is free, obtained the AIV of expection, but output is also distant apart from suitability for industrialized production.
Developed very sophisticated gene clone and functional analysis system in the streptomycete, the gene that is based on homologous recombination wherein commonly used interrupts and gene substitution technique, and its ultimate principle as shown in Figure 1.
Be of convenient length and chromosome segment A, the B consistent as carrying two on the plasmid of gene substitution with natural direction.Be inserted with the resistant gene D that expresses in streptomycete between the fragment, carrier part also contains the resistant gene E that expresses in streptomycete simultaneously.Accordingly, the homologous fragment on the karyomit(e) is A, B, and C then is will be by resistant gene D metathetical purpose fragment between A and the B.Gene substitution is under antibiotic selective pressure, take place with the form of single copy or low copy, so plasmid does not generally duplicate in recipient bacterium.The form that plasmid usually adopts has several, as a single function carrier that only in intestinal bacteria, duplicates, and temperature-sensitive type plasmid or duplicate and the defective plasmid of stabilization function.When plasmid changes recipient bacterium over to, can obtain to take place the transformant that single cross is changed by monoclonal antibody or two anti-screening, plasmid at this moment by and karyomit(e) on reorganization between the homologous fragment be incorporated on the karyomit(e).With above-mentioned transformant under relaxation condition, grow a generation or several generations, can improve the frequency that the secondary exchange takes place greatly, pass through photomechanical printing or dibbling then on two kinds of different microbiotic flat boards, picking promptly may be that producer interrupts or the metathetical bacterial strain to a transformant that inserts resistance marker D sensitivity only.If A, B directly link to each other, the chromosome structure that obtains at last is that resistance marker inserts between A, the B and related gene is interrupted, and being called gene interrupts; If separated by the C fragment in the middle of A, the B, the chromosome structure that obtains at last is that resistance marker is replaced the C fragment and with gene disruption, is called gene substitution.
Summary of the invention
The main purpose of this research is exactly the method for interrupting by gene; make up the interrupted heat-resisting streptomyces gene recombinant bacterial strain of acyB1 gene; the heat-resisting streptomyces gene engineering recombinant bacterial strain that is only had the ethanoyl function is for the foundation of macrolide antibiotics acylations platform provides " core component ".This bacterium now on July 15th, 2009 in China Committee for Culture Collection of Microorganisms's common micro-organisms center preservation (address: Datun Road, Chaoyang District, Beijing City Institute of Micro-biology of the Chinese Academy of Sciences; Postcode: 100101), deposit number is CGMCC No.3193, classification called after Streptomyces thermotolerans.
Another object of the present invention is, a kind of construction process of said gene engineering bacteria is provided, promptly by SOE-PCR technique construction acyB1 gene destroyed recombinant vectors.For achieving the above object, the present invention has adopted following technical scheme:
On the one hand, provided by the present invention the heat-resisting streptomyces gene engineering bacteria with acetylize tylosin function obtains by interrupting the acyB1 gene.
Existingly studies show that respectively the gene of being responsible for ethanoylization and isovaleryl function is acyA gene and acyB1 gene, will have no progeny in the acyB1 gene, obtain can only the acetylize tylosin heat-resisting streptomycete.
On the other hand, the invention provides make up the acyB1 gene destroyed the method for recombinant vectors, shift by engaging between intestinal bacteria-streptomyces again, this carrier is imported in the heat-resisting streptomycete.The recombinant vectors that the acyB1 gene is destroyed becomes by the SOE-PCR technique construction, comprising following steps:
The 1acyB1 gene interrupts both sides exchange arm and acc (3) IV resistance box pcr amplification: according to acyB1 gene of having announced and both sides gene order thereof, with heat-resisting streptomyces gene group DNA is template, design two pairs of primers acyB1 gene that increases respectively and be interrupted exchange arm about the 1.4kb of sequence both sides, be template with plasmid pIJ773 again, design the resistant gene break box that a pair of primer amplification contains apramycin resistant gene aac (3) IV and conjugal transfer initiation site oriT.Reaction conditions: 95 ℃ of 45s, 66 ℃ of 60s, 72 ℃ of 90s, 30Cycles; 72 ℃ are extended 5min.After reaction was finished, electrophoresis detection was to the dna fragmentation of three treaty 1.4kb.
2SOE-PCR makes up acyB1 gene interrupt structure: the PCR product that amplification obtains carries out SOE-PCR, reaction conditions after the gel electrophoresis purifying reclaims quantitatively: 95 ℃ of 45s, 72 ℃ of 6min, 30Cycles; 72 ℃ are extended 10min.After reaction is finished, the dna fragmentation of electrophoresis detection to a 4.2kb, resulting PCR product reclaims test kit through DNA and reclaims purifying, and the BglII enzyme is cut the back and is inserted in the BmaHI site of pIJ2925.By the apramycin resistance screening, obtain positive colony that interruption takes place some acyB1 genes, called after pZM2009.
The 3acyB1 gene interrupts the structure of carrier: selected for use SuperCos1 as gene replacement vector.PZM2009 is reclaimed the fragment of 4.2kb and insert in the SuperCos1 carrier after the BglII enzyme is cut, the corresponding acyB1 gene that obtains interrupts carrier pZM2010.
The 4acyB1 gene interrupts carrier and imports heat-resisting streptomycete: 1) with pZM2010 transformed into escherichia coli ET12567/pUZ8002; The heat-resisting streptomycete mycelium of inoculation 1ml is cultivated 18h for 34 ℃ in 9ml YEME substratum;
2) with the heat-resisting streptomycete mycelium of ultrasonication, switching 2ml culture continues at 34 ℃ and cultivates continuation cultivation 16h in the fresh TSB substratum of 18ml.While picking one intestinal bacteria transformant is 37 ℃ of cultivation 16h in the LB substratum that contains apramycin (Am), kantlex (Km), paraxin (Cml);
3) with the heat-resisting streptomycete mycelium of ultrasonication, switching 1ml culture continues to cultivate 3～4h in the fresh TSB substratum of 9ml in 34 ℃.The culture of Escherichia coli of transferring is simultaneously cultivated 3～4h in having added above-mentioned three kinds of antibiotic fresh LB substratum; Collect streptomycete mycelium and culture of Escherichia coli simultaneously, 3500rpm is centrifugal, and 10min removes supernatant, collects thalline, with fresh TSB suspension thalline.3500rpm removed supernatant in centrifugal again 10 minutes, with the TSB suspension thalline of 1/10 volume;
4) the streptomycete mycelium is carried out appropriate dilution, select suitable extent of dilution,, cultivated 18～20 hours in 34 ℃ with coating the YEME substratum after intestinal bacteria and the mixing of streptomycete mycelia equal-volume;
5) from 34 ℃ of incubators, take out culture, cover with the 1ml sterilized water that contains apramycin (1000 μ g/ml) and nalidixic acid (500 μ g/ml).Grew the resistance bacterium colony that 5～30 quantity do not wait in 3～5 days on the rear plate.
5 screening acyB1 genes interrupt the double exchange bacterial strain: the some resistance bacterium colonies of picking, separate application has added the resistant panel of apramycin and the resistant panel of kantlex.Do not need by loosening cultivation, can directly screen and obtain the double exchange bacterial strain that the acyB1 gene interrupts, double exchange frequency 〉=10%, resulting mutant strain called after ZM7.
The present invention also provides a kind of method of heat-resisting streptomycete bio-transformation tylosin, and its concrete steps are as follows:
1 seed culture method: from improveing the single bacterium colony of picking ZM7 on the Gause I substratum, insert in the first order seed shake-flask culture base, seed shake-flask culture base loading amount is that 50ml/500ml shakes bottle, 30 ℃ of shaking tables, and 200RPM cultivates about 48hr.Get 0.2ml first order seed nutrient solution and transfer in secondary seed medium, 30 ℃ are shaken bottle, and 200RPM cultivates about 24hr.
2 fermentation method for transformation: get 3ml secondary seed nutrient solution and be inoculated in the fermentation shake flask substratum, fermentation shake flask substratum loading amount is that 50ml/500ml shakes bottle, behind 30 ℃ of fermentation 48hr, adds the tylosin substrate in nutrient solution, after continuing to transform about 48hr, following shaking table.
3 Liquid Detection tylosins, acetyl tylosin and isovaleryl tylosin: get fermented liquid 10ml; add 50% methyl alcohol 10ml; ultrasonication 30min; 0.45um membrane filtration fermented liquid; after an amount of dilution of the sample of handling, carry out the online detection of liquid matter, the result as shown in Figure 3; show that the A component in the tylosin can only be converted to acetyl tylosin A, does not detect the isovaleryl derivative of isovaleryl tylosin A and other component of tylosin.
Description of drawings
Below, describe the principle of the invention and embodiment in conjunction with the accompanying drawings in detail, wherein:
Fig. 1 gene interrupts or the principle,displacement synoptic diagram
Fig. 2 acyB1 gene order (CDS) (underscore part)
The liquid phase collection of illustrative plates of Fig. 3 tylosin bioconversion product
Embodiment
Followingly the present invention is described with reference to specific embodiment.It will be appreciated by those skilled in the art that these embodiment only are used to illustrate the present invention, the scope that it does not limit the present invention in any way.
Embodiment 1: the acyB1 gene interrupts the structure of bacterial strain
The 1acyB1 gene interrupts both sides exchange arm and acc (3) IV resistance box pcr amplification
According to gene BLAST result (sequence sees accompanying drawing for details), it is as follows that we design acyB1 gene interruption primer sequence:
P-acyB1-1：ga
agatctatggctgcgctcctgaagc
P-acyB1-2：ggtcgacggatccccggaattctacatgttcccgccggtg
P-acyB1-3：caccggcgggaacatgtaga
attccggggatccgtcgacc
P-acyB1-4：gcccctgccgaaacatcttc
tgtaggctggagctgcttc
P-acyB1-5：gaagcatctccagcctacagaagatgtttcggcaggggc
P-acyB1-6：ga
agatcttcagcgggacagggccgg
(P-acyB1-1﹠amp; The underscore of P-acyB1-6 partly is the BglII recognition site, P-acyB1-3﹠amp; The underscore of P-acyB1-4 partly is the primer sites on the plasmid PIJ773, primer P-acyB1-2 and the complementation of P-acyB1-3 sequence, primer P-acyB1-4 and the complementation of P-acyB1-5 sequence)
According to acyB1 gene of having announced and both sides gene order thereof, with heat-resisting streptomyces gene group DNA is template, design two pairs of primers acyB1 gene that increases respectively and be interrupted exchange arm about the 1.4kb of sequence both sides, be template with plasmid pIJ773 again, design the resistant gene break box that a pair of primer amplification contains apramycin resistant gene aac (3) IV and conjugal transfer initiation site oriT.Reaction conditions: 95 ℃ of 45s, 66 ℃ of 60s, 72 ℃ of 90s, 30Cycles; 72 ℃ are extended 5min.After reaction was finished, electrophoresis detection met with the expectation situation fully to the dna fragmentation of three treaty 1.4kb.
2SOE-PCR makes up acyB1 gene interrupt structure
The PCR product that amplification obtains carries out SOE-PCR, reaction conditions after the gel electrophoresis purifying reclaims quantitatively: 95 ℃ of 45s, 72 ℃ of 6min, 30Cycles; 72 ℃ are extended 10min.After reaction was finished, the dna fragmentation of electrophoresis detection to a 4.2kb met fully with the expectation situation.Resulting PCR product reclaims test kit through DNA and reclaims purifying, and the BglII enzyme is cut the back and inserted in the BmaHI site of pIJ2925.By the apramycin resistance screening, obtain positive colony that interruption takes place some acyB1 genes, called after pZM2009.
The sub-pZM2009 of resulting positive colony is carried out PCR and enzyme again cut checking, result and SOE-PCR make up acyB1 gene interrupt structure and meet fully.
The 3acyB1 gene interrupts the structure of carrier
PZM2009 does not contain the streptomycete replicon, but is adapted at the resistance marker that screens in the streptomycete system because it does not contain other, so be not suitable as the gene substitution that the suicide vector that shuttles back and forth is used for streptomycete.Therefore, this research has selected for use SuperCos1 as gene replacement vector.PZM2009 is reclaimed the fragment of 4.2kb and insert in the SuperCos1 carrier after the BglII enzyme is cut, the corresponding acyB1 gene that obtains interrupts carrier pZM2010.
The 4acyB1 gene interrupts carrier and imports heat-resisting streptomycete
1) with pZM2010 transformed into escherichia coli ET12567/pUZ8002; The heat-resisting streptomycete mycelium of inoculation 1ml is cultivated 18h for 34 ℃ in 9ml YEME substratum;
2) with the heat-resisting streptomycete mycelium of ultrasonication, switching 2ml culture continues at 34 ℃ and cultivates continuation cultivation 16h in the fresh TSB substratum of 18ml.While picking one intestinal bacteria transformant is 37 ℃ of cultivation 16h in the LB substratum that contains apramycin (Am), kantlex (Km), paraxin (Cml);
3) with the heat-resisting streptomycete mycelium of ultrasonication, switching 1ml culture continues to cultivate 3～4h in the fresh TSB substratum of 9ml in 34 ℃.The culture of Escherichia coli of transferring is simultaneously cultivated 3～4h in having added above-mentioned three kinds of antibiotic fresh LB substratum; Collect streptomycete mycelium and culture of Escherichia coli simultaneously, 3500rpm is centrifugal, and 10min removes supernatant, collects thalline, with fresh TSB suspension thalline.3500rpm removed supernatant in centrifugal again 10 minutes, with the TSB suspension thalline of 1/10 volume;
4) the streptomycete mycelium is carried out appropriate dilution, select suitable extent of dilution,, cultivated 18～20 hours in 34 ℃ with coating the YEME substratum after intestinal bacteria and the mixing of streptomycete mycelia equal-volume;
5) from 34 ℃ of incubators, take out culture, cover with the 1ml sterilized water that contains apramycin (1000 μ g/ml) and nalidixic acid (500g/ml).Grew the resistance bacterium colony that 5～30 quantity do not wait in 3～5 days on the rear plate.
5 screening acyB1 genes interrupt the double exchange bacterial strain
The some resistance bacterium colonies of picking, separate application has added the resistant panel of apramycin and the resistant panel of kantlex.Do not need by loosening cultivation, can directly screen and obtain the double exchange bacterial strain that the acyB1 gene interrupts, double exchange frequency 〉=10%, resulting mutant strain called after ZM7.
It in this example the composition (preparation method who comprises some individual events) of some substratum of being applied to
LB (Luria-Bertani) substratum (Sambrook et al., 1989)
Tryptones 10g, yeast extract 5g, NaCl 5g, distilled water 1000ml, pH7.0.
LA substratum (Sambrook et al., 1989)
The adding final concentration is 1.5% agar powder among the LB.
Yeast extract paste-maltose substratum (YEME) (Kisser et al., 2000)
Difco yeast extract 3g, Difco peptone 5g, Oxoid maltose 3g, glucose 10g, sucrose 103g, distilled water 1000ml, 115 ℃ of sterilization 25min face with before adding MgCl
26H
2O (2.5M) 2ml/1.
Improvement Gause I substratum
W-Gum 20g, NaCl 0.5g, KNO
31g, FeSO
40.01g, K
2HPO
40.5g, MgSO
47H
2O 0.5g, agar 20g, distilled water 1000ml, pH 7.0-7.2
The intestinal bacteria cultural method
In the LB substratum, 37 ℃ of shaking tables, 200RPM overnight incubation.
Heat-resisting streptomycete cultural method
In improvement Gause I substratum, standby behind 30 ℃ of constant incubators cultivation one all product spores.
Heat-resisting streptomycete mycelium culture method
In the YEME substratum, 30 ℃ of shaking tables, the 200RPM shaking table was cultivated 48 hours.
Heat-resisting streptomyces gene group DNA extraction method
With the heat-resisting streptomycete mycelium of YEME culture medium culturing, draw a certain amount of bacterium liquid in the 1.5ml centrifuge tube, the centrifugal 15min of 3000rpm collects thalline, add twice back of 1ml 10.3% sucrose solution washing thalline with the 500 μ l lysozyme solns 50mg mycelium that suspends again, become translucent to cell in 37 ℃ of about 30min of incubation.Add 500 μ l 2%SDS, mixing the about 1min of vibration significantly descends up to the viscosity of solution, 55 ℃ of incubation 15min, add the neutral phenol/chloroform of 1/10 volume 3M sodium-acetate (unbuffered) and 200 μ l then, after mixing vibration evenly, the centrifugal 5min of 12000rpm draws supernatant liquor carefully, discards white middle layer.Repeat four or five extractings till cannot see (or considerably less) middle layer with neutral phenol/chloroform, add the Virahol (or dehydrated alcohol of 2.2 times of volumes) of 1 times of volume at last, put upside down repeatedly and put the appearance of cotton-shaped DNA precipitation.Get the precipitation piece with the rifle choicest and place a new centrifuge tube, add 75% washing with alcohol DNA twice, discard all supernatant liquors at last, treat that ethanol volatilizees after, be dissolved in a certain amount of TE damping fluid.
The escherichia coli plasmid extracting method
Intestinal bacteria are 37 ℃ of overnight incubation in adding suitable antibiotic LB substratum, collect bacterium liquid with the 1.5ml centrifuge tube, the centrifugal 30s of 12000rpm goes supernatant to collect thalline, solution I (the 50mM glucose that adds 200 μ l precoolings, 25mM Tris-HCl, 10mM EDTA, pH8.0) suspension thalline, vibration evenly back adds 400 μ l solution II (0.2M NaOH, 1%SDS), put upside down fast about 10 times and mix (it is soft that action is wanted), and then (the 3.0M potassium acetate pH4.8) mixes to add 300 μ l solution III, the centrifugal 5min of 12000rpm, draw supernatant,, draw supernatant behind the centrifugal 5min of 12000rpm with 1/4 volume phenol chloroformic solution vibration extracting, add 1 times of volume isopropanol precipitating plasmid DNA, remove supernatant collecting precipitation thing behind the centrifugal 5min,, put and add a certain amount of TE damping fluid or ddH after worktable dries up with 70% washing with alcohol twice
2The O dissolving.
PCR
Reaction system and reaction conditions that PCR reaction reference reagent company product description is recommended carry out.The enzyme that this institute uses is the LA-Taq enzyme (being used for long-chain PCR and high-fidelity PCR) of TaKaRa company.
Long-chain PCR reaction system is as follows:
Each 1 μ l of primer (20pmol/ μ l)
Template DNA (about 30ng/ μ l) 1 μ l
DMSO 2.5μl
2×GC?Buffer?II 25μl
DNTPs mixture (2.5mM) 8 μ l
LA-Taq or Taq (5U) 0.5 μ l
ddH
2O 11.0μl
Cumulative volume 50 μ l
The dna fragmentation recycling step
1) from reaction solution, reclaims the PCR product
With 0.4ml purifying resin (use before fully mixing) the centrifugal purification post of packing into, add the PCR reaction solution that 50～100 μ l do not have paraffin oil then, left standstill 3 minutes after putting upside down mixing.Centrifugal 30 seconds of 13000rpm outwells the waste liquid in the collection tube.Add 500 μ l, 80% Virahols (or ethanol), centrifugal 30 seconds of 13000rpm outwells the waste liquid in the collection tube.Repeated for second step once, centrifugal 2 minutes of this step 13000rpm must eliminate Virahol (or ethanol).If also residual on the purification column have Virahol (or ethanol), centrifugal again 1 minute.Purification column is inserted in the clean 1.5ml centrifuge tube, adds 50 μ l ultrapure waters or TE damping fluid on the purifying resin, can not be bonded on the tube wall.Place after 2 minutes centrifugal 30 seconds of 13000r/min.Liquid in the centrifuge tube promptly is the PCR product of purifying, gets 4 μ l electrophoresis detection.
2) from plain agar sugar gel, reclaim dna fragmentation
With PCR reaction solution or endonuclease reaction liquid (50～100 μ l reaction system) electrophoresis on 1% plain agar sugar gel of no paraffin oil, dyeing.Under long-wave ultra violet lamp, downcut rapidly and contain the segmental sepharose of target dna, and in the 2ml centrifuge tube of packing into.Cut away the sepharose that does not contain DNA, simplified operation like this improves the quality of yield and dna fragmentation as far as possible.Add 0.4ml purifying resin (abundant mixing before using) in the 200-400mg sepharose, 70 ℃ are incubated 5-10 minute, put upside down mixing 1 time, sepharose is melted fully in per two minutes.For the sepharose (2.0%) of high density, add 500 μ l purifying resins in the sepharose of every 200mg, extend to 15 minutes heat-up time and will mix the liquid centrifugal purification post of packing into, centrifugal 30 seconds of 13000rpm outwells the waste liquid in the collection tube.Add 500 μ l, 80% Virahols (or ethanol), centrifugal 30 seconds of 13000rpm outwells the waste liquid in the collection tube.Repeated for 4 steps once, centrifugal 2 minutes of this step 13000rpm must be with Virahol (or ethanol), centrifugal again 1 minute.Purification column is inserted in clean 1.5ml or the 2ml centrifuge tube, adds 40 μ l ultrapure waters or TE damping fluid on the purifying resin, can not be bonded on the tube wall.Place after 2 minutes centrifugal 30 seconds of 13000rpm.Liquid in the centrifuge tube promptly is the PCR product of purifying, gets 4 μ l electrophoresis detection.
DNA connects
Be used for the carrier DNA of DNA ligation and exogenous dna fragment after suitable restriction restriction endonuclease cutting, use T behind the purifying
4Dna ligase connects.Enzyme connects that the ratio of foreign DNA and carrier should be 3～4 in the reaction system: 1, and the enzyme disjunctor is about 20 μ l, 16 ℃ of enzymes connect reaction and spend the night or place the room temperature enzyme to connect reserve in 2～3 hours and transform and use.
Embodiment 2: the acyB1 gene interrupts bacterial strain and transforms tylosin
1 seed culture method
From improveing the single bacterium colony of picking ZM7 on the Gause I substratum, insert in the first order seed shake-flask culture base, seed shake-flask culture base loading amount is that 50ml/500ml shakes bottle, 30 ℃ of shaking tables, 200RPM cultivates about 48hr.Get 0.2ml first order seed nutrient solution and transfer in secondary seed medium, 30 ℃ are shaken bottle, and 200RPM cultivates about 24hr.
2 fermentation method for transformation
Get 3ml secondary seed nutrient solution and be inoculated in the fermentation shake flask substratum, behind 30 ℃ of fermentation 48hr, in nutrient solution, add the tylosin substrate, after continuation transforms about 48hr, following shaking table.
3 Liquid Detection tylosins, acetyl tylosin and isovaleryl tylosin
Get fermented liquid 10ml; add 50% methyl alcohol 10ml; ultrasonication 30min; 0.45um membrane filtration fermented liquid; after an amount of dilution of the sample of handling, carry out the online detection of liquid matter, the result as shown in Figure 3; show that the A component in the tylosin can only be converted to acetyl tylosin A, does not detect the isovaleryl derivative of isovaleryl tylosin A and other component of tylosin.
Below be some medium components (preparation method who comprises some individual events) that are applied in the example
Heat-resisting streptomycete seed shake-flask culture base
Soyflour 15g, W-Gum 30g, yeast extract 2g, K
2HPO
40.5g, MgSO
47H
2O 0.5g, tap water 1000ml, pH 7.0-7.2.
The fermentation shake flask substratum
W-Gum 30g, soyflour 30g, yeast extract 2g, MgSO
47H
2O 5g, K
2HPO
4100g, KH
2PO
460g, defoamer 0.2ml, tap water 1000ml, PH 7.0-7.2.
Substrate preparation and feed supplement method
The 3g tylosin is dissolved in the 100ml distilled water, uses 0.22 micron sterilizing filter filtration sterilization, get the 5ml tylosin and add in the 50ml fermented liquid.
Detection is tired with the preparation of moving phase
Acetonitrile: ammonium acetate: Glacial acetic acid=45: 45: 10, Spirit of Mindererus concentration are 0.15M.
Sequence table
＜110〉Zhongmu Industry Co.,Ltd
＜120〉the acyB1 gene interrupts the method for the structure and the conversion tylosin thereof of bacterial strain
<130>ZM001
<160>7
<170>PatentIn?version?3.5
<210>1
<211>27
<212>DNA
<213>Streptomyces?thermotolerans
<400>1
gaagatctat?ggctgcgctc?ctgaagc 27
<210>2
<211>40
<212>DNA
<213>Streptomyces?thermotolerans
<400>2
ggtcgacgga?tccccggaat?tctacatgtt?cccgccggtg 40
<210>3
<211>40
<212>DNA
<213>Streptomyces?thermotolerans
<400>3
caccggcggg?aacatgtaga?attccgggga?tccgtcgacc 40
<210>4
<211>39
<212>DNA
<213>Streptomyces?thermotolerans
<400>4
gcccctgccg?aaacatcttc?tgtaggctgg?agctgcttc 39
<210>5
<211>39
<212>DNA
<213>Streptomyces?thermotolerans
<400>5
gaagcatctc?cagcctacag?aagatgtttc?ggcaggggc 39
<210>6
<211>26
<212>DNA
<213>Streptomyces?thermotolerans
<400>6
gaagatcttc?agcgggacag?ggccgg 26
<210>7
<211>2749
<212>DNA
<213>Streptomyces?thermotolerans
<400>7
gatcacactc?ttcgaggaac?tccacgggcg?ctgacgcacg?cggcgagggc?gcgccccgca 60
ccggtcgtcc?cgcgtcggct?acggagtgcc?ggacggggcg?ggttcggacc?tgggtgtcga 120
gccggcgtcc?ggggaccgcc?gcggccgtcc?cagggttcgc?atgaccggct?tctccacgaa 180
gaagtgcagg?aacgccgaca?gccccagcgc?cagcgtgaag?gcgagcaggg?tcagcccgac 240
ggcggccggt?gtgtcccact?gccggtaata?gccctgcttc?ccgccggcga?agcggtgccc 300
gtactggatg?atcaggtagt?gcacgaggta?gaaggcgaag?gtgagttccc?ccagcagcac 360
catcgtcctg?gtccccagcc?aggagcggac?gccgcgcaca?tcaccgacgg?ccaccgaggc 420
gagcagcagc?gcgatcaccg?ggacggtcaa?cgcgccgggg?tcgtagtggt?tcggcaccgc 480
gaacgtcacc?gcgaacaccg?ctgagaacag?cgcgacgcag?gccaggggac?gcgggcccct 540
ccagcgtccc?cggatcacga?tctgggccat?gagcatcccg?agcacgaact?ccagcagccg 600
caccggcggg?aacatgtaga?tgaaccacca?ccgcagctgc?ggcatgtccg?ggtcccacgg 660
caggggcggg?ctggccggca?gcagcagtgc?gaccaggggg?atggagacgg?cggccacgga 720
caccgcggcg?gcccaccgcc?agagccggtc?cgtacggacc?ttggtgaaga?aggcgaagag 780
gaacgggaac?atggcgtaga?agaacagctc?gcaggagagc?gaccacgcca?ccgggttcat 840
gctgccgtac?tcgtggtggt?cggggaacca?tgcctggatc?agcagcaggt?tcgtgagcag 900
tccgtcccac?accgatcggc?ccatgttggg?ctcgttgagg?gccagcacga?tcagcagcgt 960
caccagcagc?acgggcaggt?gcagcgagta?cgcgcggacc?gtgcgccgcc?gccagaagtt 1020
caccttggac?ttgtcgggca?gacccgccca?ggtgaggacg?aaaccgctga?gcatgaagaa 1080
gaacgagacc?gtcagcgggc?ccagccggtt?cagcgggaac?tgcagcgcgg?aattgatctc 1140
ggtgttcttg?aagaacggct?gtgtcgatat?atgggaggtg?aataccagta?gagcggagat 1200
gaaacgcatc?ccgccgagcg?cgggaagatg?tttcggcagg?ggcatgggtg?acctcgcggc 1260
ggacgggtgg?gcgggagcag?atgtctaagg?caccgcgcgg?ccgccgggca?aggcgtatct 1320
gacaaagagt?gtgagccgcc?gcgcgacagt?ggtgtgttcc?caccgctgca?cggccggcga 1380
cggtggtttc?gtcaccgggc?gacgcggatt?taatcatccg?gaaacacgga?cgacggttct 1440
tcgcggcggt?gtgacgcgag?gtgtgcggga?agaattgtgt?ggcctcggca?cctggattta 1500
cggaacgaat?taactgaggc?tggccagcag?gtcttttcca?gtggatcaag?cggcttgtga 1560
gggtcatagt?gcacagtatt?ccgtgtggct?caaaaccgtc?ggcctccatg?tgggacaccg 1620
gtgtccatga?cgacttcgat?acgcacatct?ccgagacctg?ctcggagctg?ttcagttcgc 1680
tgcgccgggc?cgaccagcgc?aagaggggcg?aacagtacgt?ccgtggtctg?ctcaccgctc 1740
agggacgcaa?gaccgcccgc?aacctcgccg?cgttcgtcgg?tgaaggcgcc?gcggaccaga 1800
acctccacca?cttcgtggcc?ggatccacct?gggactggcg?ctccgtgcgt?gccgcgctgg 1860
cccgctacgc?cgaccagacg?gtacgcgggg?acgcgtgggt?gatccgcccc?atggtggtct 1920
acaaggcagg?gggacggtcg?gtcggcgtgg?gccggcgctt?cgtacccgac?ctggggcggg 1980
tggtcagctg?tcagcagagc?tacgggctct?ggctcgcctc?cgacgccatg?tcggcaccgg 2040
tgaactggca?tctgacgctg?ggcggcggac?cgggcgaccg?tcacgatcgg?cagctgagcg 2100
cgtacggcga?ggaggagaag?ctcgtcgacc?tggtggcgga?actcacgcgc?tcgaaccggg 2160
tgttggcgcg?tccggtggtg?atggacgcgc?ggatcgccac?gctgccccgg?ctggttcggg 2220
cgctgtccgc?ggctgatcaa?tcgtttctct?taagggtgagcggcgatctt?ccgctcgccc 2280
tcgccggcag?ccggggccaa?ctggacaggc?gcgcgcaggt?ctggcccgcc?cagcacctca 2340
tggaacagct?caagcggctc?aggcgccctg?tggagtggca?gggctccatc?agcttcgtcg 2400
ccccgtgcaa?cgtggtgctg?accgatcagc?tgccgcagcg?cacgctcctg?ctgttcgggg 2460
tgtggcgcgc?caaccgcagg?cgacccgcgg?acctgtggct?caccgacctc?acgtcctgga 2520
accgcggcgc?actgctgcgg?ctggccatgc?tgacctgccg?cgtggacgcc?gacttcgccc 2580
gcgtcagcct?gggcgtcggc?atccgcgact?tcgagggccg?ctccttccag?ggctggcacc 2640
gtcacgtgac?actggcctcg?atagcccacg?ccctacgcct?ttcctgcacc?gacaccgccc 2700
gcacccccac?ggccccggcc?ctgtcccgct?gacggtgagg?tcacggggc 2749
Claims (3)
1. heat-resisting streptomycete CGMCC No.3193.
2. the recombinant vectors pZM2010 that the acyB1 gene of Gou Jianing is destroyed.
3. one kind ferments and transforms the method for tylosin, and this method comprises cultivates heat-resisting streptomycete CGMCC No.3193 earlier, mends the tylosin substrate then in fermented liquid, carries out bio-transformation.Leavening temperature is 30 ℃, and fermention medium PH is 7.0-7.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102108202A CN102051341A (en) | 2009-11-11 | 2009-11-11 | Construction method of interrupted strain in acyB1 gene and method for converting interrupted strain into tylosin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102108202A CN102051341A (en) | 2009-11-11 | 2009-11-11 | Construction method of interrupted strain in acyB1 gene and method for converting interrupted strain into tylosin |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102051341A true CN102051341A (en) | 2011-05-11 |
Family
ID=43956142
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102108202A Pending CN102051341A (en) | 2009-11-11 | 2009-11-11 | Construction method of interrupted strain in acyB1 gene and method for converting interrupted strain into tylosin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102051341A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103276031A (en) * | 2013-06-28 | 2013-09-04 | 宁夏泰瑞制药股份有限公司 | Culture medium for producing acetylisovaleryltylosin by fermenting streptomyces thermotolerans and fermentation method |
-
2009
- 2009-11-11 CN CN2009102108202A patent/CN102051341A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103276031A (en) * | 2013-06-28 | 2013-09-04 | 宁夏泰瑞制药股份有限公司 | Culture medium for producing acetylisovaleryltylosin by fermenting streptomyces thermotolerans and fermentation method |
| CN103276031B (en) * | 2013-06-28 | 2015-09-30 | 宁夏泰瑞制药股份有限公司 | A kind of heat-resisting streptomycete fermentation produces substratum and the fermentation process of acetylisovaleryl tylosin |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Stetter et al. | Methanothermus fervidus, sp. nov., a novel extremely thermophilic methanogen isolated from an Icelandic hot spring | |
| KR920006350B1 (en) | Improvements in or relating to antibiotic-producing micro-oganism | |
| CN103468625B (en) | Gene disruption mutant of streptomyces bingchenggensis as well as preparation method and application thereof | |
| CN102181470B (en) | Method for improving yield of Streptomyces antibiotics and plasmid thereof | |
| CN107815478B (en) | Method for producing kasugamycin by fermenting streptomyces aureofaciens BJX007 | |
| CN106497981A (en) | A kind of method of activating microorganisms recessiveness secondary metabolite biological synthesis gene cluster expression | |
| CN103740734A (en) | Biosynthesis gene cluster of Streptomyces xiamenensis, purpose and bacterial strain | |
| CN105821071A (en) | Unmarked gene knock-out method of pediococcus acidilactici DQ2 based on homologous recombination | |
| CN111621454B (en) | Gene engineering high-yield strain streptomyces diastatochromogenes, production method and application of epsilon-polylysine | |
| CN88102798A (en) | Resistenzgen gegen phosphinothricin | |
| CN102703495A (en) | Method for improving yield of streptomycete antibiotic and plasmid thereof | |
| Vaudequin-Dransart et al. | The cryptic plasmid of Agrobacterium tumefaciens cointegrates with the Ti plasmid and cooperates for opine degradation | |
| CN103409341A (en) | Application of relA gene in increase of moenomycin yield of streptomyces bambergiensis and strain | |
| CN102719388A (en) | Method for improving yield of streptomyces antibiotics and plasmids thereof | |
| CN102453708B (en) | Method for increasing yield of streptomyces coeruleorubidus daunorubicin | |
| CN102051341A (en) | Construction method of interrupted strain in acyB1 gene and method for converting interrupted strain into tylosin | |
| Gusek et al. | Review of the Streptomyces lividans/Vector plJ702 System for Gene Cloning | |
| Jian et al. | Identification of genes necessary for jinggangmycin biosynthesis from Streptomyces hygroscopicus 10-22 | |
| CN105255936A (en) | Method for establishing salinispora arenlocola CNS-205 gene genetic manipulation system | |
| CN103820362A (en) | Construction of biosynthesis gentamicin X2 engineering bacteria and application thereof | |
| CN101381722B (en) | Method for improving streptomyces bambergiensis bambermycin yield and bacterial strain | |
| CN110129244B (en) | Streptomyces chassis strain, construction method thereof and application thereof in heterologous expression research | |
| CN102277310B (en) | Vector-host system for expressing antibiotic gene clusters and application thereof | |
| CN102010846B (en) | Gene blocking mutant for streptomyces coeruleorubidus and preparation method thereof | |
| CN118516289B (en) | Spinosyns Spn016, method for preparing spinosad and method for screening spinosyns |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20110511 |