CN102031268A - Vascular endothelial growth factor-165 (VEGF-165) and HbetaD3 double gene plasmid vector and constructing method thereof - Google Patents
Vascular endothelial growth factor-165 (VEGF-165) and HbetaD3 double gene plasmid vector and constructing method thereof Download PDFInfo
- Publication number
- CN102031268A CN102031268A CN2010102893101A CN201010289310A CN102031268A CN 102031268 A CN102031268 A CN 102031268A CN 2010102893101 A CN2010102893101 A CN 2010102893101A CN 201010289310 A CN201010289310 A CN 201010289310A CN 102031268 A CN102031268 A CN 102031268A
- Authority
- CN
- China
- Prior art keywords
- vegf
- gene
- pvivo1
- mcs
- plasmid vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to a vascular endothelial growth factor-165 (VEGF-165) and HbetaD3 double gene plasmid vector and a constructing method thereof. By using a pVIVO1-mcs plasmid vector system, HbetaD3cDNA acquired from human gingival tissue and VEGF165cDNA acquired from leukemia cells (HL-60) are constructed by enzyme digestion recombination to obtain recombinant plasmid pVIVO1-mcs-VEGF165-HbetaD3. In the invention, the VEGF capable of specifically promoting epithelial cell proliferation and the HbetaD3 capable of resisting bacteria and fungi and neutralizing poison are recombined on the same vector and expressed together, and when being applied to healing of wounds, the VEGF-165 and HbetaD3 double gene plasmid vector can promote epithelia repair of the surface of wounds and also can enhance the immunity of the internal environment of the wounds, thus achieving working along both lines. The invention can play an important role in gene therapy of healing of wounds and in the field of tissue engineering study, and has wide application prospect.
Description
Technical field
The invention belongs to biological gene treatment field, specifically, relate to the plasmid vector and the construction process thereof that can in gene recombination technology, use; More particularly, relate to have dual-gene eukaryotic expression recombinant plasmid vector of VEGF-165 and H β D3 and construction process thereof.
Background technology
Raising day by day along with The development in society and economy and industrialization degree, death due to wound and other unexpected injuries has become the fourth-largest cause of death that is only second to malignant tumour, cardiovascular and cerebrovascular diseases, respiratory system disease in China, then holds pride of place in person between twenty and fifty.Therefore, carrying out after wound and the wound research of tissue repair in a deep going way and be not only the needs that traumatic medicine deeply develops, also is the important need of modern social development.At present; reparation for jaw face and other position wound of human body; particularly the trauma repair of large organization disappearance adopts the treatment pattern of " with the trauma repair wound " more; though tangible curative effect is played in the reparation to local wound tissue disappearance; saved patient's life; disposable tissue flap is transplanted and is repaired wound damaged treatment time that has also shortened the patient greatly after the wound; but because the source of tissue flap is the normal body at other position of patient body; postoperative must be for bringing new wound for the district; stay new scar; even dysfunction, the quality of life of patient's postoperative is brought certain influence.Treating this disease as the mode of how " not having wound and repairing wound ", is problem anxious to be solved at present.
The agglutination that occurs coordination behind the body injury is comprising complicated role of network between various kinds of cell, cytokine and the extracellular matrix.Cytokine has vital role in wound healing process, it can regulate the various kinds of cell reaction in the processes of wound repair, influence cell proliferation, migration, extracellular matrix synthesizes and release etc.In numerous cytokines, vascular endothelial growth factor (VEGF) is an important promoting healing factor, immunohistochemical methods shows that the expression of VEGF mainly is arranged in the endochylema of epithelial cell, inoblast and scavenger cell, no matter be in the tissue of the different repairing phases of tissue or wound back before wound, VEGF all is the persistence positive expression, prompting VEGF has the source than horn of plenty in jaw facial tissue, shown its effect that can bring into play.Therefore, our specificity selects VEGF as the active polypeptide that promotes wound healing, is comparatively desirable and feasible.
Adopting antibiotic therapy for the infection in the wound is the method for using always, really can effectively suppress or kill sensitive bacterial, but antibiotic can not neutralize a toxin, can not resist fungi, in addition, especially broad-spectrum antibiotics also can increase the weight of the normal ecological flora imbalance joint device of F in the body, further weaken the little ecological protective screen of organismic internal environment, formed new infection-induced factor.Discover that alexin (defensin) has obvious sterilization and bacteriostatic action, and antimycotic and toxopexic effect is arranged, its effect and alexin amount are proportionate, and alexin has unique advantage aspect anti-infective in body.Alexin is the autarcetic important medium that body is resisted the pathogenic micro-organism invasion, human beta-defensin (1～3) wide expression is in oral cavity tissue, as tissues such as oral mucosa, sialisterium, gum, tongues, in oral epithelium natural host defensive raction, play a significant role.Wherein beta-defensin-3 is insensitive to salt concn with respect to other alexin, the gold-coloured staphylococci of multidrug resistance and the enterococcus faecalis of anti-vancocin had powerful germicidal action, stronger to gram-positive microorganism lethality, and do not influence internal environment of oral cavity micro-ecological bacterial group, not injuring human tissue cell, is the active antibacterial peptide that infects in the anti-oral cavity of ideal.
To sum up, the present invention is directed to the clinical incidence height of human body soft tissue wound, harm is heavy, the problem in science that treatment is difficult, intend preferred VEGF-165 and alexin-3 for realizing both having promoted surface of a wound epithelial repair, Synergistic treatment strategy that again can the enhancing body immunity is dealt with problems, for effective treatment body soft-tissue trauma provides new way.
Summary of the invention
One of purpose of the present invention: be to make up a kind of people VEGF-165 and human alpha-defensin 3 dual-gene recombinant plasmid vectors, for gene therapy body soft-tissue trauma provides new approach.
Two of purpose of the present invention: the construction process that provides above-mentioned recombinant plasmid vector.
One of purpose of the present invention is achieved through the following technical solutions:
VEGF-165 and the dual-gene plasmid vector of H β D3 is characterized in that: described recombinant plasmid vector comprises people VEGF-165 and people H β D3 gene.
Wherein, the VEGF-165 gene order is as described in the sequence table 1.H β D3 gene order is as described in the sequence table 2.The structure iron of pVIVO1-mcs plasmid vector is as shown in table 3, and it is the 968-974bp zone that H β D3 gene is inserted into carrier MCS1 site, and it is the 4085-4098bp zone that the VEGF-165 gene is inserted into carrier MCS2 site.Utilize pVIVO1-mcs plasmid vector system, be built into recombinant plasmid pVIVO1-mcs-VEGF165-H β D3.
The used plasmid vector pVIVO1-mcs of the present invention is the double gene coexpression eukaryotic vector, and host range is wide, transfection efficiency and gene expression dose height, the transient expression, security is better, be the excellent carrier of gene therapy, it is comparatively desirable to be applied to wound healing and organizational project etc.
Two of purpose of the present invention is achieved through the following technical solutions:
The construction process of a kind of VEGF-165 and the dual-gene plasmid vector of H β D3 mainly comprises following step:
1) obtains people VEGF-165 and people H β D3 gene;
2) with NcoI and EcoRI H β D3DNA and plasmid pVIVO1-mcs are carried out double digestion, adopt the cohesive end connection method to connect, obtain recombinant plasmid pVIVO1-mcs-H β D3;
3) with BspHI and HindIII recombinant plasmid pVIVO1-mcs-H β D3 and VEGF DNA are carried out double digestion again, adopt the cohesive end connection method to connect, obtain recombinant plasmid pVIVO1-mcs-VEGF165-H β D3;
4) liposome-mediated recombinant plasmid transfection 293FT cell, foreign gene is expressed in cell.
The present invention has following technique effect:
1, the present invention select specificity promote epithelial cell proliferation vascular endothelial growth factor (VEGF) and can antibacterium, the antimycotic and toxopexic human β H β D3 of energy (H β D3) is as active biomolecule, it is cloned among the polygene expression vector pVIVO1-mcs, and with its transfection damage mucous membrane district, make damage local expression secretion of VEGF and H β D3, bring into play the effect of these two kinds of genes simultaneously, promote wound healing.Experimentation on animals fully confirms: VEGF and H β D3 double-gene therapy can be accelerated the difficult more healing of sexual trauma of oral mucosas tissue.
2, vascular endothelial growth factor (VEGF) and human β H β D3 (H β D3) are carried in the present invention on identical carrier, make gene transfection after, two foreign gene coexpressions, collaborative playing a role.Polygene expression vector pVIVO1-mcs is a transient transfection simultaneously, can not produce permanent effect to body after the treatment, thereby avoid the generation of other complication.
Description of drawings
The present invention is further detailed explanation below in conjunction with the drawings and specific embodiments:
Fig. 1 is the structural representation of VEGF-165 and the dual-gene plasmid vector of H β D3;
Goal gene electrophorogram HL-1 that Fig. 2 obtains and HL-2 are from leukemia cell (HL60) and amplify the hVEGF165cDNA gene fragment, and YY is for amplifying H β D3cDNA gene fragment from gingiva tissue;
Fig. 3 recombinant plasmid pVIVO1-mcs-H β D3NcoI and EcoRI double digestion are identified figure;
Fig. 4 recombinant plasmid pVIVO1-mcs-VEGF165-H β D3 double digestion identifies that electrophorogram DL2000 and DL15000 are Marker, P is an empty carrier, VDP165 is a recombinant plasmid, VDP165-D is the H β D3cDNA gene fragment that recombinant plasmid obtains through NcoI, EcoRI double digestion, and VDP165-V is that recombinant plasmid obtains the hVEGF165cDNA gene fragment behind AgeI, HindIII double digestion;
Fig. 5 transfection do immunofluorescence under the light field during 293FT cell 48h of recombinant plasmid pVIVO1-mcs-VEGF165-H β D3;
Fig. 6 transfection do immunofluorescence under the 293FT cell 48h DAPI of recombinant plasmid pVIVO1-mcs-VEGF165-H β D3;
Fig. 7 transfection H β D3 red fluorescence antibody under the 293FT cell 48h green glow of recombinant plasmid pVIVO1-mcs-VEGF165-H β D3;
Fig. 8 transfection VEGF green fluorescence antibody under the 293FT cell 48h blue light of recombinant plasmid pVIVO1-mcs-VEGF165-H β D3.
Embodiment
1.1 material: the patient's gingiva tissue that excises in the operation is provided by southwestern department of stomatology, Hospital, leukemia cell HL-60 is so kind as to give by the Qu Xiaolong master of this institute, the 293FT cell is preserved by this institute, and VEGF165 and H β D3 upstream and downstream primer are synthetic by Shanghai JaRa biotech firm, and other main agents see the following form:
| Reagent | The source |
| Plasmid pVIVO1-mcs | InvivoGen |
| The total RNA extraction reagent box | Dalian is precious biological |
| The little extraction reagent kit of plasmid | Sky, Beijing root |
| The NcoI enzyme | Japan is spun |
| The EcoRI enzyme | Japan is spun |
| The HindIII enzyme | NEB |
| The BspHI enzyme | NEB |
| The AgeI enzyme | NEB |
| Reverse transcription test kit (ReverTra Ace-α) | Japan is spun |
| High-fidelity polysaccharase (KOD-P1us) | Japan is spun |
| Common DNA product purification test kit | Sky, Beijing root |
| The T4DNA ligase enzyme | Dalian is precious biological |
| The TaqDNA polysaccharase | Dalian is precious biological |
| β-defensin3 (K-13) (goat-anti) | SANTA |
| BD-3 fluorescence antibody (the anti-sheep of donkey) (redness) | The green skies |
| VEGF antibody (rabbit is anti-) | The green skies |
| VEGF fluorescence antibody (goat-anti rabbit) (green) | The green skies |
| RNAprep Pure culturing cell/bacterium total RNA extraction reagent box | Sky, Beijing root |
| Lipofectamine2000 (liposome 2000) | invitrogen |
1.2 the structure of eukaryon expression plasmid pVIVO1-mcs-VEGF165-H β D3
1.2.1 synthetic VEGF165 of design and H β D3 upstream and downstream primer
The VEGF165 primer sequence is as follows:
Upstream primer P1:5 '-CGTCATGACCATGAACTTTCTGCTGT-3 ',
Downstream primer P2:5 '-CCCAAGCTTCACCGCCTCGGCTTGTC-3 '.
Introduce the BspHI restriction enzyme site in the P1 design, introduced the HindIII restriction enzyme site in the P2 design.
H β D3 primer sequence is as follows:
Upstream primer P3:5 '-CATGCCATGGCAGCTATGAGGATCCAT-3 ',
Downstream primer P4:5 '-CCGGAATTCTCAGGGTTTTTATTTCT-3 '.
Introduce the NcoI restriction enzyme site in the P3 design, introduced the EcoRI restriction enzyme site in the P4 design.
1.2.2 utilize the RT-PCR method from leukemia cell (HL60) and gingiva tissue, to amplify VEGF165cDNA and H β D3cDNA respectively
According to the operation steps extraction gingiva tissue of the precious biological total RNA extraction reagent box in Dalian and the total RNA in the HL60 cell.Carry out RT-PCR by the reverse transcription test kit (ReverTra Ace-α) and the operation steps of high-fidelity polysaccharase (KOD-Plus) that Japan is spun.The PCR reaction system:
Contain 10 * buffer for KOD-Plus5 μ l, KOD-Plus high-fidelity polysaccharase (10U/ μ 1) 1 μ l, 2mM dNTPs 5 μ l, 25mM MgSO42 μ l, upstream and downstream primer (10 μ m) each 1.5 μ l, reverse transcription reaction liquid 2 μ l, ultrapure water 32 μ l in the 50 μ l systems.
The VEGF165 reaction conditions: 94 ℃ of pre-sex change 5min, 94 ℃ * 30s, 62.6 ℃ * 60s, after totally 35 circulations, 72 ℃ are extended 10min to 72 ℃ * 60s; H β D3 reaction conditions: 94 ℃ of pre-sex change 5min, 94 ℃ * 45s, 48.2 ℃ * 45s, 72 ℃ * 30s is after totally 35 circulations, 72 ℃ * 10min.
1.2.3 the structure of eukaryon expression plasmid pVIVO1-mcs-H β D3
H β D3PCR product is carried out purifying according to the operation steps of the common DNA product purification of sky, Beijing root test kit, H β D3DNA purified product and plasmid pVIVO1-mcs purifying once more behind NcoI, EcoRI double digestion.Measuring their concentration, is in 16 ℃ to be connected at 10: 1 to spend the night by the dna segment and the mole ratio of carrier, connects product and transforms DH5 α, is inoculated in the LB flat board that contains Totomycin (100ug/ml) and is positioned over 37 ℃ of 16h.Select the single bacterium colony enlarged culturing of a plurality of whites, PCR preliminary screening positive colony send order-checking further to confirm after NcoI, EcoRI double digestion are identified.
1.2.4 the structure of eukaryon expression plasmid pVIVO1-mcs-VEGF165-H β D3
The VEGF165PCR product is carried out purifying according to the operation steps of the common DNA product purification of sky, Beijing root test kit, VEGF165DNA purified product and plasmid pVIVO1-mcs-H β D3 purifying once more behind BspHI, HindIII double digestion.Measuring their concentration, is in 16 ℃ to be connected at 10: 1 to spend the night by the dna segment and the mole ratio of carrier, connects product and transforms DH5 α, is inoculated in the LB flat board that contains Totomycin (100ug/ml) and is positioned over 37 ℃ of 16h.Select the single bacterium colony enlarged culturing of a plurality of whites, PCR preliminary screening positive colony send order-checking further to confirm after BspHI, HindIII double digestion are identified.
1.3 the expression of eucaryon plasmid carrier in the 293FT cell
1.3.1 transfection 293FT cell
In transfection the day before yesterday with the 2.5g/L trysinization of 293FT cell, cell counting is inoculated in 6 orifice plates by 1 * 109, when cell covers with to 90%-95%, respectively with pVIVO1-mcs, pVIVO1-mcs-VEGF165-H β D3 transfection 293FT cell, concrete operations are undertaken by the specification sheets of the Lipofectamine2000 test kit of Invitrogen company, and the 293FT cell contrast of untransfected is set simultaneously, place 37 ℃ 5% CO2 incubator to cultivate 48 hours cells transfected.
VEGF-165 gene order such as sequence table 1.H β D3 gene order such as sequence table 2
Sequence table 1:
CCGCCTCGGCTTGTCACATCTGCAAGTACGTTCGTTTAACTCAAGCTGCCTCGCCTTGCAACGCGAGTCTGTGTTTTTGCAGGAACATTTACACGTCTGCGGATCTTGTACAAACAAATGCTTTCTCCGCTCTGAGCAAGGCCCACAGGGATTTTCTTGTCTTGCTCTATCTTTCTTTGGTCTGCATTCACATTTGTTGTGCTGTAGGAAGCTCATCTCTCCTATGTGCTGGCCTTGGTGAGGTTTGATCCGCATAATCTGCATGGTGATGTTGGACTCCTCAGTGGGCACACACTCCAGGCCCTCGTCATTGCAGCAGCCCCCGCATCGCATCAGGGGCACACAGGATGGCTTGAAGATGTACTCGATCTCATCAGGGTACTCCTGGAAGATGTCCACCAGGGTCTCGATTGGATGGCAGTAGCTGCGCTGATAGACATCCATGAACTTCACCACTTCGTGATGATTCTGCCCTCCTCCTTCTGCCATGGGTGCAGCCTGGGACCACTTGGCATGGTGGAGGTAGAGCAGCAAGGCAAGGCTCCAATGCACCCAAGACAGCAGAAAGTTCAT
Sequence table 2:
ATGAGGATCCATTATCTTCTGTTTGCTTTGCTCTTCCTGTTTTTGGTGCCTGTTCCAGGTCATGGAGGAATCATAAACACATTACAGAAATATTATTGCAGAGTCAGAGGCGGCCGGTGTGCTGTGCTCAGCTGCCTTCCAAAGGAGGAACAGATCGGCAAGTGCTCGACGCGTGGCCGAAAATGCTGCCGAAGAAAGAAATAA
Above-described only is preferred implementation of the present invention; should be understood that; for a person skilled in the art; under the premise of not departing from the present invention; can also make some changes and improvements; these also should be considered as protection scope of the present invention, and these can not influence effect of the invention process and practical applicability.
Claims (5)
1.VEGF-165 reach the dual-gene plasmid vector of H β D3, it is characterized in that: described recombinant plasmid vector comprises people VEGF-165cDNA and people H β D3cDNA, and wherein the VEGF-165cDNA gene order is:
CCGCCTCGGCTTGTCACATCTGCAAGTACGTTCGTTTAACTCAAGCTGCCTCGCCTTGCAACGCGAGTCTGTGTTTTTGCAGGAACATTTACACGTCTGCGGATCTTGTACAAACAAATGCTTTCTCCGCTCTGAGCAAGGCCCACAGGGATTTTCTTGTCTTGCTCTATCTTTCTTTGGTCTGCATTCACATTTGTTGTGCTGTAGGAAGCTCATCTCTCCTATGTGCTGGCCTTGGTGAGGTTTGATCCGCATAATCTGCATGGTGATGTTGGACTCCTCAGTGGGCACACACTCCAGGCCCTCGTCATTGCAGCAGCCCCCGCATCGCATCAGGGGCACACAGGATGGCTTGAAGATGTACTCGATCTCATCAGGGTACTCCTGGAAGATGTCCACCAGGGTCTCGATTGGATGGCAGTAGCTGCGCTGATAGACATCCATGAACTTCACCACTTCGTGATGATTCTGCCCTCCTCCTTCTGCCATGGGTGCAGCCTGGGACCACTTGGCATGGTGGAGGTAGAGCAGCAAGGCAAGGCTCCAATGCACCCAAGACAGCAGAAAGTTCAT；
H β D3cDNA gene order is:
ATGAGGATCCATTATCTTCTGTTTGCTTTGCTCTTCCTGTTTTTGGTGCCTGTTCCAGGTCATGGAGGAATCATAAACACATTACAGAAATATTATTGCAGAGTCAGAGGCGGCCGGTGTGCTGTGCTCAGCTGCCTTCCAAAGGAGGAACAGATCGGCAAGTGCTCGACGCGTGGCCGAAAATGCTGCCGAAGAAAGAAATAA。
2. VEGF-165 as claimed in claim 1 and the dual-gene plasmid vector of H β D3 is characterized in that: utilize pVIVO1-mcs plasmid vector system, be built into recombinant plasmid pVIVO1-mcs-VEGF165-H β D3.
3.VEGF-165 reach the construction process of the dual-gene plasmid vector of H β D3, it is characterized in that: comprise following step:
1) obtains people VEGF-165 and people H β D3 gene;
2) with NcoI and EcoRI H β D3DNA and plasmid pVIVO1-mcs are carried out double digestion, adopt the cohesive end connection method to connect, obtain recombinant plasmid pVIVO1-mcs-H β D3;
3) with BspHI and HindIII recombinant plasmid pVIVO1-mcs-H β D3 and VEGF DNA are carried out double digestion again, adopt the cohesive end connection method to connect, obtain recombinant plasmid pVIVO1-mcs-VEGF165-H β D3;
4) liposome-mediated recombinant plasmid transfection 293FT cell, foreign gene is expressed in cell.
4. the construction process of VEGF-165 as claimed in claim 3 and the dual-gene plasmid vector of H β D3 is characterized in that: obtain people VEGF-165 and people H β D3 gene by RT-PCR.
5. the construction process of VEGF-165 as claimed in claim 4 and the dual-gene plasmid vector of H β D3 is characterized in that: the PCR primer that synthesizes amplification VEGF-165 and H β D3 according to gene order design among the Genebank:
The PCR primer sequence of VEGF-165 of wherein increasing is:
Forward 5 '-CCCAAGCTTCACCGCCTCGGCTTGTC-3 ' is introduced the HindIII site,
Reverse 5 '-CGTCATGACCATGAACTTTCTGCTGT-3 ' introduces the BspHI site, and the PCR primer sequence of the H β D3 that wherein increases is:
Forward 5 '-CATGCCATGGCAGCTATGAGGATCCAT-3 ', introduce the NcoI site,
Reverse 5 '-CCGGAATTCTCAGGGTTTTTATTTCT-3 ', introduce the EcoRI site.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102893101A CN102031268A (en) | 2010-09-21 | 2010-09-21 | Vascular endothelial growth factor-165 (VEGF-165) and HbetaD3 double gene plasmid vector and constructing method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102893101A CN102031268A (en) | 2010-09-21 | 2010-09-21 | Vascular endothelial growth factor-165 (VEGF-165) and HbetaD3 double gene plasmid vector and constructing method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102031268A true CN102031268A (en) | 2011-04-27 |
Family
ID=43884721
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102893101A Pending CN102031268A (en) | 2010-09-21 | 2010-09-21 | Vascular endothelial growth factor-165 (VEGF-165) and HbetaD3 double gene plasmid vector and constructing method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102031268A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108324926A (en) * | 2018-03-23 | 2018-07-27 | 高志涛 | The composition and application thereof of stem cell extract and antibacterial peptide |
| CN108913657A (en) * | 2018-08-26 | 2018-11-30 | 青海七彩花生物科技有限公司 | A kind of VEGF-165 activator and the purposes for promoting stem cell differentiation |
| CN110760542A (en) * | 2019-11-18 | 2020-02-07 | 天津大学 | Plasmid for coexpression of ZNF580 and VEGF165 double genes and application thereof |
-
2010
- 2010-09-21 CN CN2010102893101A patent/CN102031268A/en active Pending
Non-Patent Citations (5)
| Title |
|---|
| ADONE BARONI ET AL: "Antimicrobial human beta-defensin-2 stimulates migration, proliferation and tube formation of human umbilical vein endothelial cells", 《PEPTIDES》, vol. 30, 12 November 2008 (2008-11-12), pages 267 - 272, XP025873852, DOI: doi:10.1016/j.peptides.2008.11.001 * |
| GOSHIMA, N. ET AL: "GENBANK:AB451322.1", 《NCBI》, 2 September 2008 (2008-09-02) * |
| HARTLEY, J. L. ET AL: "GENBANK:BC111596.2", 《NCBI》, 13 September 2007 (2007-09-13) * |
| QINGTIAN LI ET AL: "Potential therapeutic efficacy of a bactericidal–immunomodulatory fusion peptide against methicimethicillin-resistant Staphylococcus aureus skin infection", 《APPL MICROBIOL BIOTECHNOL》, vol. 86, 28 October 2009 (2009-10-28), pages 305 - 309, XP019799874 * |
| 余兴邦等: "防御素研究进展", 《动物医学进展》, vol. 27, no. 8, 31 December 2006 (2006-12-31), pages 47 - 51 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108324926A (en) * | 2018-03-23 | 2018-07-27 | 高志涛 | The composition and application thereof of stem cell extract and antibacterial peptide |
| CN108913657A (en) * | 2018-08-26 | 2018-11-30 | 青海七彩花生物科技有限公司 | A kind of VEGF-165 activator and the purposes for promoting stem cell differentiation |
| CN108913657B (en) * | 2018-08-26 | 2021-07-06 | 深圳华源再生医学有限公司 | VEGF-165 activator and application thereof in promoting stem cell differentiation |
| CN110760542A (en) * | 2019-11-18 | 2020-02-07 | 天津大学 | Plasmid for coexpression of ZNF580 and VEGF165 double genes and application thereof |
| CN110760542B (en) * | 2019-11-18 | 2022-07-26 | 天津大学 | Plasmid for coexpression of ZNF580 and VEGF165 double genes and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104140974B (en) | Encode the nucleic acid of the Chimeric antigen receptor albumen of GPC 3 and express the T lymphocytes of the Chimeric antigen receptor albumen of GPC 3 | |
| Sun et al. | Comparison of the capability of GDNF, BDNF, or both, to protect nigrostriatal neurons in a rat model of Parkinson's disease | |
| KR102227180B1 (en) | Recombinant herpes simplex virus and uses thereof | |
| RU2014141514A (en) | THERAPEUTIC DOSING OF NEUREGULIN OR ITS SEQUENCE FOR THE TREATMENT OR PREVENTION OF HEART FAILURE | |
| CN102355906A (en) | Method for preventing and treating hyperpermeability | |
| JPH08501931A (en) | Compositions and methods for vaccination against coronavirus | |
| WO2015089280A1 (en) | Stem cell delivered oncolytic herpes simplex virus and methods for treating brain tumors | |
| CN102031268A (en) | Vascular endothelial growth factor-165 (VEGF-165) and HbetaD3 double gene plasmid vector and constructing method thereof | |
| WO2024056106A1 (en) | Segmented vesicular stomatitis virus vector, preparation method therefor, and use thereof | |
| EP3684783A1 (en) | Gene expression inhibitors | |
| CN101392249A (en) | Antibiotic peptide gene, preparation method thereof and construction of expression plasmid of the same in pichia vector | |
| CN108840947A (en) | Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of ox long-acting interferon | |
| CN105367661B (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, the NKT cell of engineering HER1 targeting and its application | |
| JP2019500028A (en) | Method for producing bispecific T cells for use in cancer immunotherapy | |
| CN105924526B (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, CARHER1-NKT cell and its preparation method and application | |
| CN102803500A (en) | Immunoregulatory peptides and methods of use | |
| CN111304254A (en) | Preparation method of neutrophil preparation with over-expressed hACE2 gene | |
| CN101096680A (en) | NDA vaccine eucaryon expression carrier and application in preparation of gene vaccine | |
| HU227667B1 (en) | Novel expression vectors and uses thereof | |
| Park et al. | Inhibition of Pseudomonas aeruginosa with a recombinant RNA-based viral vector expressing human β-defensin 4 | |
| WO2017088448A1 (en) | Preparation method of dual-effect dengue fever vaccine, and application thereof | |
| EP2489366A1 (en) | Use of spink6 gene and protein encoded therein in the manufacture of anti-tumor medicaments | |
| Voronova et al. | Obtaining a New Gene-Cell Construct Based on Transduced Olfactory Ensheathing Cells for the Treatment of Spinal Cord Injuries | |
| Price et al. | Bioengineering the lung with iPS cells in a decellularized lung matrix bioreactor system | |
| CN101629177B (en) | Reconstitution cell lethal expanded toxin CdtB, expression vector and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20110427 |