CN105924526B - Chimeric antigen receptor and its gene and recombinant expression carrier, CARHER1-NKT cell and its preparation method and application - Google Patents
Chimeric antigen receptor and its gene and recombinant expression carrier, CARHER1-NKT cell and its preparation method and application Download PDFInfo
- Publication number
- CN105924526B CN105924526B CN201510580581.5A CN201510580581A CN105924526B CN 105924526 B CN105924526 B CN 105924526B CN 201510580581 A CN201510580581 A CN 201510580581A CN 105924526 B CN105924526 B CN 105924526B
- Authority
- CN
- China
- Prior art keywords
- nkt cell
- cell
- nkt
- culture
- her1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a kind of Chimeric antigen receptor and its genes and recombinant expression carrier, CARHER1-NKT cell and its preparation method and application, the Chimeric antigen receptor is HER1ScFv-CD8-CD137-CD3 ζ, the intracellular signal structural domain including concatenated rat growth hormone signal peptide, the hinge area of HER1ScFv, CD8 and transmembrane region, the intracellular signal structural domain of CD137 and CD3 ζ.When using CARHER1-NKT cell therapy advanced stage HER1 positive kidney of the invention, caused drug resistance when can effectively avoid using the existing drug for targeting HER1, there is certain specific killing activity to kidney cancer cell, and to having been subjected to repeatedly treatment (such as radiotherapy, chemotherapy and other drugs symptomatic treatment) but the advanced stage HER1 positive patients with renal cell carcinoma without obvious curative effects has certain therapeutic effect.
Description
Technical field
The invention belongs to knubble biological arts, and in particular, to one of adoptive immunotherapy chimeric antigen by
Body HER1ScFv-CD8-CD137-CD3 ζ and its gene and recombinant expression carrier, the NKT cell for being engineered HER1 targeting
(CARHER1-NKT cell) and its application.
Background technique
EGFR (epithelial growth factor receptor, EGF-R ELISA) i.e. HER1, is former cancer
The expression product of gene c-erbB1 belongs to human epidermal growth factor acceptor (HER) family, itself has tyrosinase kinases
Activity, once correlation gene can be had in active cell core by combining with epidermal growth factor (EGF), so that cell division be promoted to increase
It grows.HER1 high expression in Several Kinds of Malignancy, it is important that research finds that HER1 signal path plays in the generation of kidney pathology
Effect, meanwhile, compared with normal nephridial tissue, HER1 expression is up to 90% in renal carcinoma tissue, expression and kidney
The progress of disease and transfer are related.Although the treatment of nearest kidney has obtained certain progress, patient is not still improved
Survival rate, therefore need to inquire into new therapy to overcome this puzzlement.
Currently, the drug therapy of anti-HER1 has been in clinical research rank when treating advanced stage HER1 positive patients with renal cell carcinoma
Section, still, clinical effectiveness show that only part patients with renal cell carcinoma is using the drug (micromolecular inhibitor as targeted HER1) of anti-HER1
Treatment is effective, and patient eventually generates certain drug resistance, to influence the curative effect of drug.
Summary of the invention
The purpose of the invention is to overcome the drug therapy advanced stage HER1 positive kidney for using anti-HER1 in the prior art
The defect of caused drug resistance when patient provides a kind of Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ and its gene
With recombinant expression carrier, it is engineered the NKT cell (CARHER1-NKT cell) and its preparation method and application of HER1 targeting,
The NKT cell of Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ modification, can when treating advanced stage HER1 positive kidney
Caused drug resistance when effectively avoiding using anti-HER1 drug has certain special target killing activity to kidney cancer cell, and
The advanced stage HER1 positive to repeatedly treatment (such as radiotherapy, chemotherapy and other drugs symptomatic treatment) is had been subjected to but without obvious curative effects
Patients with renal cell carcinoma has certain therapeutic effect.
The present inventor has been surprisingly found that under study for action, using Chimeric antigen receptor HER1ScFv-CD8- of the invention
When the NKT cell therapy advanced stage HER1 positive kidney of CD137-CD3 ζ modification, the medicine using existing anti-HER1 can be effectively avoided
Caused drug resistance when object is treated has certain special target killing activity to kidney cancer cell, and to having been subjected to multiple treatment
(such as radiotherapy, chemotherapy and other drugs symptomatic treatment) but the advanced stage HER1 positive patients with renal cell carcinoma without obvious curative effects have certain
Therapeutic effect.
Therefore, to achieve the goals above, described chimeric in a first aspect, the present invention provides a kind of Chimeric antigen receptor
Antigen receptor is HER1ScFv-CD8-CD137-CD3 ζ, including concatenated rat growth hormone signal peptide, HER1ScFv, CD8
The intracellular signal structural domain in hinge area (area hinge) and transmembrane region, the intracellular signal structural domain of CD137 and CD3 ζ.
Second aspect, the present invention provides the genes for encoding above-mentioned Chimeric antigen receptor.
The third aspect, the present invention provides the recombinant expression carriers containing said gene.
Fourth aspect, the present invention provides a kind of NKT cells for being engineered HER1 targeting, and the NKT cell is above-mentioned
The NKT cell of Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ modification.
5th aspect, the present invention provides a kind of preparation method of NKT cell for being engineered HER1 targeting, the methods
Include:
Packaging carries the slow virus of pWPXL-HER1ScFv-CD8-CD137-CD3 ζ, obtains viral concentration liquid；Using obtaining
Viral concentration liquid inductance contaminate NKT cell, make NKT cell express Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ.
6th aspect, the present invention provides the NKT cells for the engineering HER1 targeting that the above method is prepared.
7th aspect, the present invention provides the NKT cell of above-mentioned engineering HER1 targeting in preparation for treating tumour
Preparation in application.
When being co-cultured with HER1 positive kidney cancer cell, Chimeric antigen receptor HER1ScFv-CD8-CD137- of the invention
The NKT cell of CD3 ζ modification, i.e. the NKT cell of engineering HER1 targeting can specifically bind HER1 antigen, and enhancing is immune
Cell-targeting identifies the ability of kidney cancer cell surface HER1 antigen, reinforces the specific killing activity to kidney cancer cell, and really
Caused drug resistance when can effectively avoid the drug therapy using existing anti-HER1, to repeatedly treatment is had been subjected to, (such as radiotherapy is changed
Treatment and other drugs symptomatic treatment etc.) but the advanced stage HER1 positive patients with renal cell carcinoma without obvious curative effects has certain therapeutic effect.
The NKT cell of engineering HER1 targeting of the invention provides a kind of new selection, tool for treatment advanced stage HER1 positive kidney
There is good industrial application prospect.
Other features and advantages of the present invention will the following detailed description will be given in the detailed implementation section.
Detailed description of the invention
Fig. 1 is result of the flow cytometry to the NKT cell phenotype analysis being separately cultured.
Fig. 2 is the restriction enzyme MluI/ of Lentiviral pWPXL-CD8-CD137-CD3 ζ of the invention
The electrophoretic identification of NdeI double digestion segment.
Fig. 3 is the restriction enzyme of Lentiviral pWPXL-HER1ScFv-CD8-CD137-CD3 ζ of the invention
The electrophoretic identification of enzyme MluI/NdeI double digestion segment.
Fig. 4 is the structural schematic diagram of Lentiviral pWPXL-HER1ScFv-CD8-CD137-CD3 ζ of the invention,
Wherein, sequence counterclockwise is positive gene piece degree, is clockwise cdna reverse segment.
Fig. 5 is the viral concentration that Flow cytometry contains Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ
Efficiency of infection of the liquid to NKT cell.
Fig. 6 is the NKT cell of Flow cytometry Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ modification
The result of (CARHER1-NKT cell) phenotypic evaluation.
Fig. 7 is the cytotoxicity analysis figure of CARHER1-NKT cell of the invention to human renal carcinoma cell lethal effect.
Fig. 8 is CARHER1-NKT cell of the invention in the therapeutic process of the patients with renal cell carcinoma of advanced stage HER1 positive, difference
The left nephrosis stove variation diagram of period patient.
Fig. 9 is CARHER1-NKT cell of the invention in the therapeutic process of the patients with renal cell carcinoma of advanced stage HER1 positive, difference
The liver lesion variation diagram of period patient.
Specific embodiment
Detailed description of the preferred embodiments below.It should be understood that described herein specific
Embodiment is merely to illustrate and explain the present invention, and is not intended to restrict the invention.
The present invention provides a kind of Chimeric antigen receptor, the Chimeric antigen receptor is HER1ScFv-CD8-CD137-CD3
ζ, the intracellular signal knot including concatenated rat growth hormone signal peptide, the hinge area of HER1ScFv, CD8 and transmembrane region, CD137
The intracellular signal structural domain in structure domain and CD3 ζ.
Under preferable case, the Chimeric antigen receptor is HER1ScFv-CD8-CD137-CD3 ζ, is believed by rat growth hormone
The intracellular signal structural domain of number peptide, the hinge area of HER1ScFv, CD8 and transmembrane region, the intracellular signal structural domain of CD137 and CD3 ζ
It is in series.It is further preferred that Chimeric antigen receptor has the amino acid sequence as shown in SEQ ID NO.1, further
Preferably, the amino acid sequence of Chimeric antigen receptor is as shown in SEQ ID NO.1.
The present invention provides the genes for encoding above-mentioned Chimeric antigen receptor.Under preferable case, the gene has such as SEQ
Nucleotide sequence shown in ID NO.2, it is further preferred that encoding the nucleotide sequence of the gene of above-mentioned Chimeric antigen receptor such as
Shown in SEQID NO.2.
The present invention provides the recombinant expression carriers containing said gene.Under preferable case, recombinant expression carrier is slow disease
Malicious expression vector.For Lentiviral, there is no particular limitation, as long as can be with assistant carrier cotransfection incasing cells
Such as 293T incasing cells, the NTK for obtaining viral concentration liquid and Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ modification is thin
Born of the same parents, under preferable case, Lentiviral is pWPXL-HER1ScFv-CD8-CD137-CD3 ζ.
The preparation method of Lentiviral pWPXL-HER1ScFv-CD8-CD137-CD3 ζ is not limited particularly
It is fixed, can be those skilled in the art it is conceivable that various methods, under preferable case, Lentiviral pWPXL-
The preparation method of HER1ScFv-CD8-CD137-CD3 ζ the following steps are included:
(1) area hinge of CD8 and the intracellular signal structural domain of transmembrane region, CD137 are expanded respectively from NKT cell cDNA
It with the intracellular signal structural domain of CD3 ζ, and is cloned into carrier pWPXL-GFP, building obtains pWPXL-CD8-CD137-CD3 ζ；
(2) nucleotide sequence of composite coding rat growth hormone signal peptide and HER1ScFv, and it is cloned into pWPXL-
In CD8-CD137-CD3 ζ, the correct pWPXL-HER1ScFv-CD8-CD137-CD3 ζ of sequence is obtained after sequence verification.
In step (1), for expanded respectively from NKT cell cDNA CD8 the area hinge and transmembrane region, CD137 it is intracellular
There is no particular limitation for the method for the intracellular signal structural domain of signal domain and CD3 ζ, can be various sides commonly used in the art
Method, such as can be RT-PCR method.Wherein, then NKT cell can be carried out by the mononuclearcell in separation people's venous blood
Culture obtains.
Specifically, the method for obtaining pWPXL-CD8-CD137-CD3 ζ may include: to extract the total serum IgE of NKT cell, reverse
Record obtains NKT cell cDNA and utilizes primer P1 (SEQID NO.11) and P2 (SEQID using obtained NKT cell cDNA as template
NO.12 the area hinge and transmembrane region (SEQID NO.3) that PCR amplification obtains CD8 gene) are carried out；Utilize primer P3 (SEQID
NO.13) and P4 (SEQID NO.14) carries out the intracellular signal structural domain (SEQID NO.4) that PCR amplification obtains CD137 gene；
The intracellular signal structure that PCR amplification obtains CD3 ζ gene is carried out using primer P5 (SEQID NO.15) and P6 (SEQID NO.16)
Domain (SEQID NO.5), carries out double digestion for the PCR product of acquisition respectively, then with the slow virus after MluI/NdeI double digestion
Expression vector pWPXL-GFP connection.
In step (2), for the method for the nucleotide sequence of composite coding rat growth hormone signal peptide and HER1ScFv
There is no particular limitation, can be various methods commonly used in the art, such as can be synthesized by full genome synthetic technology.
Specifically, the method for obtaining the correct pWPXL-HER1ScFv-CD8-CD137-CD3 ζ of sequence may include: to pass through
Nucleotide sequence (the SEQID of full genome synthetic technology composite coding rat growth hormone signal peptide and HER1ScFv fusion
NO.8), it is cloned into carrier pGSI, obtains pGSI-HER1ScFv；Then pGSI-HER1ScFv is subjected to MluI single endonuclease digestion, with
The recombinant plasmid pWPXL-CD8-CD137-CD3 ζ connection obtained through restriction enzyme MluI single endonuclease digestion is identified through sequencing, is obtained
To the correct pWPXL-HER1ScFv-CD8-CD137-CD3 ζ of sequence.Wherein, the nucleotide sequence of rat growth hormone signal peptide
As shown in SEQID NO.6, HER1ScFv nucleotide sequence is as shown in SEQID NO.7.
The present invention also provides a kind of NKT cells for being engineered HER1 targeting, and the NKT cell is by above-mentioned inosculating antibody
The NKT cell (i.e. CARHER1-NKT cell) of original receptor HER1ScFv-CD8-CD137-CD3 ζ modification.
The present invention also provides a kind of preparation methods of NKT cell for being engineered HER1 targeting, this method comprises: packaging
The slow virus for carrying pWPXL-HER1ScFv-CD8-CD137-CD3 ζ, obtains viral concentration liquid；Utilize obtained viral concentration liquid
NKT cell is infected, NKT cell is made to express Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ.
The method for carrying the slow virus of pWPXL-HER1ScFv-CD8-CD137-CD3 ζ for packaging does not limit particularly
It is fixed, it can be the common various methods of those skilled in the art, under preferable case, by Lentiviral pWPXL-
HER1ScFv-CD8-CD137-CD3 ζ and helper plasmid (such as psPAX2, pMD2.G) cotransfection 293T incasing cells transfect 48-
Viral supernatants are collected when 72h, centrifugation, filtering are added 5 × PEG6000-NaCl in filtrate and are mixed, supernatant is abandoned after centrifugation,
The sterile PBS dissolution of 0-4 DEG C of pre-cooling of precipitating, obtains viral concentration liquid.
Further include being prepared via a method which NKT cell in method of the invention:
(1) in the presence of CD3 monoclonal antibody, proleulzin and interleukin-15, mononuclearcell is subjected to the first stage
Culture；
(2) in the presence of proleulzin, the cell that the first stage is cultivated carries out second stage culture.
Under preferable case, the embodiment of first stage culture includes: that mononuclearcell is incubated at the first NKT is thin
In born of the same parents' culture solution, the first NKT cell culture fluid contains NKT cell culture medium, CD3 monoclonal antibody, proleulzin and white
Interleukin -15；It is further preferred that the concentration of the CD3 monoclonal antibody is 30-70ng/mL in the first NKT cell culture fluid,
And/or the concentration of the proleulzin is 300-700U/mL and/or the concentration of the interleukin-15 is 30-70ng/mL.
Under preferable case, the embodiment of the second stage culture includes: the cell training for cultivating the first stage
It supports in the 2nd NKT cell culture fluid, NKT cell culture medium and proleulzin is contained in the 2nd NKT cell culture fluid；Into
Preferably, in the 2nd NKT cell culture fluid, the concentration of the proleulzin is 300-700U/mL to one step.
For NKT cell culture medium, there is no particular limitation, can be commonly used in the art various for cultivating NKT cell
Culture medium, such as can be GT-T551 culture medium.
When preparing NKT cell, for first stage culture and the condition of second stage culture, there is no particular limitation, can
Think various conditions commonly used in the art, such as can be in 30-37 DEG C, the CO that saturated humidity is 3-6%2It is trained in incubator
It supports.Those skilled in the art can be adaptively adjusted the time of culture, this is known to those skilled in the art, herein
It repeats no more.
In the NKT cell that the present invention is prepared, CD3+Cell average ratio > 90%, CD3+CD8+The total CD3 of cell Zhan+Carefully
Average ratio > 70% of born of the same parents；CD3+CD56+The total CD3 of cell Zhan+Average ratio > 15% of cell.
Method for infecting NKT cell is not particularly limited, and can be various methods commonly used in the art, preferable case
Under, this method comprises:
(1) in the presence of viral concentration liquid, nucleoprotamine and proleulzin, NKT cell is subjected to first stage infection training
It supports；
(2) in the presence of CD3 monoclonal antibody, proleulzin and interleukin-15, by first stage infection culture
Cell carries out second stage infection culture.
Preferably, the embodiment of the first stage infection culture includes: by NKT cell culture in the 3rd NKT cell
In culture solution, the 3rd NKT cell culture fluid contains NKT cell culture medium, viral concentration liquid, nucleoprotamine and interleukin-
2；It is further preferred that the concentration of the proleulzin is 300-700U/mL in the 3rd NKT cell culture fluid.
Preferably, the embodiment of the second stage infection culture includes: by the thin of first stage infection culture
Born of the same parents are incubated in the first NKT cell culture fluid.The concrete composition of first NKT cell culture fluid can be found in aforementioned corresponding interior
Hold, details are not described herein.
It is not special for the condition of first stage infection culture and second stage infection culture when infecting NKT cell
Restriction, can be various conditions commonly used in the art, such as can 30-37 DEG C, saturated humidity be 3-6% CO2Culture
It is cultivated in case.Those skilled in the art can be adaptively adjusted the time of culture, this is those skilled in the art
Known, details are not described herein.
Specifically, the method for infecting NKT cell includes: to take 1 × 107-5×107A NKT cell, discards old culture solution,
The fresh GT-T551 culture solution of 2-4mL is added, adds 200-400 μ L viral concentration liquid, 2-4 μ L 1 × 10-6Mg/mL milt egg
The IL-2 of white and final concentration of 300-700U/mL is placed in 30-37 DEG C, the CO that saturated humidity is 3-6%212- is infected in incubator
After 16h, culture solution is abandoned, cell is gone in not coated culture bottle, the GT-T551 culture medium of 20-50mL is added, adds end
Concentration is the IL-2 of 300-700U/mL, the CD3 monoclonal antibody of final concentration of 30-70ng/ml and final concentration of 30-70ng/mL
Interleukin 15, in 30-37 DEG C, saturated humidity be 3-6% CO212-18h is cultivated in incubator, obtains chimeric antigen
The NKT cell of receptor HER1ScFv-CD8-CD137-CD3 ζ modification.
It is further preferred that the method for infection NKT cell further include:
(3) first in the presence of proleulzin, the cell progress of second stage infection culture is external evoked, to cell
Density when being 80-90%, then in the presence of CD3 monoclonal antibody, proleulzin and interleukin-15, cell is expanded
Culture.
Under preferable case, the external evoked embodiment includes: by the cell training of second stage infection culture
It supports in the 2nd NKT cell culture fluid, the embodiment of the amplification cultivation includes: by cell culture in described first
In NKT cell culture fluid.The concrete composition of first NKT cell culture fluid and the 2nd NKT cell culture fluid can be found in aforementioned corresponding
Content, details are not described herein.
Specifically, the method for NKT cell is infected further include: by the slow-virus infection obtained after second stage infection culture
NKT cell is carried out external evoked with the GT-T551 culture solution of the final concentration of 300-700U/mL of IL-2, and the density to cell is
Cell is transferred in cell culture bags when 80-90%, final concentration of 300-700U/mL, CD3 of IL-2 were added every 1.5-2.5 days
The fresh GT-T551 of the final concentration of 30-70ng/ml of monoclonal antibody, the final concentration of 30-70ng/mL of interleukin-15
Culture solution carries out amplification cultivation and cell is expanded to total amount to be 1 × 109-2×109A cell.By slow virus pair of the invention
The Chimeric antigen receptor for targeting HER1 antigen carries out NKT cell infection, and efficiency of infection is up to 30%-60%, and obtain
CARHER1-NKT cell, CD3+CD56+The total CD3 of cell Zhan+The ratio of cell is within the scope of 15%-40%.
The Chimeric antigen receptor of the NKT cell expression of Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ modification
Protein amino acid sequence is as shown in SEQID NO.1.Wherein, it will be understood by those skilled in the art that before Chimeric antigen receptor
Body protein is by rat growth hormone signal peptide, the area hinge of HER1ScFv, CD8 and transmembrane region, the intracellular signal structure of CD137
The intracellular signal structural domain of domain and CD3 ζ are in series, after protein translation after the signal peptide of rough endoplasmic reticulum excision in the cell
As mature Chimeric antigen receptor albumen, after secretion output and it is positioned on the cell membrane of NKT cell.The Chimeric antigen receptor
The corresponding gene coded sequence of protein amino acid sequence is as shown in SEQID NO.2.The Chimeric antigen receptor is with gene C D8's
The structure that the intracellular signal structural domain of the area hinge and transmembrane region and CD137 and CD3 ζ are connected in series is signal transduction structural domain,
Amino acid sequence is as shown in SEQID NO.9, and corresponding gene coded sequence is as shown in SEQID NO.10.
The present invention also provides the NKT cells for the engineering HER1 targeting that the above method is prepared.
The present invention also provides the NKT cells of engineering HER1 targeting to prepare answering in the preparation for treating tumour
With.Under preferable case, tumour refers to advanced stage HER1 positive kidney, in particular recurs refractory advanced stage HER1 positive kidney.Ability
Field technique personnel should be understood that advanced stage HER1 positive kidney refers to and be led to not carry out hand due to internal medicine or surgery etc.
IV phase of art excision or recurrent kidney, Symptoms are as follows: blood urine, waist lump and pain in the loins etc..
Embodiment
The present invention is further illustrated for embodiment below, but is not intended to limit the present invention.
Experimental method in following embodiment is unless otherwise specified conventional method in that art.Institute in following embodiments
Experimental material is unless otherwise specified to be commercially available from routine biochemistry reagent shop, in which:
NKT cell culture medium GT-T551 is purchased from TaKaRa company.
Lymphocyte separation medium is purchased from TBD company.
CD3 monoclonal antibody, recombinant fiber connection albumen (retronectin) are purchased from TaKaRa company.
Recombinant human protein's interferon-γ, rhIL-2, recombinant human interleukin 15 are purchased from protech company.
Total RNA extraction reagent box RNAiso Reagent, high-fidelity DNA polymerase (HS DNA
Polymerase), T4DNA ligase is purchased from TaKaRa company.
RevertAidTMFirst Strand cDNA Synthesis Kit is purchased from Fermentas company.
Bgl II, EcoRI, MluI, BamHI, NdeI, EcoR V are purchased from Fermentas company.
Modification enzyme Klenow Fragment is purchased from Fermentas company.
Ago-Gel DNA QIAquick Gel Extraction Kit, common DNA product purification kit, the small extraction reagent kit of plasmid are purchased from day
Root biochemical technology Co., Ltd.
PWPXL-GFP, psPAX2, pMD2.G are purchased from Addgene company.
PGSI is purchased from Beijing Tian Yihuiyuan Biotechnology Co., Ltd.
Trans1-T1Phage Resistant Competent cell is purchased from Beijing Quanshijin Biotechnology Co., Ltd.
LipofectamineTM2000Transfection Reagent transfection reagent is purchased from Invitrogen company.
293T incasing cells is purchased from U.S. ATCC.
In PEG6000-NaCl final concentration of 25.5 the mass %, NaCl of PEG6000 final concentration of 1.2M, PEG6000 and
NaCl is purchased from Shanghai Suo Laibao Biotechnology Co., Ltd.
Fetal calf serum is purchased from PAA company, Germany.
The mouse Renca kidney cancer cell of height expression HER1 is purchased from U.S. ATCC company.
Cell Counting Kit-8 (CCK8) kit is purchased from Beijing Wo Bisen Science and Technology Ltd..
All primers are synthesized by Beijing Tian Yihuiyuan Biotechnology Co., Ltd.
The preparation of embodiment 1NKT cell
(1) take people's venous blood in the vacuum tube containing heparin.Using lymphocyte separation medium, by density gradient centrifugation side
Method separation obtains mononuclearcell (PBMCs).
(2) after PBMCs is washed three times, using the NKT cell culture medium GT-T551 of the Human autologous serum containing 0.6 volume %
Adjusting final concentration of cells is 2 × 106A cell/mL；By cell inoculation in first passing through final concentration of 10 μ g/mL's in advance
The coated 75cm of retronectin2In Tissue Culture Flask.Then the recombined human of final concentration of 500U/mL is added in culture medium
The recombination human interleukin -15 of interleukin-22,50ng/ml CD3 monoclonal antibody and 50ng/mL, in 37 DEG C, saturated humidity 5%
CO2It is cultivated in incubator.
(3) it cultivates the 4th day, cell is transferred in not coated culture bottle, be added according to cell growth population within every 2 days
NKT cell culture medium GT-T551, control cell concentration are 1 × 108A cell/mL, and the weight of final concentration of 500U/ml is added
Group human interleukin 2；Culture obtained NKT cell, flow cytometry analyzes NKT cell phenotype to the 12nd day.As a result see figure
1, wherein CD3+: 95.04%；CD3+CD8+: 90.99%；CD3+CD56+: 24.12%；CD8+CD56+: 24.63%.
The building of 2 Lentiviral pWPXL-HER1ScFv-CD8-CD137-CD3 ζ of embodiment
(1) preparation of NKT cell cDNA
Centrifugation embodiment 1 cultivates obtained NKT cell, is extracted with total RNA extraction reagent box RNAiso Reagent
The total serum IgE of cell, -80 DEG C save backup.The total serum IgE of extraction Reverse Transcriptase kit RevertAidTM First Strand
CDNA Synthesis Kit reverse transcription obtains NKT cell cDNA, and -20 DEG C save backup.
(2) preparation of slow virus plasmid pWPXL-CD8-CD137-CD3 ζ
Design and synthesize following primer sequence (wherein, for underscore labeled as protection base, box is restriction enzyme site):
P1 (SEQID NO.11):GATC CTGAGCAACTCCATCATGTACTTC
MluI
P2 (SEQID NO.12):GATC GCAGTAAAGGGTGATAACCAGTGA
BglII
P3 (SEQID NO.13):GATC AAACGGGGCAGAAAGAAACTCC
BglII
P4 (SEQID NO.14):GATC CAGTTCACATCCTCCTTCTTCTTCT
EcoRI
P5 (SEQID NO.15):GATC AGAGTGAAGTTCAGCAGGAGCG
EcoRI
P6 (SEQID NO.16):GATC ATAATCAACCTCTGGATTAC
NdeI
Using NKT cell cDNA in step (1) as template, PCR amplification is carried out with primer P1 and P2, obtains the CD8 of long 287bp
The area hinge and transmembrane region, for nucleotide sequence as shown in SEQID NO.3, II restriction enzyme site of MluI and Bgl is contained at both ends respectively
With protection base；PCR amplification is carried out with primer P3 and P4, obtains the CD137 intracellular signal structural domain of long 146bp, nucleotides sequence
For column as shown in SEQID NO.4, Bgl II and EcoRI restriction enzyme site and protection base are contained in both ends respectively；With primer P5 and P6 into
Row PCR amplification obtains the intracellular signal structural domain of the CD3 ζ of long 359bp, and nucleotide sequence is as shown in SEQID NO.5, both ends point
It Han You not EcoRI and NdeI restriction enzyme site and protection base.Each step pcr amplification reaction system is identical, to expand CD137 letter intracellular
For number structural domain, PCR amplification, PCR reaction condition reference are carried outThe explanation of HS DNA Polymerase
Book, reaction system (50 μ L) are as follows:
Distilled water: 32.5 μ L
5 × reaction buffer:10 μ L
DNTP mixture (every kind of 2.5mM): 4 μ L
P3(10mM):1μL
P4(10mM):1μL
NKT cell cDNA (200ng/ul): 1 μ L
HS DNA Polymerase:0.5 μ L
Above-mentioned PCR product is separated with 1% Ago-Gel, is carried out with Ago-Gel DNA QIAquick Gel Extraction Kit
DNA fragmentation recycling.Double enzyme digestion reaction is carried out respectively after obtaining segment, and digestion products are recycled with common DNA product purification kit
It is spare.
Lentiviral pWPXL-GFP MluI/NdeI double digestion, digestion products through 1% Ago-Gel into
Row separation, recycle big carrier segments with Ago-Gel DNA QIAquick Gel Extraction Kit, then with the CD8, CD137 recycled before,
CD3 ζ segment is connected by T4DNA ligase, and it is thin that connection product converts Trans1-T1Phage Resistant Competent
Born of the same parents, picking monoclonal after 37 DEG C of culture 16h, 37 DEG C, 250rpm is cultivated and is extracted plasmid with the small extraction reagent kit of plasmid after 12h.It extracts
Plasmid through restriction enzyme MluI and NdeI double digestion identify, identification electrophoretogram see Fig. 2, wherein M1:DNA molecular weight mark
Remember D15000；1 swimming lane: the non-endonuclease bamhi of plasmid pWPXL-CD8-CD137-CD3 ζ；2 swimming lanes: plasmid pWPXL-CD8-
The endonuclease bamhi (751bp) of CD137-CD3 ζ；M2:DNA molecular weight marker D2000.It will identify that correct plasmid send Beijing day one
The fusion segment of insertion is sequenced in Hui Yuan Biotechnology Co., Ltd.By the correct recombinant plasmid name of sequencing result
For pWPXL-CD8-CD137-CD3 ζ, wherein the area hinge of CD8 and the nucleotide sequence of transmembrane region as shown in SEQID NO.3,
The nucleotide sequence of the intracellular signal structural domain of CD137 is as shown in SEQID NO.4, the nucleosides of the intracellular signal structural domain of CD3 ζ
Acid sequence is as shown in SEQID NO.5.
(3) preparation of slow virus plasmid pWPXL-HER1ScFv-CD8-CD137-CD3 ζ
The nucleotide sequence of full genome composite coding rat growth hormone signal peptide and HER1ScFv fusion, sequence is such as
Shown in SEQID NO.8, by Beijing, Tian Yihuiyuan Biotechnology Co., Ltd is synthesized, 5 ' end containing MluI restriction enzyme site,
Kozak sequence, 3 ' ends are named as pGSI- by foregoing fusion gene cloning in plasmid pGSI containing MluI restriction enzyme site
HER1ScFv.Plasmid is separated through MluI single endonuclease digestion, digestion products through 1% Ago-Gel, is recycled with Ago-Gel DNA
It is spare that kit recycles target fragment.
PWPXL-CD8-CD137-CD3 ζ plasmid is through restriction enzyme MluI single endonuclease digestion, and digestion products are through 1% agarose
Gel is separated, spare with Ago-Gel DNA QIAquick Gel Extraction Kit recycling carrier segments.Then Growth in Rats swashs with recycling
The DNA fragmentation of plain signal peptide and HER1ScFv are attached by T4DNA ligase, and specific method is shown in specification.Connection is produced
Object converts Trans1-T1Phage Resistant Competent cell, picking monoclonal after 37 DEG C of culture 16h, and 37 DEG C,
After 250rpm cultivates 12h, plasmid is extracted with the small extraction reagent kit of plasmid.The plasmid of extraction is bis- through restriction enzyme MluI/NdeI
Digestion identification, qualification result are as shown in Figure 3, wherein M1:DNA molecular weight marker D2000；1 swimming lane: plasmid pWPXL-
The endonuclease bamhi (825bp, 751bp) of HER1ScFv-CD8-CD137-CD3 ζ；2 swimming lanes: plasmid pWPXL-HER1ScFv-CD8-
The non-endonuclease bamhi of CD137-CD3 ζ；M2:DNA molecular weight marker D15000.It will identify that correct plasmid send Beijing day brightness remote
The fusion segment of insertion is sequenced in Biotechnology Co., Ltd.The correct recombinant plasmid of sequencing result is named as
PWPXL-HER1ScFv-CD8-CD137-CD3 ζ, structural schematic diagram is as shown in figure 4, including rat growth hormone signal
Peptide (nucleotide sequence is as shown in SEQID NO.6), anti-HER1 single-chain antibody (nucleotide sequence is as shown in SEQID NO.7), CD8
The area hinge and transmembrane region and CD137 intracellular signal structural domain and CD3 ζ intracellular signal structural domain, wherein the inosculating antibody
Original receptor is with the structure that the intracellular signal structural domain of the area hinge of gene C D8 and transmembrane region and CD137 and CD3 ζ is connected in series
Signal transduction structural domain, amino acid sequence is as shown in SEQID NO.9, corresponding gene coded sequence such as SEQID NO.10 institute
Show.
The preparation of the NKT cell of 3 Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ of embodiment modification
(1) packaging and concentration of slow virus
Measure slow virus expression plasmid pWPXL-HER1ScFv-CD8-CD137-CD3 ζ and auxiliary respectively with spectrophotometer
The concentration of plasmid psPAX2, pMD2.G, three kinds of plasmids are used with the mass ratio of 4:2:1
LipofectamineTM2000Transfection Reagent transfection reagent cotransfection 293T incasing cells.It is transfecting respectively
Viral supernatants are collected when 48h, 72h in 50mL EP pipe, 4 DEG C, 2000g is centrifuged 10min, shifts the supernatant that obtains twice to new
In EP pipe, with 4.5 μm of filter filter virus supernatants；The viral supernatants and 5 × PEG6000-NaCl of filtering according to 4:1 volume ratio
It mixes, 4 DEG C of standing 2h, then 4 DEG C, 10000g is centrifuged 20min, abandons supernatant, and precipitating is molten with the sterile PBS of 4 DEG C of pre-coolings of 1mL
Solution is dispensed, -80 DEG C save backup to get the viral concentration liquid of Chimeric antigen receptor by every 100 μ L of pipe.
According to the method described above, slow virus expression plasmid pWPXL-GFP and helper plasmid psPAX2, pMD2.G cotransfection are utilized
293T incasing cells, collects viral supernatants, and concentration obtains the slow virus concentrate of expression GFP green fluorescent protein.
(2) amplification cultivation of slow-virus infection NKT cell and infected cell
Example 1 in 75cm21 × 10 cultivated in culture bottle7A NKT cell discards old culture solution, and 2mL is added
Viral concentration liquid, the 2 μ L 1 × 10 that fresh NKT cell culture medium GT-T551,200 μ L steps (1) obtain-6Mg/mL milt egg
White, the rhIL-2 of final concentration of 500U/mL is placed in 37 DEG C, the CO that saturated humidity is 5%2Infection 12 is small in incubator
Shi Hou abandons culture solution.NKT cell is synchronized with the slow virus concentrate of expression GFP green fluorescent protein simultaneously and infects (
To NKT cell be known as CART-GFP cell), for calculating the efficiency of infection of the virus.By metainfective cell go to without
The coated 75cm of CD3 and retronectin2In culture bottle, the NKT cell culture medium GT-T551 of 20mL is added, adds dense eventually
Degree is the rhIL-2 of 500U/mL, the CD3 monoclonal antibody of final concentration of 50ng/ml and final concentration of 50ng/mL
Recombinant human interleukin 15, in 37 DEG C, the CO that saturated humidity is 5%218h is cultivated in incubator, obtained NKT cell is known as
CARHER1-NKT cell.CARHER1-T cell (the preparation method reference literature of T cell: Yajing is prepared with identical method
Zhang,et al.Autologous CIK Cell Immunotherapy in Patients with Renal Cell
Carcinoma after Radical Nephrectomy.Clinical Study, the preparation of 2.4 part CIK cells in 2013
Method).With the efficiency of infection of the Flow cytometry virus, as a result as shown in figure 5, the infection of CARHER1-NKT cell is imitated
Rate is 46.52%.
(3) external evoked amplification CARHER1-NKT cell mass
By the NKT cell culture medium of the final concentration of 500U/mL of the NKT cell rhIL-2 after above-mentioned culture
GT-T551 progress is external evoked, and cell is transferred in cell culture bags when the density of cell is 85%, is recombinated every addition in 2 days
The end of the final concentration of 50ng/ml of final concentration of 500U/mL, CD3 monoclonal antibody of human interleukin 2, recombinant human interleukin 15
Concentration be 50ng/mL fresh NKT cell culture medium GT-T551 carry out amplification cultivation, to cell amplification to total amount be 1.5 ×
109It after a cell or so, is identified using cell colony of the flow cytometer to infection, cell phenotype commonly reaches CD3 sun
Property cell proportion > 90%；CD3CD8 double positive cells ratio > 70%；CD3CD56 double positive cells ratio > 15%, is as a result shown in
Fig. 6, CD3+: 90.83%；CD3+CD4+: 14.48%；CD3+CD8+: 80.90%；CD3+CD56+: 34.48%；CD8+CD56+:
34.25%.
Cytotoxicity analysis of the embodiment 4CARHER1-NKT cell to mouse kidney cancer cell lethal effect
The mouse kidney cancer cell Renca of high expression HER1 is taken to be inoculated in 96 orifice plates, after 37 DEG C of incubator overnight incubations, respectively
The NKT cell cultivated in CARHER1-NKT cell, CARHER1-T cell and the embodiment 1 prepared in Example 3, to imitate target
Than (killing cell: target cell) 5:1,10:1,20:1,40:1 is co-cultured with Renca cell, after the co-cultivation of 4h,
The CCK8 that 10 μ L are added in each hole is dyed.It is respectively to prepare in embodiment 3 that killing cell controls group is arranged simultaneously
The NKT cell cultivated in CARHER1-NKT cell, CARHER1-T cell and embodiment 1, and same amount of CCK8 is added and carries out
Dyeing；And setting target cell control group is the Renca cell that immunocyte killing processing is not added, and is added same amount of
CCK8 is dyed.Microplate reader detects Apoptosis situation, and the amount of Apoptosis is calculated according to the following equation: apoptosis
Rate={ 1- [(experimental group-killing cell controls group-target cell control group)/experimental group] } × 100%, in the formula, killing is thin
Born of the same parents' control group is the light absorption value for there was only killing cell and target cell not being added to measure, and target cell control group is there was only target cell and do not add
The light absorption value that killing cell measures；Experimental group is that the corresponding immunocyte for imitating target ratio (killing cell: target cell) is added to kill
The light absorption value measured after the reason of injury, is shown in Fig. 7.The NKT cell pair of Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ modification
The kidney cancer cell of height expression HER1 has specific killing activity, and the specific killing activity of CARHER1-NKT cell is substantially better than
CARHER1-T cell and NKT cell.
Therapeutic effect of the embodiment 5CARHER1-NKT cell to the patients with renal cell carcinoma of the advanced stage HER1 positive
Take 5 × 108The NKT cell (i.e. CAR HER1-NKT cell) of a HER1ScFv-CD8-CD137-CD3 ζ modification, warp
After crossing 100ml normal saline dilution, the patients with renal cell carcinoma of continuous three days venous re-transfusions to the advanced stage HER1 positive is (of the invention utilizing
Before CARHER1-NKT cell carries out targeting immunization therapy, having been subjected to repeatedly treatment, (such as radiotherapy, chemotherapy and other drugs, which are suited the medicine to the illness, to be controlled
Treat etc.), but without obvious curative effects) in vivo, the treatment situation of patient is assessed after feedback.
Fig. 8 is different time sections patient after CARHER1-NKT cell is fed back in the patients with renal cell carcinoma body of the advanced stage HER1 positive
Left nephrosis stove variation diagram.As shown in figure 8, CARHER1-NKT cell is previous to the patients with renal cell carcinoma treatment of the advanced stage HER1 positive
In month, disease is in the state of rapid progress, and patient's nephrosis stove longest diameter increases to 9cm by 3cm；By CARHER1-NKT cell
4 weeks after immunization therapy, patient's nephrosis stove stops increasing, and is stable at 9cm；8 weeks reviewing patient's tumor sizes and process after treatment
Similar before CARHER1-NKT cell therapy, nephrosis stove is stable at 9cm；12 weeks after treatment, patient's nephrosis stove slightly reduces, tumour
The state of an illness is still in continual and steady state.Illustrate that the left kidney size of tumor of patient in 3 months after treating is stablized, CARHER1-NKT is thin
Born of the same parents can contain the rapid progress of kidney, have certain therapeutic effect to the patients with renal cell carcinoma of the advanced stage HER1 positive.
Fig. 9 is different time sections patient after CARHER1-NKT cell is fed back in the patients with renal cell carcinoma body of the advanced stage HER1 positive
Liver lesion variation diagram.As shown in figure 9, before CARHER1-NKT cell is to the patients with renal cell carcinoma treatment of the advanced stage HER1 positive, patient
Intrahepatic metastasis lesion is multiple, in the state quickly increased；4 weeks after CARHER1-NKT cellular immunotherapy, patient liver is right
Leaf disease stove stops increasing, and left lobe of liver lesion slightly reduces；8 weeks after treatment, patient's lesion is in stable state；12 weeks after treatment,
Patient's left lobe of liver lesion further reduces, and right lobe of liver size of tumor is similar before relatively treating, and intralesional necrosis is obvious.Explanation
CARHER1-NKT cell can effectively contain the rapid progress of high load capacity kidney, and patient is allowed to obtain the stable disease of long period
There is certain therapeutic effect in phase to the patients with renal cell carcinoma of the advanced stage HER1 positive.
The preferred embodiment of the present invention has been described above in detail, still, during present invention is not limited to the embodiments described above
Detail within the scope of the technical concept of the present invention can be with various simple variants of the technical solution of the present invention are made, this
A little simple variants all belong to the scope of protection of the present invention.
It is further to note that specific technical features described in the above specific embodiments, in not lance
In the case where shield, can be combined in any appropriate way, in order to avoid unnecessary repetition, the present invention to it is various can
No further explanation will be given for the combination of energy.
In addition, various embodiments of the present invention can be combined randomly, as long as it is without prejudice to originally
The thought of invention, it should also be regarded as the disclosure of the present invention.
Claims (5)
1. a kind of preparation method for the NKT cell for being engineered HER1 targeting, which is characterized in that the described method includes:
Packaging carries the slow virus of pWPXL-HER1ScFv-CD8-CD137-CD3 ζ, obtains viral concentration liquid；Utilize obtained disease
Malicious concentrate infects NKT cell, and NKT cell is made to express Chimeric antigen receptor HER1ScFv-CD8-CD137-CD3 ζ；
The amino acid sequence of the Chimeric antigen receptor is as shown in SEQ ID NO.1；
It is described infection NKT cell method include:
It takes in 75cm21 × 10 cultivated in culture bottle7A NKT cell discards old culture solution, and the fresh NKT cell training of 2mL is added
Support base GT-T551,200 μ L viral concentration liquid, 2 μ L 1 × 10-6The recombined human of mg/mL nucleoprotamine, final concentration of 500U/mL is white
Interleukin 2 is placed in 37 DEG C, the CO that saturated humidity is 5%2After infecting 12 hours in incubator, culture solution is abandoned；By metainfective cell
It goes to and connects the coated 75cm of albumen with recombinant fiber without CD32In culture bottle, the NKT cell culture medium GT- of 20mL is added
T551 adds the rhIL-2 of final concentration of 500U/mL, the CD3 monoclonal antibody of final concentration of 50ng/ml and end
Concentration is the recombinant human interleukin 15 of 50ng/mL, in 37 DEG C, the CO that saturated humidity is 5%218h is cultivated in incubator；
By the NKT cell culture medium GT- of the final concentration of 500U/mL of the NKT cell rhIL-2 after above-mentioned culture
T551 progress is external evoked, and cell is transferred in cell culture bags when the density of cell is 85%, white every 2 days addition recombined humans
The final concentration of the final concentration of 50ng/ml of final concentration of 500U/mL, CD3 monoclonal antibody of interleukin 2, recombinant human interleukin 15
Amplification cultivation is carried out for the fresh NKT cell culture medium GT-T551 of 50ng/mL.
2. according to the method described in claim 1, wherein, the method also includes being prepared via a method which NKT cell:
(1) in the presence of CD3 monoclonal antibody, proleulzin and interleukin-15, mononuclearcell is subjected to first stage training
It supports；The embodiment of the first stage culture includes: that mononuclearcell is incubated in the first NKT cell culture fluid, described
First NKT cell culture fluid contains NKT cell culture medium, CD3 monoclonal antibody, proleulzin and interleukin-15；First NKT
In cell culture fluid, the concentration of the CD3 monoclonal antibody is 30-70ng/mL and/or the concentration of the proleulzin is
The concentration of 300-700U/mL and/or the interleukin-15 is 30-70ng/mL；
(2) in the presence of proleulzin, the cell that the first stage is cultivated carries out second stage culture；The second stage
The embodiment of culture includes: the cell culture of cultivating the first stage in the 2nd NKT cell culture fluid, and described second
Contain NKT cell culture medium and proleulzin in NKT cell culture fluid；In 2nd NKT cell culture fluid, the proleulzin
Concentration is 300-700U/mL.
3. the NKT cell for the engineering HER1 targeting that method as claimed in claim 1 or 2 is prepared.
4. the NKT cell of engineering HER1 targeting as claimed in claim 3 is preparing answering in the preparation for treating tumour
With.
5. application according to claim 4, wherein the tumour refers to advanced stage HER1 positive kidney.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510580581.5A CN105924526B (en) | 2015-09-11 | 2015-09-11 | Chimeric antigen receptor and its gene and recombinant expression carrier, CARHER1-NKT cell and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510580581.5A CN105924526B (en) | 2015-09-11 | 2015-09-11 | Chimeric antigen receptor and its gene and recombinant expression carrier, CARHER1-NKT cell and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105924526A CN105924526A (en) | 2016-09-07 |
| CN105924526B true CN105924526B (en) | 2019-08-06 |
Family
ID=56839870
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510580581.5A Active CN105924526B (en) | 2015-09-11 | 2015-09-11 | Chimeric antigen receptor and its gene and recombinant expression carrier, CARHER1-NKT cell and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105924526B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108395480A (en) * | 2017-02-08 | 2018-08-14 | 广州百尼夫生物科技有限公司 | Chimeric antigen receptor and its gene and recombinant expression carrier, CARHER2-NKT cells and its preparation method and application |
| AU2018338874A1 (en) * | 2017-09-29 | 2020-04-02 | Nantcell, Inc. | Cd1d and tcr-nkt cells |
| CN109678965B (en) * | 2018-10-12 | 2023-04-07 | 中国人民解放军总医院 | Chimeric antigen receptor, gene and recombinant expression vector thereof, CD22-CD19 dual-targeting T cell and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103483453A (en) * | 2012-06-12 | 2014-01-01 | 上海吴孟超医学科技基金会 | Chimeric antigen receptor combining EGFR (epidermal growth factor receptor) family proteins and composition and uses thereof |
| CN103820393A (en) * | 2014-02-24 | 2014-05-28 | 中国人民解放军总医院 | Engineered CD20 targeting NKT cell and its preparation method and application |
| CN104126009A (en) * | 2011-10-07 | 2014-10-29 | 国立大学法人三重大学 | Chimeric antigen receptor |
| CN105367661A (en) * | 2014-08-26 | 2016-03-02 | 西比曼生物科技（上海）有限公司 | Chimeric antigen receptor, gene and recombinant expression vector of chimeric antigen receptor, engineering HER1 targeted NKT cells and application of engineering HER1 targeted NKT cells |
-
2015
- 2015-09-11 CN CN201510580581.5A patent/CN105924526B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104126009A (en) * | 2011-10-07 | 2014-10-29 | 国立大学法人三重大学 | Chimeric antigen receptor |
| CN103483453A (en) * | 2012-06-12 | 2014-01-01 | 上海吴孟超医学科技基金会 | Chimeric antigen receptor combining EGFR (epidermal growth factor receptor) family proteins and composition and uses thereof |
| CN103820393A (en) * | 2014-02-24 | 2014-05-28 | 中国人民解放军总医院 | Engineered CD20 targeting NKT cell and its preparation method and application |
| CN105367661A (en) * | 2014-08-26 | 2016-03-02 | 西比曼生物科技（上海）有限公司 | Chimeric antigen receptor, gene and recombinant expression vector of chimeric antigen receptor, engineering HER1 targeted NKT cells and application of engineering HER1 targeted NKT cells |
Non-Patent Citations (1)
| Title |
|---|
| anti-epidermal growth factor receptor scFv，partial[synthetic construct];Zhou YQ等;《GENBANK》;20120401;Accession NO.AFF61391.1 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105924526A (en) | 2016-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105924527B (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, CAR30-NKT cell and its preparation method and application | |
| CN103820393B (en) | NKT cell of through engineering approaches CD20 targeting and its preparation method and application | |
| CN105924528B (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, CARMSLN-NKT cell and its preparation method and application | |
| CN105924530B (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, CAR20-NKT cell and its preparation method and application | |
| CN105384824A (en) | Chimeric antigen receptor and gene and recombinant expression vector thereof, engineered HER2 targeting NKT cell and application thereof | |
| CN105936649B (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, CAR133-NKT cell and its preparation method and application | |
| CN105859890A (en) | Chimeric antigen receptor as well as gene and recombinant expression vector, engineered CD30-targeted NKT cell and application thereof | |
| CN107793483B (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, CARMSLN-NKT cell and its preparation method and application | |
| CN109678965A (en) | The T cell and its application of Chimeric antigen receptor and its gene and recombinant expression carrier, the bis- targetings of CD22-CD19 | |
| CN112584849A (en) | Therapeutic agents comprising nucleic acids and CAR-modified immune cells and uses thereof | |
| JP2020536533A (en) | Isolated recombinant oncolytic vaccinia virus for the treatment of tumors and / or cancer, pharmaceutical compositions, and their use | |
| CN108409840A (en) | The Chimeric antigen receptor of anti-CD123 single-chain antibodies and combinations thereof and application | |
| CN107586759B (en) | Construction method and application of recombinant Newcastle disease virus | |
| CN107793482A (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, CAR133 NKT cells and its preparation method and application | |
| CN105367661B (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, the NKT cell of engineering HER1 targeting and its application | |
| CN105924526B (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, CARHER1-NKT cell and its preparation method and application | |
| CN105384820A (en) | Chimeric antigen receptor and gene and recombinant expression vector thereof, engineered CD19 targeting NKT cell and application thereof | |
| CN105949323A (en) | EpCAM-specific chimeric antigen receptor and encoding gene and application thereof | |
| CN109293781A (en) | The T cell and its application of Chimeric antigen receptor and its gene and recombinant expression carrier, the bis- targetings of CD19-CD20 | |
| CN105384826A (en) | Cord blood nucleated cell for expressing chimeric antigen receptor and application of cord blood nucleated cell | |
| CN108395480A (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, CARHER2-NKT cells and its preparation method and application | |
| CN105920592B (en) | Application of the CARHER1-NKT cell in the preparation that preparation is used for treatment of advanced HER1 positive lung cancer | |
| CN105920615B (en) | Application of the CARHER1-NKT cell in the preparation that preparation is used for treatment of advanced HER1 positive pancreatic cancer | |
| CN105920616B (en) | Application of the CARHER1-NKT cell in the preparation that preparation is used for treatment of advanced HER1 positive cholangiocarcinoma | |
| CN105384823A (en) | Chimeric antigen receptor and gene and recombinant expression vector thereof, engineered CD33 targeting NKT cell and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |