CN102010849A - Recombinant lactic acid bacteria of pig interleukin 10 and application thereof - Google Patents
Recombinant lactic acid bacteria of pig interleukin 10 and application thereof Download PDFInfo
- Publication number
- CN102010849A CN102010849A CN2010105487222A CN201010548722A CN102010849A CN 102010849 A CN102010849 A CN 102010849A CN 2010105487222 A CN2010105487222 A CN 2010105487222A CN 201010548722 A CN201010548722 A CN 201010548722A CN 102010849 A CN102010849 A CN 102010849A
- Authority
- CN
- China
- Prior art keywords
- poil
- lactic acid
- recombinant
- pig
- acid bacteria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to recombinant lactic acid bacteria of pig interleukin 10. Ribose nucleic acid (RNA) in pig spleen cells is used as a template; poIL-10 genes are obtained by reverse transcription-polymerase chain reaction (RT-PCR) technology; the poIL-10 genes are transformed into escherichia coli after being connected with a pMD18T vector of a cloning vector; and the poIL-10 genes are inserted into an escherichia coli-lactic acid bacterium shuttle expression plasmid pW425et to build a recombinant plasmid pW425et-poIL-10 and electrically transform the recombinant plasmid pW425et-poIL-10 into the lactic acid bacteria to obtain the recombinant lactic acid bacteria capable of stably expressing the pig interleukin 10. The recombinant lactic acid bacteria can be planted in intestinal canals through oral administration, stably express the pig interleukin 10, effectively regulate immune functions of organisms, stimulate proliferation of cells B, improve the levels of IgG, IgM and IgA of serum, improve the capability of the organisms generating specific antibodies for pathogenic microorganisms, ensure healthy growth of pigs and promote sustainable and healthy development of animal husbandry.
Description
Technical field
The invention belongs to biological technical field, exactly pig interleukin 10 recombinant lactic acid bacterias and application thereof.
Background technology
Livestock industry is the important component part of modern agriculture industrial system, is the strong industry in China's agricultural and rural economy structure strategical adjustment, also is to change one of the main path of rural economy growth pattern and important content of new countryside construction.China is live pig big producing country, pork consumption big country, and pork is the meat product source that Chinese people democracy is wanted, and accounts for more than 60% of daily consumption of meat.Although intensification, high-density breeding pattern have solved the consumption problem of the increase of the density of population to pork product, but because under the height intensive culture condition, pig immunity and anti-stress ability descend, discharge pathogenic micro-organism and contact the increase of pathogenic micro-organism chance, cause morbidity and mortality ratio to increase, the speed of growth is slow, and breed revenue decline and pork product are under-supply etc.Therefore, the autoimmune level of raising pig, increase have important practical significance for promotion China pig industry sustainable and healthy development, promotion rural economy growth level and guarantee high quality pork product-feed to the defensive ability/resistance ability of pathogenic micro-organism.
Interleukin 10 (IL-10) is found in following generation of mouse Th2 cell clone condition of in vitro culture first, is that the cytokines mRNA that can suppress the Th1 cell strain is transcribed, and becomes " cytokine synthesis inhibitory factor(CSIF) " back called after IL-10.Discover, IL-10 is a kind of many cells sources, multi-functional cytokine, in cells such as T cell, B cell, dendritic cell, Monocytes, keratinocyte, mastocyte, secretion is arranged all, can regulate the differentiation that grows in of cell, participating in Inflammatory response and immunomodulatory, is the inflammation and the immune-regulating factor of generally acknowledging at present.
IL-10 can raise the antigenic expression of major histocompatibility complex II class, stimulator antigen specific b cells propagation, and be divided into plasmocyte, and then secrete multiple specific antibody, as IgG, IgM and IgA etc., the humoral immunity level of enhancing body.Promote propagation, the maturation of non-monocyte dependent T cell, under the condition that IL-3, IL-4 exist, stimulate the propagation of mastocyte and progenitor cell thereof, strengthen the vigor of mastocyte.IL-10 can bring into play the antianaphylaxis effect by suppressing eosinophilic granulocyte expression CD40, and quickens the apoptosis of eosinophilic granulocyte, and IL-10 can also stop the CD4 of TXi Baoshouti mediation
+The activation of T cell.The T cell of handling with IL-10 can cause persistent T cells with antigenic specificity not have effect.IL-10 can suppress the generation and the antigen presentation of prostaglandin E2, also can reduce the expression of lipopolysaccharides signal transduction acceptor TLR-4, strengthens CD14, CD16, CD64 and by the expression of the scavenger receptor CD163 of bacteria lipopolysaccharide, IFN-γ and TNF downward modulation.IL-10 can also suppress scavenger cell and produce oxyradical, oxynitride, metalloprotease, increases the generation of the tissue depressant of metalloprotease.Endogenous and exogenous IL-10 all can be in transcriptional level strongly inhibited IL-1, IL-6, IL-8, TNF-α, granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor etc. synthetic, thereby play antiphlogistic effect.In sum, IL-10 not only can stimulate the specific antibody of body generation at pathogenic micro-organism, improves humoral immunity level; And relating to each link of inflammation, its anti-inflammatory action is extremely extensive.
At present, the research that IL-10 uses in physianthropy is comparatively extensive, has related to diseases such as tumour, colitis, rheumatoid arthritis, psoriatic, hepatitis C, allergic asthma and organ transplantation.Some researchs that the application of IL-10 aspect Animal diseases also carried out both at home and abroad.Discover, the IL-10 gene order of pig IL-10 gene order and people, rat and mouse compares, find that homology is respectively 84%, 79% and 79%, the homology of pig and people IL-10 gene order is very high, and it is consistent that this IL-10 with two kinds of animals has cross reaction.
In Mycobacterium bovis infecting mouse model, IL-10 follows TNF and IL-12 and produces, and IL-12 deficient mice cellular immunization strengthens, thereby causes the reaction of intensive granuloma, makes bacterium remove and accelerates.IL-10 not only directly suppresses scavenger cell and expresses TNF-α, also raises the expression of other anti-inflammatory cytokines (as IL-1R α and sTNF-R1) simultaneously, thereby IL-10 has anti-inflammatory action, can suppress the generation of Inflammatory response.In the disease of the excessive generation of pro-inflammatory cytokine, IL-10 plays important regulating effect.Actinobacillus pleuropneumoniae causes serious acute pleuropneumonia, follow the expression of inflammatory cytokine (as IL-1, IL-6, IL-8 etc.) to increase, the bacillary pleuropneumonia of pig IL-10 (P IL-10) treatment that Morrison etc. (2000) express with recombinant adenovirus obtains better curative effect, the inflammatory cytokine level reduces, and infected pigs's pulmonary lesion alleviates greatly.Therefore, IL-10 is used for the treatment of the immune mediator agent of immunologic function disorder and the anti-inflammatory control agent of some inflammatory diseases, will have very big using value.
Milk-acid bacteria is an important probiotic bacterium in human and animal's digestive tube, be considered to the microorganism of " generally recognized as safe (Generally Regarded As Safe; GRAS) " grade in the world, can bring into play nutrition, biological barrier, immuno-stimulating and improve multiple physiological actions such as body metabolism the host.Milk-acid bacteria can finally be induced the intensity of body enhancing immunity reaction by activating dendritic cell, activating macrophage, raising cytokine levels, increase natural killer cell activity and improving immunoglobulin level.
Summary of the invention
The objective of the invention is in order to solve under high-density, the intensive culture condition, the problem that pig immunity and anti-stress ability descend, and the raising pig produces the ability of specific antibody to pathogenic micro-organism, and provide can by oral, non-injection, have immunoloregulation function, but the recombinant lactic acid bacteria of stably express pig interleukin 10.
Described milk-acid bacteria preferred plant lactobacillus;
Described poIL-10 is to be template with pig spleen cell RNA, the gene order that amplifies;
Described poIL-10, its base sequence is shown in sequence table SEQ ID No.1.
A kind of recombinant plasmid, pW425et-poIL-10.
Another object of the present invention provides the preparation method of pig interleukin 10 recombinant lactic acid bacterias, and it comprises:
1) be template with pig spleen cell RNA, the PCR method amplification obtains the poIL-10 gene order, and its upstream and downstream contains Kpn I and HindIII restriction enzyme site respectively;
2) the poIL-10 gene is inserted among intestinal bacteria-lactic acid bacteria shuttle expression vector pW425et, make up intestinal bacteria-lactic acid bacteria shuttle recombinant expression pW425et-poIL-10;
3) recombinant plasmid pW425et-poIL-10 is converted in the milk-acid bacteria.
Another object of the present invention provides a boar immunostimulant, and it is with pig interleukin 10 recombinant lactic acid bacterias, is inoculated in the liquid MRS substratum, and 37 ℃, static anaerobism is cultured in every milliliter of bacterium liquid and contains 2 * 10
11Individual viable bacteria.
Another object of the present invention provides a kind of method for breeding that strengthens pig immunity, and it comprises: piglet was taken 7-14 days continuously from 7 age in days once described 4ml/ time one boar immunostimulants for oral use every day.
The present invention is according to the gene order of the poIL-10 of GenBank login, design and synthesize a pair of primer, upstream and downstream contains Kpn I and HindIII restriction enzyme site respectively, extract RNA in the pig spleen cell and be template, adopt round pcr to obtain the poIL-10 gene, identify with being converted in the intestinal bacteria after cloning vector pMD18T carrier is connected.To be inserted among intestinal bacteria-lactic acid bacteria shuttle expression plasmid pW425et through being accredited as correct poIL-10 gene, construction recombination plasmid pW425et-poIL-10, and its electricity is converted in the milk-acid bacteria, but obtained the recombinant lactic acid bacteria of stably express pig interleukin 10.Animal experiment shows, but this recombinant lactic acid bacteria effective stimulus B cell proliferation, the level of IgG, IgM and IgA in the raising serum, thus play the effect of regulating the pig immunologic function, and then strengthen the defensive ability/resistance ability of pig to pathogenic micro-organism.
The present invention utilizes the advantage of milk-acid bacteria as human digestive road fungal component, has prepared the recombinant lactic acid bacteria of expressing pig interleukin 10.This recombinant lactic acid bacteria is through oral being colonizated in the enteron aisle, and stably express pig interleukin 10, effectively regulate body's immunological function, stimulate B cell proliferation, improve body produces specific antibody to pathogenic micro-organism ability, enhancing body ensures the healthy growth (production) of pig to the disease resistance of cause of disease, promotes the livestock industry sustainable and healthy development.
By the form of fermentation, can obtain the recombinant lactic acid bacteria of stably express pig interleukin 10 on a large scale, avoided the purification process of original recombinant interleukin 10 complexity; And can bring into play the immunoregulation effect of interleukin 10 by oral this recombinant lactic acid bacteria, evade human and material resources risk that consume and cross infection in the injection use.Production technique is simple relatively, and is easy to use, is beneficial to large-scale production.
Description of drawings
Fig. 1. pig spleen cell RNA extracts the result.Wherein, M:D2000marker; 1: splenocyte RNA extracts the result.
Fig. 2 .poIL-10PCR amplification.Wherein, M:D2000marker; 1:poIL-10PCR result.
Fig. 3 .pMD18T-poIL-10 plasmid extracts the result.Wherein, M: λ DNA/Hind III digested marker; The 1:pMD18T-poIL-10 plasmid extracts the result.
Fig. 4 .pMD18T-poIL-10 enzyme is cut the result.Wherein, M:D2000marker; 1:.pMD18T-poIL-10 enzyme is cut the result.
The homology analysis result of Fig. 5 .poIL-10 gene.
Fig. 6 .pW425et plasmid extracts the result.Wherein, M: λ DNA/Hind III digested marker; The 1:pW425et plasmid extracts the result.
Fig. 7. the pW425et-poIL-10 plasmid extracts the result in the bacillus coli DH 5 alpha.Wherein, M: λ DNA/Hind III digestedmarker; 1: the pW425et-poIL-10 plasmid extracts the result in the intestinal bacteria.
Fig. 8. the pW425et-poIL-10 enzyme is cut the result in the bacillus coli DH 5 alpha.M wherein
1: λ DNA/Hind III digestedmarker; M
2: D2000marker; 1-6: the pW425et-poIL-10 enzyme is cut the result in the bacillus coli DH 5 alpha.
Fig. 9. the pW425et-poIL-10 plasmid extracts the result in the lactobacillus.Wherein, M: λ DNA/Hind III digestedmarker; 1: the pW425et-poIL-10 plasmid extracts the result in the lactobacillus.Wherein, M
1: λ DNA/Hind III digestedmarker; M
2: D2000Marker1,2: pW425et-poIL-10 plasmid enzyme restriction result in the lactobacillus.
Figure 10. pW425et-poIL-10 plasmid enzyme restriction result in the lactobacillus.Wherein, M
1: λ DNA/Hind III digestedmarker; M
2: D2000Marker; 1,2: pW425et-poIL-10 plasmid enzyme restriction result in the lactobacillus.
Figure 11 .poIL-10 expression of results in milk-acid bacteria.Wherein, M: protein Marker; The SDS-PAGE result that A, 1:poIL-10 express in milk-acid bacteria; 2: empty carrier negative control SDS-PAGE result; The Western-blot result that B, 1:poIL-10 express in milk-acid bacteria; 2: empty carrier negative control Western-blot result
Figure 12. pig interleukin 10 recombinant lactic acid bacterias are to the influence of IgG level in the porcine blood serum.
Figure 13. pig interleukin 10 recombinant lactic acid bacterias are to the influence of IgM level in the porcine blood serum.
Figure 14. pig interleukin 10 recombinant lactic acid bacterias are to the influence of IgA level in the porcine blood serum.
Figure 15. pig interleukin 10 recombinant lactic acid bacterias are to CD19 in the pig spleen cell
+The influence of B cell proliferation.
Figure 16. pig interleukin 10 recombinant lactic acid bacterias are to the influence of pig IFN-γ, INF expression level.
Embodiment
The acquisition of embodiment 1 pig interleukin 10 (poIL-10) gene
Get pig spleen, make splenocyte suspension, adopt Trizol to extract the RNA of splenocyte, get 1 μ l and carry out the detection of 0.8% agarose gel electrophoresis, as shown in Figure 1.
1) amplification of poIL-10 gene
According to the poIL-10 gene order design primer of GenBank login, upstream primer: 5 ' TTT
GGTACCATGCCCAGCTCAG, downstream primer: CCC
AAGCTTTCAGTTCTTCCTCATC contains Kpn I and HindIII restriction enzyme site respectively, and it is synthetic to be sent to the living worker in Shanghai.With splenocyte RNA is template, adopts RT-PCR technology amplification poIL-10 gene.
Reaction system:
Upstream primer (P1,10 μ mol/L) 1.0 μ L
Downstream primer (P2,10 μ mol/L) 1.0 μ L
dNTP(2.5mmol/L) 4.0μL
10
×Buffer 5.0μL
Transcriptase-TapDNA polysaccharase 1.0 μ L
Template ribonucleic acid 1.0 μ L
ddH
2O 37.0μL
Total?V 50.0μL
Reaction conditions: 45 ℃ of reverse transcription 30min, 70 ℃ of deactivation 10min; 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, 57 ℃ of annealing 30s, 72 ℃ are extended 1min, totally 30 circulations; 72 ℃ of total elongation 10min.Get 1 μ l after reaction finishes and carry out 0.8% agarose gel electrophoresis and detect, the result shows and successfully amplifies the poIL-10 gene, as shown in Figure 2.
2) being connected of poIL-10 gene and pMD18T, conversion
Adopt Axygen company dna gel to reclaim test kit, operation is reclaimed amplifying target genes to specifications, reclaims fragment and is connected with cloning vector pMD18T.
Linked system:
Solution?I 5.0μL
Reclaim goal gene 3.5 μ L
pMD18T 0.5μL
T4DNA ligase enzyme 1.0 μ L
Total?V 10.0μL
Condition of contact: 16 ℃ of connections are spent the night, transformed into escherichia coli DH5 α next day (E.coli DH5 α) competent cell.
Get connection product 10 μ L, add in the 100 μ L E.coli DH5 α competence ice bath 30min behind the mixing; 42 ℃ of heat shock 90s, ice bath 5min immediately; Add 800 μ L fresh liquid LB substratum, 37 ℃, the 160r/min shaking table is cultivated 2-3h; Get 50 μ L, 100 μ L, 150 μ L respectively, 200 μ L bacterium liquid are coated ready containing on penbritin (100 μ g/mL) the LB agar plate, cultivate 8-16h for 37 ℃, screening recombinant clone.
3) evaluation of pMD8T-poIL-10 and sequential analysis
Press the operation of test kit specification sheets and extract the sub-plasmid of the doubtful positive colony of screening, and get 1 μ L and carry out 0.8% agarose gel electrophoresis, as shown in Figure 3.Adopt Kpn I and HindIII restriction enzyme that the plasmid vector that is extracted is carried out enzyme and cut evaluation, it is as follows that enzyme is cut system:
10×LBuffer 1.0μL
Recombinant plasmid 7.0 μ L
HindIII 1.0μL
Kpn?I 1.0μL
Total?V 10.0μL
Reaction conditions: 37 ℃ of water-bath 2h.After the end, get 5 μ L and carry out 0.8% agarose gel electrophoresis and detect, the result shows and successfully obtained recombinant expression vector pMD8T-poIL-10, as shown in Figure 4.
Recombinant plasmid after will identifying through double digestion is sent to the living worker in Shanghai and checks order, and sequencing result shows that through the Blast compare of analysis sequence homology of poIL-10 gene that is increased and GenBank login reaches 100%, as shown in Figure 5.
The structure of embodiment 2 recombinant expression vector pW25et-poIL-10
1) preparation of plasmid pW425et
Preparation contains the Escherichia coli bacteria liquid of pW425et, extracts the operation of test kit specification sheets according to plasmid DNA, extracts plasmid, gets 2 μ L and carries out the detection of 0.8% agarose gel electrophoresis.The result shows and successfully obtained plasmid pW425et, as shown in Figure 6.
2) recovery of goal gene, connection and conversion
The recovery of goal gene:
Adopt Kpn I and HindIII restriction enzyme respectively pMD8T-poIL-10 and pW425et to be carried out double digestion, to obtain poIL-10 gene and the big fragment of pW425et; The double digestion system is as follows:
10×L?Buffer 2.0μL
Recombinant plasmid (or carrier) 16.0 μ L
HindIII 1.0μL
Kpn?I 1.0μL
Total?V 20.0μL
Reaction conditions: 37 ℃ of water-bath 3h.After the end, press dna gel and reclaim the operation of test kit specification sheets, target gene fragment is reclaimed.
PoIL-10 gene and big segmental connection of carrier:
The target gene fragment that reclaims is connected, and linked system is as follows:
10×Ligation?Buffer 1.0μL
The poIL-10 gene reclaims product 7.0 μ L
PW425et reclaims product 1.0 μ L
T4DNA ligase enzyme 1.0 μ L
Total?V 10.0μL
Reaction conditions: 21 ℃ connect 5h, and 4 ℃ are spent the night; Next day Transformed E .coli DH5 α competence.
Recombinant expression vector Transformed E .coli DH5 α competence:
Get the above-mentioned connection mixture of 10 μ L and add in the 100 μ L E.coli DH5 α competence ice bath 30min behind the mixing; 42 ℃ of heat shock 90s, ice bath 5min immediately; Add 800 μ L fresh liquid LB substratum, 37 ℃, the 160r/min shaking table is cultivated 2-3h; Get 50 μ L, 100 μ L, 150 μ L respectively, 200 μ L bacterium liquid are coated ready containing on erythromycin (200 μ g/mL) the LB agar plate, cultivate 8-16h for 37 ℃, screening recombinant clone.
The enzyme of recombinant expression vector pW25et-poIL-10 is cut evaluation:
Press the operation of test kit specification sheets and extract the sub-plasmid of the doubtful positive colony of screening, and get 1 μ L and carry out 0.8% agarose gel electrophoresis, as shown in Figure 7.Adopt Kpn I and HindIII restriction enzyme that the plasmid vector that is extracted is carried out enzyme and cut evaluation, it is as follows that enzyme is cut system:
10×L?Buffer 1.0μL
Recombinant plasmid (or carrier) 7.0 μ L
HindIII 1.0μL
Kpn?I 1.0μL
Total?V 10.0μL
Reaction conditions: 37 ℃ of water-bath 2h.After the end, get 2 μ L and carry out 0.8% agarose gel electrophoresis and detect, the result shows and successfully made up recombinant expression vector pW25et-poIL-10, as shown in Figure 8.
Embodiment 3 expresses the preparation of pig interleukin 10 recombinant lactic acid bacterias
1) preparation of lactobacillus competent cell and conversion
With-70 ℃ of lactobacillus plantarum, lactobacillus bulgaricus, lactobacterium helveticus, Lactobacterium acidophilum, lactobacterium casei, lactobacillus reuteri or lactobacillus fermentums that very low temperature is frozen, hatch to thawing for 37 ℃, coat MRS flat board (containing thymidylic acid 100 μ g/mL), 37 ℃ of static overnight incubation of anaerobism.Next day, picking colony is inoculated in the fresh 10mL MRS liquid nutrient medium (containing 1% glycine), 37 ℃ of static thalline OD that are cultured to of anaerobism
600Value is 0.6-0.8.Get bacterial culture fluid, (contain 1% glycine) by the 1%-2% dose inoculation in fresh MRS liquid nutrient medium, thalline OD is treated in 37 ℃ of static cultivations of anaerobism
600When value is 0.2-0.3, collect standby;
With the yeast culture thing ice bath 10min of above collection, 4 ℃, 6000r/min, centrifugal 5min.Precipitation is cleaned twice with ice-cold cleaning buffer solution; 4 ℃, 6000r/min, centrifugal 5min collecting precipitation is resuspended in the electric shock damping fluid ice bath 5min at last;
Get the lactobacillus competence 200 μ L of above-mentioned processing, add 20 μ L recombinant expression vector pW25et-poIL-10, mix gently in the ice-cold pole cup of back transposition (Φ 20mm), the laggard horizontal high voltage electricity of ice bath 5min transforms, and condition is voltage 2.5kv, time 3.0ms;
Behind the high-voltage electric shock, with pole cup ice bath 5min, in the liquid MRS substratum that the 800 μ L of content transposition in the cup are fresh, 37 ℃ of static recovery 4-5h of anaerobism, coating contains the MRS flat board of erythromycin (400 μ g/mL), the 37 ℃ of static cultivation of anaerobism 16-20h, screening positive clone.
2) evaluation of recombinant expression vector pW25et-poIL-10 in the milk-acid bacteria
Test kit extracts the plasmid DNA of doubtful positive recombination lactic acid bacillus, and gets 1 μ L and carry out 0.8% agarose gel electrophoresis, as shown in Figure 9; Adopt Kpn I and HindIII restriction enzyme that the plasmid vector that is extracted is carried out enzyme and cut evaluation, it is as follows that enzyme is cut system:
10×L?Buffer 1.0μL
Recombinant plasmid 7.0 μ L
HindIII 1.0μL
Kpn?I 1.0μL
Total?V 10.0μL
Reaction conditions: 37 ℃ of water-bath 2h.After the end, get 2 μ L and carry out the detection of 0.8% agarose gel electrophoresis, as shown in figure 10, confirmed successfully to have prepared recombinant lactic acid bacteria LAB/pW25et-poIL-10.
The detection of embodiment 4 recombinant lactic acid bacteria Lb.planturm/pW25et-poIL-10 expression products
The single bacterium colony of recombinant lactic acid bacteria LAB/pW25et-poIL-10 that (contains erythromycin 400 μ g/mL) on the picking MRS flat board is seeded in the 5ml liquid MRS substratum and (contains erythromycin 400 μ g/mL), and 37 ℃, static anaerobism overnight incubation; The bacterium liquid of getting cultivation next day is seeded in the 100ml liquid MRS substratum in 1: 100 ratio and (contains erythromycin 400 μ g/mL), and 37 ℃, static anaerobism is cultured to bacterium liquid OD
600Value is 0.6 o'clock, begins to collect bacterium liquid, per hour collects once, each 2ml; Empty carrier recombinant lactic acid bacteria Lb.planturm/pW25et also does same processing.Collect after 6 hours continuously, with bacterium liquid 12000r/min, centrifugal 1min abandons supernatant, adds dithiothreitol (DTT) 5 μ l, 2 in precipitation
*Sample-loading buffer 45 μ l, distilled water 50 μ l, behind the mixing to the boiling water 10min.Carry out SDS-PAGE electrophoresis and Western-blot and detect, as shown in figure 11.The result has confirmed that poIL-10 has obtained expression in milk-acid bacteria, but successfully prepares the recombinant lactic acid bacteria Lb.planturm/pW25et-poIL-10 of stably express pig interleukin 10.
Embodiment 5 expresses the detection of pig interleukin 10 recombinant lactic acid bacteria immunoloregulation functions
Recombination lactic acid bacillus Lb.planturm/pW25et-poIL-10 is inoculated in the liquid MRS substratum, and 37 ℃, static anaerobism is cultured in every milliliter of bacterium liquid and contains 2 * 10
11Individual viable bacteria.
15 the 7 healthy piglets of age in days are divided into 3 groups at random, 5 every group, are respectively PBS group (4ml/ time), Lb.planturm group (effective colony number 8 * 10
11/ time) and recombinant lactic acid bacteria Lb.planturm/pW25et-poIL-10 group (effective colony number 8 * 10
11/ time), each is organized to gavage every day once and weans to 21 ages in days, is 4ml at every turn.Piglet 22 ages in days are designated as test 0 day, respectively at getting blood in the 0th day, 7 days and 14 days, adopt the ELISA method to measure IgG, IgM and IgA content in the peripheral blood, and result such as Figure 12 are shown in 13,14.And slaughtered piglet in the 14th day, flow cytometry is measured CD19 in the splenocyte
+The B cell quantity, the result is as shown in figure 15; Get mesenteric lymph nodes simultaneously and measure the expression of urging inflammatory factor IFN-γ, TNF with flow cytometry, the result as shown in figure 16.
Test-results shows that Lb.planturm/pW25et-poIL-10 has improved CD19 in the splenocyte
+The content of immunoglobulin IgG, IgM and IgA in B cell quantity and the peripheral blood, the immunity function of piglet is effectively regulated in the expression of having reduced short inflammatory factor IFN-γ, TNF.
Claims (8)
1. pig interleukin 10 recombinant lactic acid bacterias, it is the milk-acid bacteria that has transformed recombinant plasmid pW425et-poIL-10, wherein poIL-10 is the abbreviation of pig interleukin 10 genes, and described milk-acid bacteria is lactobacillus plantarum, lactobacillus bulgaricus, lactobacterium helveticus, Lactobacterium acidophilum, lactobacterium casei, lactobacillus reuteri or lactobacillus fermentum.
2. pig interleukin 10 recombinant lactic acid bacterias according to claim 1 is characterized in that: described milk-acid bacteria is a lactobacillus plantarum.
3. pig interleukin 10 recombinant lactic acid bacterias according to claim 2 is characterized in that: described poIL-10 is to be template with pig spleen cell RNA, the gene order that amplifies;
4. pig interleukin 10 recombinant lactic acid bacterias according to claim 3 is characterized in that: described poIL-10, its base sequence is shown in sequence table SEQ ID No.1.
5. recombinant plasmid, pW425et-poIL-10.
6. the preparation method of pig interleukin 10 recombinant lactic acid bacterias, it comprises:
1) be template with pig spleen cell RNA, the PCR method amplification obtains the poIL-10 gene order, and its upstream and downstream contains Kpn I and HindIII restriction enzyme site respectively;
2) the poIL-10 gene is inserted among intestinal bacteria-lactic acid bacteria shuttle expression vector pW425et, make up intestinal bacteria-lactic acid bacteria shuttle recombinant expression pW425et-poIL-10;
3) recombinant plasmid pW425et-poIL-10 is converted in the milk-acid bacteria.
7. a boar immunostimulant, it is with pig interleukin 10 recombinant lactic acid bacterias, is inoculated in the liquid MRS substratum, 37 ℃ of static anaerobism are cultured in every milliliter of bacterium liquid and contain 2 * 10
11Individual viable bacteria.
8. method for breeding that strengthens pig immunity, it comprises: piglet was taken 7-14 days continuously from 7 age in days once described 4ml/ time one boar immunostimulants for oral use every day.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010105487222A CN102010849B (en) | 2010-11-18 | 2010-11-18 | Recombinant lactic acid bacteria of pig interleukin 10 and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010105487222A CN102010849B (en) | 2010-11-18 | 2010-11-18 | Recombinant lactic acid bacteria of pig interleukin 10 and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102010849A true CN102010849A (en) | 2011-04-13 |
CN102010849B CN102010849B (en) | 2013-09-04 |
Family
ID=43841181
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2010105487222A Expired - Fee Related CN102010849B (en) | 2010-11-18 | 2010-11-18 | Recombinant lactic acid bacteria of pig interleukin 10 and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102010849B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110343640A (en) * | 2019-07-25 | 2019-10-18 | 上海交通大学 | A kind of fermentation process of people's intestinal flora and application |
CN113677799A (en) * | 2019-02-05 | 2021-11-19 | 伊兰科美国公司 | Genetically modified lactobacillus and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1482247A (en) * | 2003-01-13 | 2004-03-17 | 王春凤 | Non-antibiotics resistant shuttle plasmid expression carrier and its constructing method and uses |
-
2010
- 2010-11-18 CN CN2010105487222A patent/CN102010849B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1482247A (en) * | 2003-01-13 | 2004-03-17 | 王春凤 | Non-antibiotics resistant shuttle plasmid expression carrier and its constructing method and uses |
Non-Patent Citations (2)
Title |
---|
]OKAMOTO I,KOHNO K,TANIMOTO T, ET AL.: "IL-18 prevents the development of chronic graft versus host disease in mice", 《IMMUNOLOGY》, vol. 164, no. 11, 31 December 2000 (2000-12-31), pages 6067 - 6074 * |
胡静涛,等: "猪A 组轮状病毒Vp7 基因与双标记表达载体pW425et 的重组及在大肠杆菌中的表达", 《吉林农业大学学报》, vol. 30, no. 1, 31 December 2008 (2008-12-31), pages 84 - 88 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113677799A (en) * | 2019-02-05 | 2021-11-19 | 伊兰科美国公司 | Genetically modified lactobacillus and application thereof |
CN110343640A (en) * | 2019-07-25 | 2019-10-18 | 上海交通大学 | A kind of fermentation process of people's intestinal flora and application |
CN110343640B (en) * | 2019-07-25 | 2021-04-02 | 上海交通大学 | Fermentation method and application of human intestinal flora |
Also Published As
Publication number | Publication date |
---|---|
CN102010849B (en) | 2013-09-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102356816B (en) | Animal health care probiotics leavening capable of improving meat quality and application thereof | |
CN106540240B (en) | Preparation and application of antibacterial peptide fusion cell factor CAMPILs co-expression biological agent | |
CN110591945A (en) | Excellent lactobacillus reuteri for preventing ulcerative colitis | |
CN105524855B (en) | A kind of bacillus coagulans and its application with aquatic pathogenic bacterium antagonistic properties | |
CN101457233B (en) | Method for constructing chlorella expression vector, converting chlorella and breaking wall of chlorella | |
CN102010849B (en) | Recombinant lactic acid bacteria of pig interleukin 10 and application thereof | |
CN101993843B (en) | Bacillus firmus strain and application thereof | |
CN109593723A (en) | A kind of efficient mescenchymal stem cell and the preparation method and application thereof for inhibiting immune response | |
CN110172433B (en) | Recombinant bacillus subtilis engineering bacterium for producing porcine epidermal growth factor and application thereof | |
CN105132310A (en) | Cold-water-fish probiotics bacillus strain and application thereof | |
CN108558998A (en) | Porcine IL-4/6 co-express the preparation and application of recombination yeast bacteria preparation with pig antibacterial peptide is merged | |
CN116286496B (en) | Composite probiotics for reducing diarrhea of weaned pigs and application thereof | |
CN101955942B (en) | DNA (Deoxyribonucleic Acid) molecule for encoding pig alpha-interferon and recombinant colibacillus as well as application thereof | |
CN109897857A (en) | - 2 gene of human interleukin and its expression of one kind optimization and application | |
CN105646718A (en) | M1 type MAP (macrophage activation peptide) and IL-2 (interleukin-2) fusion protein and fusion gene as well as expression vector and construction method of expression vector | |
CN103012578B (en) | Recombinant porcine interleukin 2, and encoding gene and expression method thereof | |
CN103205377B (en) | Quality bacillus coagulans for breeding broilers and application of excellent bacillus coagulans | |
CN113512559B (en) | Mycoplasma bovis Mbov _0701 mutant gene and mutant strain and application thereof | |
CN110651891B (en) | Probiotic preparation for improving growth performance, immunity and nutritional quality of turbot | |
CN108948163A (en) | Queensland nut plant alexin and its application | |
CN113004424A (en) | Preparation and application of pig interleukin 17 and 22 co-expression alternate antibiotic preparation | |
CN107418905B (en) | Cold water fish probiotic lactococcus lactis strain and application thereof | |
CN108129570B (en) | Preparation and application of fusion bovine antibacterial peptide and interleukin 2 co-expression recombinant yeast preparation | |
CN101280282B (en) | Transgenic yeast containing flounder growth hormone gene, preparation and application thereof | |
CN116903755B (en) | Fusion protein and nucleic acid molecule for pig interleukin3, 7 and 15 co-expression, and substitution biological material and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130904 Termination date: 20151118 |
|
EXPY | Termination of patent right or utility model |