CN101993884B - Double-gene expression plasmid and application thereof - Google Patents

Abstract

The invention provides a double-gene expression plasmid and application thereof. The plasmid can express two exogenous genes at the same time and comprises two groups of warm promoter PRPL promoters which are from gamma protobe and controlled by a temperature sensitive repressor cIts857 and respectively control the expression of two exogenous genes at the downstream. The pronucleus double-gene expression plasmid expresses the exogenous genes for coding red fluorescent protein and organophosphorous hydrolase. The invention also adopts the plasmid to construct bioengineering bacteria which can express the destination gene without derivation and adopts the warm promoter from the gamma protobe to construct the double-gene expression plasmid which can be used for independently expressing two exogenous destination genes. The inducer is avoided by selecting proper expression bacteria strain and the application prospect for constructing the bioengineering bacteria by using the plasmid as the carrier is widened.

Description

A kind of double gene expression plasmid and uses thereof

Technical field

The invention belongs to the genetically engineered field, relate to a kind of while independently to express double gene expression plasmid of two kinds of external source goal gene and uses thereof.

Background technology

Plasmid is the outer hereditary unit that can carry out self-replicating of karyomit(e), comprises thymus nucleic acid (DNA) molecule beyond the karyomit(e) in Eukaryotic organoid and the bacterial cell.Now be used for traditionally specially referring to the dna molecular beyond the karyomit(e) in the biologies such as bacterium, yeast and actinomycetes.In genetically engineered, plasmid often is used as the carrier of gene, and it has broad variety: expression plasmid, cloned plasmids, shuttle plasmid and integrated plasmid etc.Artificial constructed plasmid can integrate multiple useful feature, as contains multiple single restriction enzyme site, has antibiotic resistance etc., often is used to genetically engineered.

The mushroom cell strain system that makes foreign gene obtain efficiently expressing with engineered method generally claims " engineering bacteria ", has been used to all respects, such as pharmaceutical production, contaminant degradation etc.In many situations, " engineering bacteria " is to adopt plasmid as the carrier of foreign gene, when expression alien gene, according to the different promoters of foreign gene upstream, needs to add different inductors and carries out abduction delivering, such as IPTG, semi-lactosi, pectinose etc.

In order to satisfy the research needs of multifunctional engineering, Novagen company has developed pETDuet and pACYCDuet double gene expression vector, the two can express two kinds of target proteins simultaneously in same colon bacillus, also can cotransformation, unite the expression for complicated albumen composition.This serial plasmid adopts T7 promotor control exogenous protein expression, all need the interpolation of inductor when exogenous protein expression, use cost and operation steps that this has increased engineering bacteria are the deficiencies on it is used, and some inductor itself just has certain toxicity, such as IPTG.And in prokaryotic expression plasmid makes up, not yet see the double gene expression plasmid that utilizes other promotors to make up.

At present, the degradation method of organophosphorus pesticide mainly contains photochemical degradation, chemical degradation and three kinds of forms of microbiological deterioration.Although traditional physics and chemistry method degrading organic phosphor pesticides effect is pretty good, cost is too high and cause easily secondary pollution, therefore can only be used as a kind of supplementary means.Along with the development of biotechnology, people explore the degraded of organophosphorus pesticide, have affirmed fully the vital role of microorganism in degraded.It is many that microorganism has kind, the fast characteristics with being easy to handle of variation, the degradation bacteria of having separated so far many organophosphorus pesticides, the biochemical property of the organic phosphorus degrading enzyme of some of them microorganism have obtained identifying that minority organic phosphorus pesticide degradation gene has obtained separating, identifies and transformed.The bioremediation technology of subduing pesticidal contamination with microorganism or acellular enzyme goods show wide application prospect (Qiu Daoji etc., the progress of organic phosphorus pesticide degradation method is printed during chemical industry in the environment, 2006,20 (3): 64-67).Make up the genetically engineered microorganism with degradation of pesticide ability by recombinant DNA technology, be that genetically engineered microorganism (GEMs) is the new way of effectively removing these pollutions, the research that utilizes engineering strain to come degrading organic phosphor pesticides has been arranged at present, but the engineering strain that has made up need to add inductor, has increased use cost and operation steps during organic phosphorus pesticide degradation is used.

Summary of the invention

The object of the invention is to, a kind of simultaneously independent double gene expression plasmid of expressing two kinds of external source goal gene is provided.

Another object of the present invention is, the purposes of above-mentioned double gene expression plasmid is provided.

The objective of the invention is to realize by the following technical solutions.On the one hand, the invention provides a kind of double gene expression plasmid, it can give expression to two kinds of foreign genes simultaneously, and this expression plasmid comprises two groups of P _RP _LPromotor, control is positioned at the expression of two kinds of foreign genes in its downstream respectively; Preferably, described P _RP _LIt is warm start that is controlled by temperature sensitive repressor cIts857 that derives from lambda particles phage.

Preferably, described plasmid also comprises resistant gene, replicon and a plurality of restriction enzyme site; More preferably, described resistant gene is selected from ampicillin resistance gene, Pyocianil resistant gene and kalamycin resistance gene, most preferably is ampicillin resistance gene; Described replicon is selected from pMB1 replicon, CoE1 replicon, pSC101 replicon and p15A replicon, most preferably is the pMB1 replicon; Described restriction enzyme site is selected from EcoR I, BamH I and Pst I.

Preferably, in described foreign gene, comprise at least a kind of reporter gene, be selected from fluorescin genoid, beta-galactosidase gene and luciferase gene, more preferably be selected from the fluorescin genoid, most preferably be the red fluorescent protein gene.

Preferably, wherein said foreign gene is respectively the gene of coding red fluorescent protein and the gene of coding organophosphor hydrolytic enzyme.

Preferably, described double gene expression plasmid has the plasmid map shown in Figure 1B.

Preferably, described double gene expression plasmid has the base sequence shown in SEQ.ID.NO.1.

On the other hand, the invention provides a kind of bacterial strain that comprises above-mentioned double gene expression plasmid; Preferably, described bacterial strain is for being colon bacillus (Escherichia coli) EC-DGEP-LMT001, be preserved in the common micro-organisms center (CGMCC of China Committee for Culture Collection of Microorganisms on January 19th, 2009, the address: Datun Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica), its deposit number is CGMCC2881.The present invention also provides cell liquid culture and/or the whole-cell protein liquid by the bacterial strain preparation that comprises above-mentioned double gene expression plasmid.

Another aspect the invention provides the purposes of above-mentioned protokaryon double gene expression plasmid in transforming the bacterial strain of not expressing the temperature sensitive repressor; Preferably, described bacterial strain is selected from colon bacillus and false pseudomonas bacillus, more preferably colon bacillus.

In sum, the invention provides the double gene expression plasmid that a kind of artificial constructed warm start that is controlled by temperature sensitive repressor (cIts857) that utilizes lambda particles phage is controlled exogenous gene expression, can express simultaneously two kinds of purpose foreign proteins.The bacterial strain of selecting not express temperature sensitive repressor (cIts857) then just can directly be expressed target protein without any need for inducing action as Host Strains.

In a preferred embodiment of the invention, the promotor P on this pL-DsRed-pL-OPH plasmid _RP _LSequence (its sequence is shown in SEQ.ID.NO 2 and SEQ.ID.NO 3), ampicillin resistance gene (its sequence is shown in SEQ.ID.NO 6), pMB1 replicon sequence (its sequence is shown in SEQ.ID.NO 7), rrnBT1T2 terminator sequence (its sequence is shown in SEQ.ID.NO5) derives from plasmid pBV220, red fluorescent protein DsRed gene order (its sequence is shown in SEQ.ID.NO 4) derives from plasmid pDsRed-N1, organophosphor hydrolytic enzyme (organophosphorus hydrolase, OPH) gene order opd (its sequence is shown in SEQ.ID.NO 8) is from plasmid pGEM-T Easy-opd.Each section sequence is cut equimolecular biological means clone by PCR, enzyme and is connected into plasmid pL-DsRed-pL-OPH (its base sequence is shown in SEQ.ID.NO1).

In double gene expression plasmid pL-DsRed-pL-OPH provided by the invention, provide the penbritin selection markers with an ampicillin resistance gene sequence, a pMB1 replicon sequence is in order to keep the self-replicating of plasmid DNA, two groups of promotor P _RP _LSequence is used for the expression of control downstream target gene, the DsRed gene order contains the encoding sequence of target protein red fluorescent protein DsRed, opd gene order coding target protein organophosphor hydrolytic enzyme (organophosphorus hydrolase, OPH), the gene of two target proteins lays respectively at two groups of promotor P _RP _LThe sequence downstream.

This shows, the present invention relates to a kind of plasmid vector, it has two groups of warm start subsequence P that are controlled by temperature sensitive repressor (cIts857) and control destination gene expression that derive from lambda particles phage _RP _LAnd procaryotic high copy replicon pMB1, this plasmid contains two independently genetic expression units, can insert respectively two kinds of goal gene.This plasmid importing is not expressed in the colon bacillus of temperature sensitive repressor (cIts857), and two entrained goal gene of this plasmid just can carry out non-inducible expression, need not add any inductor.This plasmid can also have the consistency replicon with other, carries out multi-gene expression thereby carry out corotation such as the plasmid of the replicons such as pSC101 and p15A.

The plasmid of expressing foreign protein can delay the growth of host cell, and a large amount of evidences show that the plasmid of high copy number and a large amount of recombinant proteins can seriously hinder growth even the existence of transformant.Therefore, when carrying out exogenous protein expression, nearly all expression plasmid all needs to add the expression that inductor is regulated and control foreign protein at present, all is that the increased logarithmic phase interpolation inductor that is chosen at Host Strains is induced exogenous protein expression usually.And being used to come from warm start of lambda particles phage first, the present invention made up the double gene expression plasmid, utilize simultaneously two kinds of external source goal gene of independent expression of this Plasmid pattern, select suitable expression strain then can avoid the use of inductor, open be used for the application prospect that bioengineered strain makes up take plasmid as carrier.The present invention has utilized this double gene expression plasmid construction with the bioengineered strain of red fluorescent protein gene and organophosphor hydrolytic enzyme gene, this project bacterium can be without drug-induced expression organophosphor hydrolytic enzyme and red fluorescent protein, the former can be used for the degraded to organic phosphates chemical pesticide in the environment, latter is used for bioengineered strain and is discharged into the later tracking of environment and detection, has strengthened the environmental safety that bioengineered strain uses.

The bacterial strain that comprises double gene expression plasmid pL-DsRed-pL-OPH provided by the invention is colon bacillus (Escherichia coli) EC-DGEP-LMT001, be preserved in the common micro-organisms center (CGMCC of China Committee for Culture Collection of Microorganisms on January 19th, 2009, the address: Datun Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica), its preserving number CGMCCNo.2881.

Description of drawings

Below, describe by reference to the accompanying drawings embodiments of the invention in detail, wherein:

Figure 1A is the plasmid construction figure of double gene expression plasmid pL-DsRed-pL-OPH provided by the present invention;

Figure 1B is the plasmid map of double gene expression plasmid pL-DsRed-pL-OPH provided by the present invention;

Fig. 2 is double gene expression plasmid pL-DsRed-pL-OPH Transformed E .coliBL21AI provided by the present invention ^TMBacterial strain is cloned in the picture (magnification 10 of fluorescence microscopy Microscopic observation ^{* 4}), wherein A is for transforming bacterial strain, and B is unconverted bacterial strain;

Fig. 3 is double gene expression plasmid pL-DsRed-pL-OPH Transformed E .coliBL21AI provided by the present invention ^TMBacterial strain is cloned in the direct viewing picture under the daylight, and wherein A is for transforming bacterial strain, and B is unconverted bacterial strain;

Fig. 4 is the pcr amplified fragment electrophorogram of egfp gene fragment of the present invention;

Fig. 5 is that the enzyme of pGEM-T-EGFP carrier of the present invention is cut the evaluation electrophorogram, and wherein restriction enzyme site is EcoR I+BamH I;

Fig. 6 is that the PCR of pBV-EGFP carrier of the present invention identifies electrophorogram, and wherein 1 is egfp gene fragment/pBV-EGFP, and 2 is egfp gene fragment/pEGFP-N3;

Fig. 7 is the pcr amplified fragment electrophorogram of pL-EGFP of the present invention;

Fig. 8 is that the enzyme of pL-EGFP carrier of the present invention is cut the evaluation electrophorogram, and wherein 1 is restriction enzyme site EcoR I+BamH I, and 2 is restriction enzyme site EcoR I;

Fig. 9 is the pcr amplified fragment electrophorogram of dsred of the present invention;

Figure 10 is that the enzyme of pGEM-T-DsRed carrier of the present invention is cut the evaluation electrophorogram, and wherein restriction enzyme site is EcoR I+BamH I;

Figure 11 is the PCR checking electrophorogram of pL-DsRed carrier of the present invention, and wherein 1 is dsred fragment/pDsRed-N1, and 2 is dsred fragment/pL-DsRed;

Figure 12 is that the enzyme of pL-DsRed carrier of the present invention is cut the evaluation electrophorogram, and wherein 1 is restriction enzyme site EcoR I+BamH I, and 2 is restriction enzyme site EcoR I;

Figure 13 is the pcr amplification electrophorogram of opd of the present invention;

Figure 14 is that the enzyme of pGEM-T-OPH carrier of the present invention is cut the evaluation electrophorogram, and wherein restriction enzyme site is HindIII+Xho I;

Figure 15 is the PCR checking electrophorogram of pL-OPH carrier of the present invention, and wherein 1 is opd gene fragment/pGEM-T-opd, and 2 is opd gene fragment/pL-OPH;

Figure 16 is that the enzyme of pL-OPH carrier of the present invention is cut the evaluation electrophorogram, and wherein 1 is restriction enzyme site BamH I, and 2 is restriction enzyme site Pst I+BamH I;

Figure 17 is the pcr amplification electrophorogram of pL-DsRed fragment of the present invention;

Figure 18 is the pcr amplification electrophorogram of Promoter-OPH-terminator fragment of the present invention;

Figure 19 is the PCR checking electrophorogram of pL-DsRed-pL-OPH carrier of the present invention, and wherein 1 is dsred and opd gene fragment/pL-DsRed-pL-OPH, and 2 is opd gene fragment/pGEM-T-opd, and 3 is dsred gene fragment/pDsRed-N1;

Figure 20 is that the enzyme of pL-DsRed-pL-OPH carrier of the present invention is cut the evaluation electrophorogram, and wherein 1 is restriction enzyme site Nco I, and 2 is restriction enzyme site Sac I;

Figure 21 is the typical curve of p-NP among the present invention.

Embodiment

Below the invention will be further described by specific embodiment.Should be understood that following examples only are used for explanation the present invention, and be not used in the scope of the present invention that limits.

Employed technology in following examples comprises that PCR, enzyme cut the equimolecular biological means, and strain culturing, conversion, detection technique etc., unless stated otherwise, is routine techniques known to those skilled in the art; Employed plant and instrument, reagent, bacterial strain etc., only this specification sheets specifies, is that the research of this area and technician can be by public approach acquisition.

Below among each embodiment related concrete Examination on experimental operation be described as follows at this:

1, being formulated as follows of 50 μ LPCR amplification systems:

Cumulative volume 50 μ L contain 0.1～10ng plasmid, and 1 * PCR damping fluid (contains Mg ²⁺), each 0.8 μ mol/L of upstream and downstream primer, 0.2mmol/LdNTP, 2.5UDNA polysaccharase.

2, agarose gel electrophoresis, concrete grammar is with reference to " molecular cloning " (third edition) SambrookJ, Russell DW (2001) Molecular cloning:A Laboratory Manual.ColdSpring Harbor Laboratory Press, Cold Spring Harbor, New York, adopt the TAE electrophoretic buffer, the ethidium bromide staining mark, tetrabromophenol sulfonphthalein is indicator.

3, the dna gel purifying reclaims and adopts the dna gel purifying to reclaim test kit (available from Beijing ancient cooking vessel state Bioisystech Co., Ltd), and concrete operations are as follows:

1) will be without the PCR reaction solution of paraffin oil or endonuclease reaction liquid electrophoresis on 1% plain agar sugar gel, downcuts required DNA band and packs in the 1.5mL centrifuge tube, adding solution A (glue heavy/liquor capacity=1/3).

2) 50 ℃ are incubated 10 minutes, put upside down mixing 1 time, sepharose is melted fully in per 2 minutes.Wait to dissolve rearmounted room temperature and add 15 μ L solution B, fully mixing.

3) will mix liquid and be transferred to centrifugal column, leave standstill 2 minutes, 12000r/ minute centrifugal 30 seconds, outwell the waste liquid in the collection tube.

4) add 500 μ L solution C in centrifugal column, 12000r/ minute centrifugal 30 seconds, outwell the waste liquid in the collection tube.

5) repeating step 4) once.

6) 12000r/ minute centrifugal 1 minute, dry remaining liq to remove residual alcohol.

7) the centrifugal purification column sleeve is entered in the clean 1.5mL centrifuge tube, uncap and placed 5～10 minutes, ethanol is fully volatilized totally.

8) add 20～30 μ L solution D (or sterilization deionized water), leave standstill 2 minutes after, 12000r/ minute is centrifugal 30 seconds.Liquid in the centrifuge tube namely is the dna fragmentation of purifying, gets 4 μ L electrophoresis (0.8% agarose, 120V, 10 minutes) and detects and estimate quantitatively.-20 ℃ save backup.

4, the T/A cloning process is as follows:

The PCR product adds the A reaction after reclaiming the test kit recovery with dna gel, contains 6 μ L PCR in the 10 μ L systems and reclaims fragment, 1 * PCR damping fluid, 0.8mmol/L dNTP, 0.5U TaqDNA polysaccharase, 72 ℃ are moved 20 minutes on the PCR instrument, then directly extract reaction solution with the T carrier to be connected.Linked system 10 μ L comprise 5 μ L2 * damping fluids, 1 μ L T carrier DNA (50ng), and 2 μ L add the A fragment, 1 μ L T4DNA ligase enzyme, 4 ℃ of connections are spent the night.Getting 5 μ L connection product joins among the 100 μ L competence bacterium TOP 10, ice bath 30 minutes, 42 ℃ of thermal shocks 90 seconds, placed on ice immediately 3 minutes, add 950 μ L liquid LB substratum, behind 37 ℃ of shaking culture 1h, centrifugal 1 minute of 5000g, abandon top nutrient solution, keep 150 μ L nutrient solution suspension thalline, be uniformly coated on the LB flat board that contains IPTG/X-β-gal/ penbritin, be inverted dull and stereotyped in 37 ℃ cultivate 16～20 hours after, in 4 ℃ of placements 1～2 hour, it is clear that blueness is manifested with flat board, and the picking white colony shakes the dientification of bacteria.

5, the preparation of colon bacillus competent cell (Calcium Chloride Method) and method for transformation are with reference to " molecular cloning " (third edition) Sambrook J, Russell DW (2001) Molecular cloning:A Laboratory Manual.Cold Spring Harbor Laboratory Press, Cold SpringHarbor, New York, concrete operations are as follows:

1) (diameter 2～3mm) forwards in the 1L flask that contains 100mL LB substratum to cultivate 16～20 hours the fresh flat board single bacterium colony of picking from 37 ℃.Cultivated about 3 hours in 37 ℃ of violent joltings.For effectively being transformed, viable count should not surpass 10 ⁸Individual/mL, can measure the growing state that the OD600 value is monitored culture every 20～30 minutes, treat that bacterium liquid OD600 reaches at 0.35 o'clock and begins to gather in the crops bacterial cultures.

2) under aseptic condition, bacterium is transferred in the aseptic polypropylene tube of ice-cold 50mL, placed 10 minutes on ice, make culture be cooled to 0 ℃.

3) in 4 ℃ with SorvallGS3 rotary head (or rotary head suitable with it) with 4100r/ minute centrifugal 10 minutes, to reclaim cell.

4) pour out nutrient solution, pipe was inverted 1 minute so that the trace nutrient solution of final residual flows to end.

5) every 50mL initial incubation thing 0.1mol/L CaCl of 30mL precooling ₂-MgCl ₂Solution is resuspended.

6) in 4 ℃ with 4100r/ minute centrifugal 10 minutes, reclaim cell.

7) pour out supernatant, pipe was inverted 1 minute so that the liquid of final residual flows to end.

8) every 50mL initial incubation thing 0.1mol/LCaCl of 2mL precooling ₂Suspend.

9) from the competent cell suspension, get 200 μ L with the aseptic suction nozzle of cooling and transfer in the aseptic Eppendorf tube, add DNA (volume is less than 10 μ L, and dna content is less than 50ng), rotate gently with the mixing content, in ice, placed 30 minutes.

10) pipe is put in the circulator bath of pre-heating to 42 ℃ and places 90 seconds (not shaking) therebetween.

11) fast pipe is transferred in the ice bath, made cell cooling 1～2 minute.

12) Xiang Guanzhong adds 800 μ L LB substratum, then pipe is transferred on 37 ℃ of shaking tables gentleness and is shaken (rotating speed is no more than 225r/ minute), and incubation made bacteria resuscitation in 45 minutes, and the antibiotics resistance marker gene of expression plasmid coding.

13) then centrifugal concentrating cell uses gently re-suspended cell of an amount of LB, and the competent cell that proper volume (each 90mm flat board can reach 200 μ L) has been transformed is transferred to and contained on the corresponding antibiotic LB nutrient agar.

14) flat board is placed room temperature until liquid is absorbed.Be inverted plate, in 37 ℃ of cultivations, bacterium colony can occur after 12～16 hours.

6, a small amount of of plasmid is extracted (SDS alkaline lysis) method with reference to " molecular cloning " (third edition) Sambrook J, Russell DW (2001) Molecular cloning:A LaboratoryManual.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NewYork, concrete operations are as follows:

1) the mono-clonal bacterium colony of choosing after the conversion contains in the antibiotic LB substratum (50 μ g/L microbiotic) in 37 ℃ of violent jolting overnight incubation in 3mL.

2) the 1.5mL culture is poured in the Eppendorf tube, with Eppendorf centrifuge in 4 ℃ with 12000 g centrifugal 30 seconds, abandon supernatant, make bacterial precipitation dry as far as possible.

3) the gained bacterial precipitation is resuspended in the solution I (solution composition is: 25mmol/LTris-HCl (pH8.0), 10mmol/L EDTA, 50mmol/L glucose) of 100 μ L precoolings, thermal agitation disperses bacterial precipitation fully in solution I.

4) add the new solution II (solution composition is: 200mmol/L Na0H, 1%SDS) of preparing of 200 μ L, cover tightly the mouth of pipe, put upside down fast centrifuge tube 5 times, centrifuge tube is positioned on ice.

5) (solution composition is: 3mol/L Potassium ethanoate (KAc) damping fluid to add the solution III of 150 μ L precoolings, pH 4.8), cover tightly the mouth of pipe, will manage and leniently vibrate 10 seconds after being inverted, solution III is uniformly dispersed in the bacterial lysate of thickness, afterwards pipe was placed 3～5 minutes on ice.

6) use Eppendorf centrifuge in 4 ℃, centrifugal 5 minutes kinds of 12000g are transferred to supernatant in another centrifuge tube.

7) dehydrated alcohol of 2 times of volumes of adding, vibration mixes, and places 30 minutes in-20 ℃.With Eppendorf centrifuge in 4 ℃ with 12000g centrifugal 10 minutes.

8) carefully suck supernatant liquor, centrifuge tube is inverted on a piece of paper towel, so that all liquid flows out.The drop that will invest again tube wall eliminates.

9) with 1mL 70% washing with alcohol precipitation, by step 8) described method removes supernatant, makes nucleic acid precipitation drying 8 minutes in air.

10) add the sterilization deionized water dissolving precipitation that 40 μ L contain 20 μ g/mL RNaseA, 37 ℃ of insulations are put into-20 ℃ after 30 minutes and are saved backup.

7, endonuclease reaction

The single endonuclease digestion reaction system: cumulative volume 20 μ L, the about 500ng of plasmid or dna fragmentation, restriction endonuclease 1 μ L, 10 * damping fluid, 2 μ L supply volume to 20 μ L with the sterilization deionized water.37 ℃ of insulations 4 hours are got 5 μ L enzymes and are cut product and carry out electrophoresis and identify, continue endonuclease reaction until enzyme cuts entirely.

The double digestion reaction system: cumulative volume 20 μ L, the about 500 μ g of plasmid or dna fragmentation, two kinds of each 0.8 μ L of restriction endonuclease, 10 * damping fluid, 2 μ L supply volume to 20 μ L with the sterilization deionized water.37 ℃ of insulation 4h get 5 μ L enzymes and cut product and carry out electrophoresis and identify, continue endonuclease reaction until enzyme cuts entirely.

Embodiment 1: the structure of carrier pL-EGFP

Present embodiment is the structure of carrier pL-EGFP, comprise the pcr amplification that carries out first the EGFP gene fragment and clone, then construct carrier pBV-EGFP, after amplifying pL-EGFP fragment wherein, finally construct carrier pL-EGFP, details are as follows for concrete operation steps:

(1) pcr amplification of EGFP gene fragment and T/A clone

1. the pcr amplification of egfp gene fragment: take pEGFP-N3 (Clotech company) as template, amplification egfp gene fragment, 717bp.Adopt pfuDNA polysaccharase (Promega company), amplification system 50 μ L, the upstream primer sequence is 5 '-GGGAATTCATGGTGAGCAAGGGCGAG GAGCT (EcoR I), the downstream primer sequence is 5 '-TTGGATCCCTTGTACAGCTCGTCCATGCCGAG (BamH I), and the pcr amplification parameter is set to: 94 ℃ of denaturations 3 minutes; 94 ℃, 30 seconds/68 ℃ 80 seconds (25 circulations); 72 ℃ 10 minutes.Amplified fragments carry out agarose gel electrophoresis, the result is as shown in Figure 4;

2. the purifying of egfp gene fragment reclaims: adopt the agarose gel electrophoresis purifying and reclaim the egfp gene fragment;

3. make up plasmid pGEM-T-EGFP: after the egfp gene fragment that reclaims is added the A reaction, be connected structure plasmid pGEM-T-EGFP (working instructions of Promega company are seen in the concrete operations that add A reaction and connection) with pGEM-TEasy carrier (Promega company);

4. enzyme is cut evaluation: adopt EcoR I and BamH I double digestion plasmid pGEM-T-EGFP can obtain the egfp fragment, enzyme is cut and is identified electrophoresis result as shown in Figure 5.

(2) structure of carrier pBV-EGFP

1. enzyme is cut processing: the purified product of plasmid pBV 220 (Inst. of Viruses, China Preventive Medicine Science Academy) and pGEM-T-EGFP is processed through EcoR I and BamH I double digestion respectively, and purifying purpose band is reclaimed in gel electrophoresis;

2. make up plasmid pBV-EGFP: linked system 25 μ L, comprise 2.5 μ L10 * T4DNA ligase enzyme damping fluid, the 100ng enzyme is cut the recovery fragment behind pBV 220 carriers, and the 100ng enzyme is cut the recovery fragment behind the pGEM-T-EGFP, 1 μ LT4DNA ligase enzyme, 16 ℃ connect 20 hours.

3. transform plasmid pBV-EGFP: usefulness connects product Transformed E .coli DH 5 α (available from sky, Beijing root company), is coated on the LB agar plate that contains penbritin (50 μ g/mL, lower same) 37 ℃ of incubated overnight.Choose mono-clonal bacterium colony (volume 5mL, lower same) in the liquid LB that contains penbritin, 37 ℃ of lower 200～250r/ minute incubated overnight.

4. identify: get 1.5mL bacterium liquid and carry out plasmid and extract in a small amount, 25 times of former plasmids of dilution can amplify the egfp gene fragment as pcr template by the PCR checking, electrophoresis result as shown in Figure 6, wherein 1 is pBV-EGFP, 2 is pEGFP-N3.Electrophoresis result proof gained plasmid is purpose plasmid pBV-EGFP.

(3) structure of carrier pL-EGFP

1. the pcr amplification of pL-EGFP fragment: take pBV-EGFP as template, adopt pcr amplification pL-EGFP fragment, 3624bp.Adopt the pfuDNA polysaccharase, amplification system 50 μ L, the upstream primer sequence is 5 '-TTC GAGCTCCGTGCGTGTTGACTATTTTACCT (Sac I), the downstream primer sequence is 5 '-GC TCTAGATCGGCAAGGTGTTCTGGTC (XbaI), the pcr amplification parameter is set to: 94 ℃ of denaturations 3 minutes; 94 ℃, 40 seconds/56 ℃, 35 seconds/72 ℃, 6 minutes 10 seconds (25 circulations); 72 ℃, 10 minutes.The electrophoresis result of amplified fragments as shown in Figure 7;

2. the purifying of pL-EGFP fragment reclaims: utilize dna gel to reclaim the pL-EGFP fragment that test kit reclaims the purifying pcr amplification;

3. the phosphorylation of pL-EGFP fragment connects and transforms:

1) phosphorylation: utilize T4 polynucleotide kinase (available from Dalian Bao Bio-Engineering Company) phosphorylation PCR product pL-EGFP fragment terminal, press following system configurations reaction tubes: the about 25pmol/L of PCR product fragment, 5 μ L10 * T4 polynucleotide kinase damping fluid, 1 μ L 10mmol/LATP, 1 μ LT4 polynucleotide kinase replenishes volume to 50 μ L with the sterilization deionized water.37 ℃, reacted 30 minutes.Then 65 ℃, 20 minutes deactivation polynucleotide kinases.Phenol-chloroform extracting 2 times;

2) connect: carry out recirculation and connect, system is as follows: the PCR product 100ng of phosphorylation, 1 μ L10 * T4DNA ligase enzyme damping fluid, 0.5 μ L T4DNA ligase enzyme (available from Dalian Bao Bio-Engineering Company), 1.5 μ L 30%PEG8000, water supply volume to 10 μ L.16 ℃, reacted 20 hours;

3) transform and identify: get 8 μ L and connect product Transformed E .coli DH5 α, be coated on the LB agar plate that contains penbritin, 28 ℃ of incubated overnight.The picking mono-clonal enters to contain in the liquid LB substratum of penbritin, in 28 ℃ of incubated overnight.Next day, get bacterium liquid 1mL centrifugation thalline, the thalline Color expression is the green thalline that will clone that is obviously, extract plasmid, and carry out enzyme with EcoR I and BamH I and cut evaluation, the gained stripe size is consistent with expection, electrophoresis result as shown in Figure 8, wherein 1 is restriction enzyme site EcoR I+BamH I, and 2 is restriction enzyme site EcoR I, and the success of pL-EGFP plasmid construction is described.

Embodiment 2: the structure of double gene expression plasmid pL-DsRed-pL-OPH

Present embodiment is the structure of double gene expression plasmid pL-DsRed-pL-OPH, comprise make up respectively first and amplify plasmid pL-DsRed and plasmid pL-OPH after, connect and construct double gene expression plasmid pL-DsRed-pL-OPH, its plasmid construction figure is shown in Figure 1A, corresponding plasmid map as shown in Figure 1B, details are as follows for concrete operation steps:

(1) structure of plasmid pL-DsRed

1. the pcr amplification of DsRed gene fragment and T/A clone: take pDsRed-N1 (available from Clontech company) as template, the DsRed gene fragment that increases, its base sequence shown in SEQ.ID.NO4,690bp.Adopt the pfuDNA polysaccharase, amplification system 50 μ L, the pcr amplification parameter is set to: 94 ℃ of denaturations 3 minutes; 94 ℃, 30 seconds/57 ℃, 30 seconds/72 ℃, 90 seconds (25 circulations); 72 ℃, 10 minutes.The electrophoresis result of amplified fragments, as shown in Figure 9; The upstream primer sequence is 5 '-G GAATTCATGGTGCGCTCCTCCAAGA (EcoR I), the downstream primer sequence is 5 '-CG GGATCCCTCATTACTACAGGAACAGGTGGTGGC (BamH I);

2. the purifying of DsRed gene fragment reclaims: Purified in electrophoresis reclaims the DsRed gene fragment of PCR electrophoresis amplification;

3. the structure of plasmid pGEM-T-DsRed: add after the A reaction and to be connected structure plasmid pGEM-T-DsRed with the pGEM-TEasy carrier;

4. enzyme is cut evaluation: the plasmid pGEM-T-DsRed that utilizes EcoR I and BamH I double digestion to make up, enzyme cut and identify electrophoresis result as shown in figure 10.

5. the structure of plasmid pL-DsRed:

1) enzyme is cut processing: adopt EcoR I and BamH I double digestion to process pGEM-T-DsRed and pL-EGFP;

2) purifying reclaims: the gel electrophoresis purifying reclaims the purpose band;

3) make up the pL-DsRed carrier: connect;

4) checking: utilize pcr amplification DsRed gene to verify, electrophoresis result as shown in figure 11, wherein 1 is pDsRed-N1,2 is pL-DsRed; Utilizing simultaneously EcoR I and BamH I to carry out double digestion identifies, as seen double digestion can cut out DsRed gene fragment (690bp), EcoR I single endonuclease digestion gained linearizing band also with the expection consistent (3615bp), electrophoresis result as shown in figure 12, wherein 1 is restriction enzyme site EcoR I+BamH I, and 2 is restriction enzyme site EcoR I.

(2) structure of plasmid pL-OPH

1. the pcr amplification of OPH gene fragment and T/A clone: the gene opd take plasmid pGEM-T-opd (Chinese Academy of Sciences's Institute of Botany) as template amplification OPH, its base sequence shown in SEQ.ID.NO 8,1098bp.Adopt the pfuDNA polysaccharase, amplification system 50 μ L, the pcr amplification parameter is set to: 94 ℃ of denaturations 3 minutes; 94 ℃, 30 seconds/57 ℃, 35 seconds/72 ℃, 2 minutes (25 circulations); 72 ℃, 10 minutes.The electrophoresis result of amplified fragments as shown in figure 13;

2. the purifying of opd gene fragment reclaims: Purified in electrophoresis reclaims the opd gene fragment of PCR electrophoresis amplification;

3. the structure of plasmid pGEM-T-OPH: add after the A reaction and to be connected structure plasmid pGEM-T-OPH with the pGEM-TEasy carrier;

4. enzyme is cut evaluation: the plasmid pGEM-T-OPH that utilizes BamH I and Pst I double digestion to make up, enzyme cut and identify electrophoresis result as shown in figure 14.

5. the structure of plasmid pL-OPH

1) enzyme is cut processing: adopt BamH I and Pst I double digestion to process pGEM-T-OPH and carrier pBV 220;

2) purifying reclaims: the gel electrophoresis purifying reclaims purpose band opd;

3) make up the pBV-OPH carrier: connect;

4) make up the pL-OPH carrier: process pBV-OPH with EcoR I and Pst I double digestion and cut out the opd gene, and be connected carrier pL-EGFP with EcoR I with Pst I double digestion and be connected structure pL-OPH carrier;

5) checking: utilize pcr amplification opd gene to verify, electrophoresis result as shown in figure 15, wherein 1 is pGEM-T-opd, 2 is pL-OPH; Utilize simultaneously EcoR I and Pst I to carry out double digestion and identify, electrophoresis result as shown in figure 16, wherein 1 is restriction enzyme site BamH I, 2 is restriction enzyme site Pst I+BamH I.

(3) structure of double gene expression plasmid pL-DsRed-pL-OPH

1. the pcr amplification of pL-DsRed fragment and Promoter-OPH-terminator fragment

1) pcr amplification of pL-DsRed fragment: adopt pcr amplification pL-DsRed fragment, 3615bp take pL-DsRed as template.Adopt the pfuDNA polysaccharase, amplification system 50 μ L, the pcr amplification parameter is set to: 94 ℃ of denaturations 3 minutes; 94 ℃, 40 seconds/56 ℃, 35 seconds/72 ℃, 6 minutes 10 seconds (25 circulations); 72 ℃, 10 minutes.Electrophoresis result as shown in figure 17.

2) pcr amplification of Promoter-OPH-terminator fragment: adopt pcr amplification Promoter-OPH-terminator fragment, 2002bp take pL-OPH as template.Adopt the pfuDNA polysaccharase, amplification system 50 μ L, the pcr amplification parameter is set to: 94 ℃ of denaturations 3 minutes; 94 ℃, 40 seconds/53 ℃, 35 seconds/72 ℃, 4 minutes 30 seconds (25 circulations); 72 ℃, 10 minutes.Electrophoresis result as shown in figure 18.

2. the structure of double gene expression plasmid pL-DsRed-pL-OPH

1) purifying reclaims: utilize dna gel to reclaim test kit and reclaim purifying pL-DsRed and Promoter-OPH-terminatorPCR amplified fragments;

2) phosphorylation: utilize T4 polynucleotide kinase phosphorylation Promoter-OPH-terminator fragment terminal.Press following system configurations reaction tubes: the about 25pmol/L of PCR product fragment, 5 μ L10 * T4 polynucleotide kinase damping fluid, 1 μ L 10mmol/LATP, 1 μ L T4 polynucleotide kinase replenishes volume to 50 μ L with the sterilization deionized water.37 ℃, reacted 30 minutes.Then 65 ℃, 20 minutes deactivation polynucleotide kinases.Phenol-chloroform extracting 2 times.

3) connect: the system that connects is as follows: pL-DsRed fragment purification product 100ng, phosphorylation Promoter-OPH-terminator fragment 100ng, 1 μ L, 10 * T4DNA ligase enzyme damping fluid, 0.5 μ L T4DNA ligase enzyme, 1.5 μ L 30%PEG8000, water supply volume to 10 μ L.16 ℃, reaction 20h.

4) transform and identify: get 8 μ L and connect product Transformed E .coli DH 5 α, be coated on the LB agar plate that contains penbritin, 28 ℃ of incubated overnight.Choose the mono-clonal bacterium colony and contain 28 ℃ of 200～250r/ minute incubated overnight among the liquid LB of penbritin in 3mL.Get 1.5mL bacterium liquid and carry out plasmid and extract in a small amount, 25 times of former plasmids of dilution are as pcr template, the DsRed gene fragment that increases simultaneously and opd gene fragment, carry out PCR checking, electrophoresis result as shown in figure 19, wherein 1 is pL-DsRed-pL-OPH, 2 is pGEM-T-opd, and 3 is pDsRed-N1; Utilize respectively Sac I and Nco I to carry out single endonuclease digestion checking, electrophoresis result as shown in figure 20, wherein 1 is restriction enzyme site Nco I, 2 is restriction enzyme site Sac I.

Embodiment 3: double gene expression plasmid pL-DsRed-pL-OPH transforms bacterial strain

Present embodiment is transformed into double gene expression plasmid pL-DsRed-pL-OPH in the bacterial strain, and has carried out Function Identification to transforming bacterial strain.

1, the bacterial strain of preparation Plasmid Transformation:

Adopt Calcium Chloride Method to prepare E.coli BL21AI ^TMBacterial strain (Invitrogen company) competent cell changes plasmid pL-DsRed-pL-OPH in this competent cell over to, the competent cell that has transformed is transferred to contain on the antibiotic LB nutrient agar of penbritin.Flat board is placed room temperature until liquid is absorbed.Be inverted plate, in 30 ℃ of cultivations, bacterium colony can occur after 12～16 hours.The gained colony clone is plasmid pL-DsRed-pL-OPH and transforms bacterial strain.

2, the fluorescent characteristic that transforms bacterial strain is observed:

The clone who plasmid pL-DsRed-pL-OPH on the LB medium agar flat board is transformed bacterial strain continues 30 ℃ of cultivations after about 2 days, clone on the flat board is placed the fluorescence microscopy Microscopic observation, as seen intense red fluorescence, as shown in Figure 2, wherein A is for transforming bacterial strain, B is unconverted bacterial strain, and magnification is 10 ^{* 4}Continue to cultivate after about 5 days, as seen direct viewing is just cloned and is presented redness under daylight, and as shown in Figure 3, wherein A is for transforming bacterial strain, and B is unconverted bacterial strain.

3, preparation transforms the cell liquid culture of bacterial strain:

The E.coli BL21AI that picking pL-DsRed-pL-OPH transforms ^TMMono-clonal enters to contain among the liquid LB of penbritin, in 30 ℃ of jolting overnight incubation.Be inoculated in the new liquid LB substratum that contain penbritin with 2% ratio next day, continues to obtain to transform behind 30 ℃ of cultivation 14h the cell liquid culture of bacterial strain.

4, preparation transforms the whole-cell protein of bacterial strain:

Get the E.coli BL21AI that pL-DsRed-pL-OPH transforms ^TMStrain cultured solution 1.5mL pours in the Eppendorf tube, with Eppendorf centrifuge in 4 ℃ with 12000g centrifugal 30 seconds, abandon supernatant.

With twice of 1 * phosphate buffered saline buffer (PBS) (pH 7.4) washing precipitation.

1 * the PBS that adds 300 μ L suspends and precipitates the N,O-Diacetylmuramidase of the 50mg/mL of 1/100 volume, the 10%TritonX-100 of 1/100 volume.30 ℃ of temperature were bathed 15 minutes.

Centrifuge tube is placed on ice ultrasonication (40Hz, 2～3 minutes).Gained liquid is whole-cell protein liquid.

5, transform the organophosphor hydrolytic enzyme determination of activity of the whole-cell protein liquid of bacterial strain

1) mensuration of protein concn

Protein concn adopts the method for Bradford (1976) to measure.

2) making of p-NP typical curve

With 50mmol/LTris-HCl damping fluid (pH 7.8) p-NP is diluted to 6 concentration gradients (0,30,60,90,120,150mmol/L), measures respectively the absorbance of 400nm, then with OD ₄₀₀Value is ordinate zou, and p-NP concentration is X-coordinate, drawing standard curve (seeing Figure 21).

3) the OPH determination of activity of transformed bacteria

1. get 30 ℃ of bacterium samples of cultivating 14 hours and placing the 4th day, the 8th day and prepare whole-cell protein.

2. reaction system: cumulative volume 1mL contains 10 μ g whole-cell proteins, the thiophos of 3 μ L 50mmol/L, mixing in the 50mmol/LTris-HCl damping fluid (pH7.8).

3. 30 ℃ of reactions were used spectrophotometric determination OD after 1.5 hours ₄₀₀Value.

According to typical curve, the organophosphor hydrolytic enzyme that calculates whole-cell protein lysate (TCP, totalcellprotein) is active, and the result is as shown in table 1.

Table 1 transforms bacterial strain to the degraded of organophosphorus pesticide

In table 1, the lower listed numeral in " 14 hours ", " 4 days " and " 8 days " represents respectively at 30 ℃ and cultivated 14 hours and active at 30 ℃ of organophosphor hydrolytic enzymes of whole-cell protein lysate of bacterium samples preparation of placing the 4th day, the 8th day.

Sequence table

＜110〉Institute of Zoology, Academia Sinica

＜120〉a kind of double gene expression plasmid and uses thereof

<130>DIC09110020

<160>8

<170>PatentIn version 3.3

<210>1

<211>5617

<212>DNA

＜213〉artificial sequence

<400>1

ttcgagctcc gtgcgtgttg actattttac ctctggcggt gataatggtt gcatgtacta 60

aggaggttgt atggaacaac gcataaccct gaaagattat gcaatgcgct ttgggcaaac 120

caagacagct aaaagatctc tcacctacca aacaatgccc ccctgcaaaa aataaattca 180

tataaaaaac atacagataa ccatctgcgg tgataaatta tctctggcgg tgttgacata 240

aataccactg gcggtgatac tgagcacatc agcaggacgc actgaccacc atgaaggtga 300

cgctcttaaa aattaagccc tgaagaaggg cagcattcaa agcagaaggc tttggggtgt 360

gtgatacgaa acgaagcatt ggttaaaaat taaggaggga attcatggtg cgctcctcca 420

agaacgtcat caaggagttc atgcgcttca aggtgcgcat ggagggcacc gtgaacggcc 480

acgagttcga gatcgagggc gagggcgagg gccgccccta cgagggccac aacaccgtga 540

agctgaaggt gaccaagggc ggccccctgc ccttcgcctg ggacatcctg tccccccagt 600

tccagtacgg ctccaaggtg tacgtgaagc accccgccga catccccgac tacaagaagc 660

tgtccttccc cgagggcttc aagtgggagc gcgtgatgaa cttcgaggac ggcggcgtgg 720

tgaccgtgac ccaggactcc tccctgcagg acggctgctt catctacaag gtgaagttca 780

tcggcgtgaa cttcccctcc gacggccccg taatgcagaa gaagaccatg ggctgggagg 840

cctccaccga gcgcctgtac ccccgcgacg gcgtgctgaa gggcgagatc cacaaggccc 900

tgaagctgaa ggacggcggc cactacctgg tggagttcaa gtccatctac atggccaaga 960

agcccgtgca gctgcccggc tactactacg tggactccaa gctggacatc acctcccaca 1020

acgaggacta caccatcgtg gagcagtacg agcgcaccga gggccgccac cacctgttcc 1080

tgtagtaatg agggatccgt cgacctgcag ccaagcttct gttttggctt atgagagaag 1140

attttcagcc tgatacagat taaatcagaa cgcagaagcg gtctgataaa acagaatttg 1200

cctcccggca gtagcgcggt ggtcccacct gaccccatgc cgaactcaga agtgaaacgc 1260

cgtagcgccg atggtagtgt ggggtctccc catgcgagag tagccaactg ccaggcatca 1320

aataaaacga aaggctcagt cgaaagactg ggcctttcgt tttatctgtt gtttgtcggt 1380

gaacgctctc ctgagtagga caaatccgcc gggagcggat ttgaacgttg cgaagcaacg 1440

gcccggaggg tggcgggcag gacgcccgcc ataaactgcc aggcatcaaa ggaatcagaa 1500

ggccatcctg acggatggcc tttttgcgtt tctacaaact ctttgtttat ttttctaaat 1560

acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg 1620

aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc 1680

attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga 1740

tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga 1800

gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg 1860

cgcggtatta tcccgtgttg acgccgggca agagcaactc ggtcgccgca tacactattc 1920

tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac 1980

agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact 2040

tctgacaacg atcgggagga ccgaaggagc taaccgcttt tttgcacaac atgggggatc 2100

atgtaactcg ccttgatcgt tgggaaccgg atctgaatga agccatacca aacgacgagc 2160

gtgacaccac gatgcctgta gcaatggcaa caacgttgcg caaactatta actggcgaac 2220

tacttactct agcttcccgg caacaattaa tagactggat ggaggcggat aaagttgcag 2280

gaccacttct gcgctcggcc cttccggctg gctggtttat tgctgataaa tctggagccg 2340

gtgagcgtgg gtctcgcggt atcattgcag cactggggcc agatggtaag ccctcccgta 2400

tcgtagttat ctacacgacg gggagtcagg caactatgga tgaacgaaat agacagatcg 2460

ctgagatagg tgcctcactg attaagcatt ggtaactgtc agaccaagtt tactcatata 2520

tactttagat tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt 2580

ttgataatct catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc 2640

ccgtagaaaa gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct 2700

tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa 2760

ctctttttcc gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag 2820

tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc 2880

tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg 2940

actcaagacg atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca 3000

cacagcccag cttggagcga acgacctaca ccgaactgag atacctacag cgtgagcatt 3060

gagaaagcgc cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg 3120

tcggaacagg agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc 3180

ctgtcgggtt tcgccaacct ctgacttgag cgtcgatttt gtgatgctcg tcaggggggc 3240

ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc 3300

cttttgctca catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg 3360

cctttgagtg agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga 3420

gcgaggaagc ggaagagcgc ccttatcttt ccctttattt ttgctgcggt aagtcgcata 3480

aaaaccattc ttcataattc aatccattta ctatgttatg ttctgagggg agtgaaaatt 3540

cccctaattc gatgaagatt cttgctcaat tgttatcagc tatgcgccga ccagaacacc 3600

ttgccgatct agacgcttgc tagccatgag cggatacata tttgaatgta tttagaaaaa 3660

taaacaaaga gtttgtagaa acgcaaaaag gccatccgtc aggatggcct tctgattcct 3720

ttgatgcctg gcagtttatg gcgggcgtcc tgcccgccac cctccgggcc gttgcttcgc 3780

aacgttcaaa tccgctcccg gcggatttgt cctactcagg agagcgttca ccgacaaaca 3840

acagataaaa cgaaaggccc agtctttcga ctgagccttt cgttttattt gatgcctggc 3900

agttggctac tctcgcatgg ggagacccca cactaccatc ggcgctacgg cgtttcactt 3960

ctgagttcgg catggggtca ggtgggacca ccgcgctact gccgggaggc aaattctgtt 4020

ttatcagacc gcttctgcgt tctgatttaa tctgtatcag gctgaaaatc ttctctcata 4080

agccaaaaca gaagcttggc tgcagtcatg acgcccgcaa ggtcggtgac aagaaccgcg 4140

ccgggttagt cacagtgatg cctgccagcg tttcctgtgg gacgcccttc tctcgtagga 4200

atgggatcac tctcagtgga atgaaggcca tcccgtcggg gttcacgcga tccatcacgt 4260

ccatgatgtt ggtgacatag ctcgaaaacc cgaacagcca gtcattcgaa acgaggattt 4320

gtttcatgta gccttggtcg atgagcgcct tgatcaagag agcccgtgtt tgccacgaac 4380

ggatgcccag gagggctgat gcactcgcat tatcttctag accaatcgca ctgtgcggga 4440

tgtggtctag accgatgagg tatccgcgcg cagcgagggc ggtgagatag ctcaaatcgt 4500

cagtatcatc gctgtgacca atacaaaccc gtgaggggct caagccttcg gactcaaaaa 4560

tggcggcctg ctgctcacca tcgcgctgac ttgctgccgt gtgagtggtt accggaacac 4620

cggtggccaa gctggcccgg gcggccgcct ttaacactaa ctcctgaaag ggggtcgcct 4680

tgcctgtggt cgcgaccttg ataatgcccg ccctaattcc ggtgtctttg atgccatatt 4740

gaatctcacg caggaagaac tgtgtgagtt cctctacact cctcaatcgc atcgaaagtg 4800

gcgggtcgaa ccacaagccg gtcgccgcca cgatatgaac gtcggcagcc cgcgaaacct 4860

cggccaataa actgacgtcg cgaccgatat cgaaagtcga cacatcgaca atcgttcgca 4920

cgccagccgc tctggcgcgg cgcaatcctc tcacagcctt ttccgctaga gctttgcggc 4980

taccgaagaa ctctggccaa gcacgcaaga atcctgccga gctgccgcag atgtgctcgt 5040

gagtcagtgt gaaacccgct tcagagattg tgataggacc gcgcacggta ttgatccgat 5100

cgcctgtgcc gatcgatcca gccacgctcg cgcacccagc caggccgccg agcagagttc 5160

ctgcggcggc cgcagacttg agcacaaccc ttctcgtttg catggatccc cgggaattcc 5220

ctccttaatt tttaaccaat gcttcgtttc gtatcacaca ccccaaagcc ttctgctttg 5280

aatgctgccc ttcttcaggg cttaattttt aagagcgtca ccttcatggt ggtcagtgcg 5340

tcctgctgat gtgctcagta tcaccgccag tggtatttat gtcaacaccg ccagagataa 5400

tttatcaccg cagatggtta tctgtatgtt ttttatatga atttattttt tgcagggggg 5460

cattgtttgg taggtgagag atcttttagc tgtcttggtt tgcccaaagc gcattgcata 5520

atctttcagg gttatgcgtt gttccataca acctccttag tacatgcaac cattatcacc 5580

gccagaggta aaatagtcaa cacgcacgga gctcgaa 5617

<210>2

<211>389

<212>DNA

＜213〉lambda particles phage P _RP _LThe promotor positive-sense strand

<400>2

cgtgcgtgtt gactatttta cctctggcgg tgataatggt tgcatgtact aaggaggttg 60

tatggaacaa cgcataaccc tgaaagatta tgcaatgcgc tttgggcaaa ccaagacagc 120

taaaagatct ctcacctacc aaacaatgcc cccctgcaaa aaataaattc atataaaaaa 180

catacagata accatctgcg gtgataaatt atctctggcg gtgttgacat aaataccact 240

ggcggtgata ctgagcacat cagcaggacg cactgaccac catgaaggtg acgctcttaa 300

aaattaagcc ctgaagaagg gcagcattca aagcagaagg ctttggggtg tgtgatacga 360

aacgaagcat tggttaaaaa ttaaggagg 389

<210>3

<211>389

<212>DNA

＜213〉lambda particles phage P _RP _LThe promotor antisense strand

<400>3

cctccttaat ttttaaccaa tgcttcgttt cgtatcacac accccaaagc cttctgcttt 60

gaatgctgcc cttcttcagg gcttaatttt taagagcgtc accttcatgg tggtcagtgc 120

gtcctgctga tgtgctcagt atcaccgcca gtggtattta tgtcaacacc gccagagata 180

atttatcacc gcagatggtt atctgtatgt tttttatatg aatttatttt ttgcaggggg 240

gcattgtttg gtaggtgaga gatcttttag ctgtcttggt ttgcccaaag cgcattgcat 300

aatctttcag ggttatgcgt tgttccatac aacctcctta gtacatgcaa ccattatcac 360

cgccagaggt aaaatagtca acacgcacg 389

<210>4

<211>681

<212>DNA

＜213〉Dsred encoding sequence (Discosoma striata)

<400>4

atggtgcgct cctccaagaa cgtcatcaag gagttcatgc gcttcaaggt gcgcatggag 60

ggcaccgtga acggccacga gttcgagatc gagggcgagg gcgagggccg cccctacgag 120

ggccacaaca ccgtgaagct gaaggtgacc aagggcggcc ccctgccctt cgcctgggac 180

atcctgtccc cccagttcca gtacggctcc aaggtgtacg tgaagcaccc cgccgacatc 240

cccgactaca agaagctgtc cttccccgag ggcttcaagt gggagcgcgt gatgaacttc 300

gaggacggcg gcgtggtgac cgtgacccag gactcctccc tgcaggacgg ctgcttcatc 360

tacaaggtga agttcatcgg cgtgaacttc ccctccgacg gccccgtaat gcagaagaag 420

accatgggct gggaggcctc caccgagcgc ctgtaccccc gcgacggcgt gctgaagggc 480

gagatccaca aggccctgaa gctgaaggac ggcggccact acctggtgga gttcaagtcc 540

atctacatgg ccaagaagcc cgtgcagctg cccggctact actacgtgga ctccaagctg 600

gacatcacct cccacaacga ggactacacc atcgtggagc agtacgagcg caccgagggc 660

cgccaccacc tgttcctgta g 681

<210>5

<211>282

<212>DNA

＜213〉rrnBT1T2 terminator sequence (E.coli)

<400>5

catgagcgga tacatatttg aatgtattta gaaaaataaa caaagagttt gtagaaacgc 60

aaaaaggcca tccgtcagga tggccttctg attcctttga tgcctggcag tttatggcgg 120

gcgtcctgcc cgccaccctc cgggccgttg cttcgcaacg ttcaaatccg ctcccggcgg 180

atttgtccta ctcaggagag cgttcaccga caaacaacag ataaaacgaa aggcccagtc 240

tttcgactga gcctttcgtt ttatttgatg cctggcagtt gg 282

<210>6

<211>929

<212>DNA

＜213〉ampicillin resistance gene encoding sequence (E.coli)

<400>6

cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca 60

taaccatgag tgataacact gcggccaact tacttctgac aacgatcggg aggaccgaag 120

gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa 180

ccggatctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg 240

gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa 300

ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg 360

gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt 420

gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac gacggggagt 480

caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag 540

cattggtaac tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat 600

ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct 660

taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct 720

tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca 780

gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc 840

agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc 900

aagaactctg tagcaccgcc tacatacct 929

<210>7

<211>122

<212>DNA

＜213〉pMB1 ori sequence

<400>7

gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc 60

aacctctgac ttgagcgtcg attttgtgat gctcgtcagg ggggcggagc ctatggaaaa 120

ac 122

<210>8

<211>1098

<212>DNA

＜213〉OPH encoding sequence (Flavobacterium sp.)

<400>8

tcatgacgcc cgcaaggtcg gtgacaagaa ccgcgccggg ttagtcacag tgatgcctgc 60

cagcgtttcc tgtgggacgc ccttctctcg taggaatggg atcactctca gtggaatgaa 120

ggccatcccg tcggggttca cgcgatccat cacgtccatg atgttggtga catagctcga 180

aaacccgaac agccagtcat tcgaaacgag gatttgtttc atgtagcctt ggtcgatgag 240

cgccttgatc aagagagccc gtgtttgcca cgaacggatg cccaggaggg ctgatgcact 300

cgcattatct tctagaccaa tcgcactgtg cgggatgtgg tctagaccga tgaggtatcc 360

gcgcgcagcg agggcggtga gatagctcaa atcgtcagta tcatcgctgt gaccaataca 420

aacccgtgag gggctcaagc cttcggactc aaaaatggcg gcctgctgct caccatcgcg 480

ctgacttgct gccgtgtgag tggttaccgg aacaccggtg gccaagctgg cccgggcggc 540

cgcctttaac actaactcct gaaagggggt cgccttgcct gtggtcgcga ccttgataat 600

gcccgcccta attccggtgt ctttgatgcc atattgaatc tcacgcagga agaactgtgt 660

gagttcctct acactcctca atcgcatcga aagtggcggg tcgaaccaca agccggtcgc 720

cgccacgata tgaacgtcgg cagcccgcga aacctcggcc aataaactga cgtcgcgacc 780

gatatcgaaa gtcgacacat cgacaatcgt tcgcacgcca gccgctctgg cgcggcgcaa 840

tcctctcaca gccttttccg ctagagcttt gcggctaccg aagaactctg gccaagcacg 900

caagaatcct gccgagctgc cgcagatgtg ctcgtgagtc agtgtgaaac ccgcttcaga 960

gattgtgata ggaccgcgca cggtattgat ccgatcgcct gtgccgatcg atccagccac 1020

gctcgcgcac ccagccaggc cgccgagcag agttcctgcg gcggccgcag acttgagcac 1080

aacccttctc gtttgcat 1098

Claims (6)

1. double gene expression plasmid, it can give expression to two kinds of foreign genes simultaneously, and this expression plasmid comprises two groups of P _RP _LPromotor, control is positioned at the expression of two kinds of foreign genes in its downstream respectively; Described P _RP _LBe warm start that is controlled by temperature sensitive repressor cIts857 that derives from lambda particles phage, the base sequence of described double gene expression plasmid is shown in SEQ.ID.NO 1.

2. the bacterial strain that comprises the described double gene expression plasmid of claim 1, the starting strain of described bacterial strain are E.Coli BL21AI.

3. bacterial strain according to claim 2 is characterized in that, the deposit number of described bacterial strain is CGMCC No.2881.

4. the cell liquid culture that is prepared by claim 2 or 3 described bacterial strains.

5. the whole-cell protein liquid that is prepared by claim 2 or 3 described bacterial strains.

6. the purposes of protokaryon double gene expression plasmid claimed in claim 1 in transforming the bacterial strain do not express the temperature sensitive repressor, the starting strain of described bacterial strain is E.Coli BL21AI.

Images