CN101993881A - Method for constructing engineered strain of filamentous fungi with high oleic acid yield - Google Patents
Method for constructing engineered strain of filamentous fungi with high oleic acid yield Download PDFInfo
- Publication number
- CN101993881A CN101993881A CN 201010162005 CN201010162005A CN101993881A CN 101993881 A CN101993881 A CN 101993881A CN 201010162005 CN201010162005 CN 201010162005 CN 201010162005 A CN201010162005 A CN 201010162005A CN 101993881 A CN101993881 A CN 101993881A
- Authority
- CN
- China
- Prior art keywords
- vefad
- gene
- expression vector
- restriction enzyme
- montana
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a method for constructing an engineered strain of filamentous fungi with high oleic acid yield. Antisense vernicia montana VeFAD2 genes are constructed on an expression vector Pbi121 plasmid which serves as a basic skeleton, reversely connected to the vector and reversely transferred into rhizopus arrhizus by an agrobacterium medication method to change the components of fatty acids and improve oleic acid content. The method comprises the following steps of: (1) obtaining a restriction enzyme cutting site-containing full-length sequence of a vernicia montana VeFAD2 gene cDNA coding area; (2) constructing a VeFAD2 antisense expression vector; (3) obtaining an agrobacterium transformant; and (4) obtaining the rhizopus arrhizus engineered strain. The method has the advantages that: the VeFAD2 genes separated from the total RNA of vernicia montana seeds are constructed onto the expression vector pBI121, and are reversely transferred into the rhizopus arrhizus by the agrobacterium medication method to realize the highly-efficient expression of plant fatty acid synthesis genes in yeasts and improve the oleic acid content of fat and oil.
Description
Technical field
The present invention relates to the genetically engineered field, belong to the construction method of gene engineering strain method, be specifically related to the construction process of the oleic filamentous fungus engineering strain of a kind of high yield.
Background technology
Be the oil crisis that reply grows in intensity, new energy development strategy is actively being formulated and implemented in countries in the world all, wishes may search out new oil substitutes by approach by various, and biofuel is one of them.The raw material of production biofuel at present, mainly depends on oil crops, woody oleiferous plants artificial forest, animal tallow and waste grease etc.From the oil plant trees, extract grease, have a series of restraining factors such as the area of occupying cultivated land, cycle length, cost height.The development animal grease faces a series of restraining factors too.Therefore, open up new plant-sourced grease production approach, particularly the suitability for industrialized production approach is significant to the demand that satisfies ever-increasing biofuel.
Discover that except that higher plant and animal capable production grease, the low microorganism of waiting also can produce grease, the lipid acid of most of microbial oil is formed similar with general vegetables oil.Microorganism cells oil-containing 2～3% only generally, but under optimum conditions, the grease that certain micro-organisms produces and stores accounts for more than 20% of its biological total amount, has all found the greasy bacterial strain of product in known bacterium, yeast, mould and algae.It is very fast that mould is that filamentous fungus breeds in the mode of mycelia, utilizes filamentous fungus to produce lipid acid as bio-reactor, for a new technological approaches has been opened up in biodiesel raw material production.When filamentous fungus produced grease, it was fast to have propagation, and growth cycle is short, was fit to batch production production, and less input, and results are stable, be not subjected to environmental influences such as season, weather, and do not consume chemical fertilizer and agricultural chemicals, thereby environmental pollution alleviates.But at present filamentous fungus exists oil yield rate low, and lubricant component is formed complicated, with the ingredient requirement of production high-quality biofuel still be distance greatly.The utilization Protocols in Molecular Biology, the vegetable fatty acid synthesis related gene is particularly controlled the gene that produces fat amount and lipid acid quality to import in the filamentous fungus, make up high-quality " engineering strain ", make vegetation fat acid synthase gene efficiently expressing in the fungal cell, increase fungi and produce the fat amount, improve and control lipid acid composition.The new mode of this kind can fundamentally solve fungi and produce the defective that fat bacterium oil is poor, oil yield rate is low, can give full play to the advantage that filamentous fungus is suitable for bio-reactor fermentation and woods source high-quality fatty acid synthetase again.
Δ 12 fatty acid desaturation enzymes (claim oleic acid dehydrogenase again, are called for short FAD
2) be one of key enzyme in the desaturation reaction, (Δ 9) dehydrogenation in 18: 1 of its catalysis oleic acid forms linolic acid 18: 2 (Δ 9,12), introduces the 2nd two key in carbochain.The biomass energy seeds Aleurites montana (Vernicia Montana) that China south extensively distributes has the high characteristic of lipid acid combined coefficient, and VeSAD is cloned in this laboratory from the developmental seed of Aleurites montana
2Gene is with Aleurites montana VeSAD
2The yeast genes group that oppositely imports gene can suppress yeast self VeSAD
2Expression of gene, thus linoleic content in the yeast grease reduced, and the specification of quality that meets biofuel for the yeast produce oil lays the foundation.
Summary of the invention
The present invention will solve the shortcoming of above-mentioned prior art, and the construction process of the oleic filamentous fungus engineering strain of a kind of high yield is provided, antisense Aleurites montana VeFAD
2Gene constructed on expression vector pBI121 plasmid, be basic framework with pBI121, with Aleurites montana VeFAD
2Gene oppositely is connected on this carrier, its building process such as Fig. 1.Adopt agrobacterium-mediated transformation with VeFAD
2After gene oppositely changes rhizopus arrhizus over to, can change fatty acid component and improve oleic acid content, the name of this bacterial strain is called Rhizopus arrhizusVeFAD2-1, is kept at ornamental plant study group of Inst. of Subtropical Forestry, Chinese Academy of Forestry Sciences laboratory.
The present invention solves the technical scheme that its technical problem adopts: the construction process of the oleic filamentous fungus engineering strain of this high yield, contain Aleurites montana VeFAD in the filamentous fungus genome
2Expression casette, this expression cassette contain CaMV35S promotor, Aleurites montana VeFAD successively
2Sequence, terminator codon, described filamentous fungus is a rhizopus arrhizus; The step of this method is as follows:
(1), contains restriction enzyme site Aleurites montana VeFAD
2Gene cDNA encoding district full length sequence obtains
According to Aleurites montana VeFAD
2Gene (the GenBank accession number is EF152993) nucleotide sequence design primer is a template with the total RNA of Aleurites montana immature seed, through the RT-PCR amplification, at VeFAD
2Xbal I restriction enzyme site is introduced in the upstream, and BamH I restriction enzyme site is introduced in the downstream, and electrophoresis reclaims VeFAD
2Gene cDNA fragment is cloned into pGEM T-Easy carrier, transformed into escherichia coli DH5 α, and order-checking, naming this carrier is pGEM-T-Vefad2;
(2), VeFAD
2Antisense expression vector makes up
Restriction site map in conjunction with expression vector pBI121, select for use two positions of Xbal I and BamH I to be used as inserting the segmental restriction enzyme site of purpose, the primer of design band Xbal I and BamH I restriction enzyme site is that template is carried out the PCR reaction with cloning vector plasmids pGEM-T-XBfad2; Amplified production is all used Xbal I and BamH I double digestion with expression vector pCAM2300; Reclaim corresponding fragment respectively, use T
4Dna ligase connects, Transformed E .coli DH 5 α competent cells.The extraction plasmid carries out enzyme and cuts evaluation.Expression vector called after pBI-fad2;
(3) acquisition of Agrobacterium-mediated Transformation
Employing is frozen molten method with recombinant expression vector pBI-fad2 agrobacterium strains EHA105, AGL-1;
(4), the acquisition of rhizopus arrhizus engineering strain
Adopt agrobacterium-mediated transformation, activation contains the Agrobacterium of recombinant expression vector, cultivates altogether with rhizopus arrhizus bacterium liquid, transfer on the screening culture medium that contains kantlex, acquisition has the transformant of kalamycin resistance, through PCR and Southern Molecular Identification, shows Aleurites montana VeFAD
2Gene has inserted in the genome of rhizopus arrhizus.Detect through lubricant component, the oleic acid of this bacterial strain accounts for 42.44% of total oil content amount, and comparison is according to having improved 26.99%.
The effect that the present invention is useful is: the present invention will be from the total RNA of Aleurites montana seed isolating VeFAD
2Gene constructed to expression vector pBI121, and adopt agrobacterium-mediated transformation with VeFAD
2Gene oppositely imports rhizopus arrhizus, and the vegetable fatty acid synthetic gene is efficiently expressed in yeast, has improved oleic content in the grease, is fit to the requirement of biofuel more, for biodiesel raw material production provides a kind of efficient high-quality engineering strain.
Description of drawings
Fig. 1: plasmid pBI-fad2 building process synoptic diagram of the present invention;
Embodiment
The invention will be further described below in conjunction with drawings and Examples:
1 experiment material
1.1 vegetable material
Take the developmental fruit of Aleurites montana from subtropics forestry institute of China Forestry Science Research Institute arboretum, seed is stripped out in liquid nitrogen after the quick-frozen-80 ℃ of refrigerators preserve standby.
1.2 bacterial strain and plasmid
Rhizopus arrhizus (Rhizopus arrhizus) is available from DSMZ of Institute of Microorganism, Academia Sinica, and intestinal bacteria E.coli DH5 α, agrobacterium tumefaciens EHA 105, AGL-1 preserve for this laboratory.Plasmid pBI121 preserves for this laboratory, and cloning vector pGEM-T Easy is available from Promega company.
1.3 main biochemical reagents
RNA extracts test kit available from pool, sky genetically engineered company limited (Mianyang, Sichuan); EDNA synthetic agent box, IPTG, X-gal, give birth to worker's biotechnology company limited available from Shanghai; Plasmid extraction kit, DNA glue purification reclaim test kit available from vast Tyke, Beijing biological gene technology limited liability company; Intestinal bacteria E.coli DH5 α competent cell, T
4Ligase enzyme, restriction enzyme are available from precious biotechnology (Dalian) company limited.Primer is synthetic and the order-checking of bacterium liquid gives birth to worker biotechnology company limited by Shanghai respectively and associating genome company in Shanghai finishes, and fatty acid component mensuration is cultivated emphasis opening experiment chamber by the subtropics forest and finished.
1.4 substratum preparation
LB substratum (gL
-1): peptone 10, yeast extract paste 5, sodium-chlor 10 is transferred pH to 7.0.
YPD substratum (component gL
-1): peptone 20, yeast extract paste 10, glucose 20, natural pH.
SM substratum (selection substratum) (gL
-1): yeast nitrogen base 6.70, glucose 20 is transferred pH to 6.0.
MM (component gL
-1): K
2HPO
42.2822, KH
2PO
41.3609 NaCl 0.146, MgSO
47H
2O 0.49294,
CaCl
2?0.077693，FeSO
4·7H
2O?0.0025021，(NH
4)
2SO
4?0.52856，C
6H
2O
6?1.9817。
IM (inducing culture): on the basis of MM liquid nutrient medium, add 40mM MES, transfer pH to 5.3, then
The glycerine (W/V) of adding 5%, 115 ℃ of sterilization 30min.Add agar 0.8-1% before the solid medium sterilization.
YEPD substratum (seed culture medium) (gL
-1): glucose 20, yeast powder 10, peptone 10, natural pH.
Fermention medium (gL
-1): glucose 80, (NH
4)
2SO
43.0, MgSO
47H
2O 3.0, KH
2PO
42.0, pH5.5-6.0
2 experimental techniques
2.1 the total RNA of seed extracted during Aleurites montana grew
(1) liquid nitrogen grinding smudge cells is got in the extremely new centrifuge tube of fine powder about about 100mg;
(2) add the vibration of 1mL solution A and mix 30s;
(3) add 0.3mL solution B and 0.2mL chloroform, the vibration mixing;
(4) the centrifugal 13000g of room temperature, 5min gets supernatant (about 0.8mL) and moves in the new centrifuge tube;
(5) add 0.5mL solution C and 0.2mL chloroform, the vibration mixing;
(6) the centrifugal 13000g of room temperature, 3min gets supernatant (about 950mL) and moves in the new pipe;
(7) add the solution D of 1/2 volume, the vibration mixing;
(8) the centrifugal 13000g of room temperature, 5min forms white precipitate;
(9) add 1mL 75% ethanol vibration mixing, centrifugal 13000g, 3min abandons supernatant;
(10) repeating step 9, are dissolved in after drying up in the pure water of 30uL DEPC processing.
(11) get 2uL quick integrity of the total RNA of electrophoresis detection in 1.0% sepharose.Stand-by in-80 ℃ of preservations.
Solution A-D is the product in the test kit, A: lysis buffer, B: the liquid of phase-splitting for the first time, C: the liquid of phase-splitting for the second time, D:RNA precipitated liquid.
2.2 reverse transcription
Utilization (worker is given birth in Shanghai) the AMV first chain cDNA synthetic agent box is a template with total RNA, synthetic cDNA first chain.Concrete grammar is as follows:
(1) add in the ice bath:
Total RNA 3uL
Downstream Auele Specific Primer 1uL
No RNA enzyme deionized water 3uL
Cumulative volume 7uL
(2) the centrifugal 3～5s of mixing, 70 ℃ of 5min, ice bath 30s
(3) ice bath adds:
5×Reaction?Buffer 4uL
RNA enzyme inhibitors (20U/uL) 1uL
dNTP(10mM) 2uL
(4) mixing is centrifugal, and 37 ℃ of 5min add 1uLM-MLV RT (20U/uL), mixing.
(5) 37 ℃ of 60min; Last 70 ℃ of insulation 10min.
2.3PCR amplification VeFAD2 gene contains restriction enzyme site cDNA coding region total length
According to the VeFAD that on GenBank, logins
2Gene nucleotide and aminoacid sequence design degenerate primer, primer sequence is as follows:
Vefad2?FP：ATA?GGA?TCC?ATG?GGT?GCT?GGT
Vefad2?RP：GCG?TCT?AGA?TCA?GAA?CTT?CCA
Wherein Vefad2FP contain restriction enzyme site Xbal I and, Vefad2RP contains restriction enzyme site BamH I, is template with 2.2 synthetic cDNA, pcr amplification Aleurites montana VeSAD
2The gene cDNA encoding district.Amplification condition is: 94 ℃ of pre-sex change 4min, and 94 ℃ of 30S, 54 ℃ of 30S, 72 ℃ of 1min, 30 circulations, 72 ℃ are extended 10min.Amplified production detects with 1% agarose gel electrophoresis.
2.4 the clone of amplified production and order-checking
2.4.1PCR the recovery of product
With VeFAD
2CDNA reclaims the recovery purifying that test kit (vast Tyke) carries out specific amplification products with the quick glue of Type B miniprep dna segment, and operation steps is as follows:
(1) electrophoresis in 1.0% sepharose separates amplified production and forms special band;
(2) downcutting the purpose band puts in the centrifuge tube;
(3) add the 700uL sol solutions, 55 ℃ of colloidal sols shake therebetween once in a while; The dress post, 12000rpm, centrifugal 30s; Remove waste liquid;
(4) add 500uL rinsing liquid (wash buffer) rinsing, the centrifugal 30s of 12000rpm.Repeat rinsing once.Outwell behind the waste liquid again in the centrifugal 2min of 12000rpm;
(5) elution buffer (Elution buffer) or the water of adding 45uL, room temperature is placed 2min, and 12000rpm is centrifugal.Pipe end solution is the purpose segment of recovery.
2.4.2 reclaim the connection and the conversion of product
Reclaim product and be connected on the pGEM T-Easy carrier, connect the test kit specification sheets according to the pGEM-T Easy of Promega company and operate.Conversion is carried out according to the biological E.coli DH 5 α competence method for transformation of treasured.
(1) the PCR product that will reclaim purifying is connected on the pGEM-T Easy carrier, adds following ingredients in centrifuge tube respectively: reclaim product 4uL; T carrier 1uL; 2 * T
4Buffer 5uL; T
4Dna ligase (3U/uL) 1uL; Centrifugal collecting managed the end, 16 ℃ of connections of spending the night behind the mixing gently.
(2) from-80 ℃ of refrigerators, get the 100uL competent cell, put immediately on ice after thawing under the room temperature;
(3) add 5uL and connect product, mixing, ice bath 30min;
(4) 42 ℃ of water-bath thermal shock 90s place cooled on ice 3～5min rapidly;
(5) Xiang Guanzhong adds 1mL LB liquid nutrient medium (not containing Amp), and 37 ℃ of shaking culture 1h behind the mixing make bacterium the restore normal growth state and the antibiotics resistance gene (Amp of expression plasmid coding
r);
(6) get that 200uL adds 40uL X-gal and 4uL IPTG mixes after above-mentioned bacterium liquid is shaken up, coat on the screening flat board that contains Amp.Be inverted incubated overnight for 37 ℃.
(7) white colony is a recon.
2.4.3 plasmid DNA is extracted
5mL is contained Amp (50mg/L) LB liquid nutrient medium join in the little triangular flask of 50mL, the single bacterium colony 37 of picking white
℃Shaken overnight.Plasmid extracts the method for describing according to vast Imtech test kit to carry out.
(1) get the bacterium liquid of 1-3mL incubated overnight in the LB substratum, the centrifugal 30s of 12000rpm abandons most supernatant.
(2) solution I that has added RNaseA with the 250uL bacterial precipitation that evenly suspends, room temperature is placed 5min;
(3) add the 250uL solution II, gentleness spins upside down mixing 4-6 time, makes the abundant cracking of thalline;
(4) add the 350uL solution III, spin upside down mixing 6-8 time, the centrifugal 10min of 12000rpm;
(5) draw centrifugal supernatant and transfer to DNA and prepare in the pipe the centrifugal 1min of 12000rpm;
(6) will prepare pipe and put back to centrifuge tube, add the Buffer W1 of 500uL, the centrifugal 1min of 12000rpm; Abandon filtrate;
(7) will prepare pipe and put back to centrifuge tube, add the Buffer W2 of 700uL, the centrifugal 1min of 12000rpm; Abandon filtrate; Repeated washing once.
(8) will prepare pipe and move in the new centrifuge tube, and add 40-60uL water in the film centre, room temperature leaves standstill 1min; The centrifugal 1min of 12000rpm.With results recombinant plasmid in-20 ℃ of preservations.
2.4.4 the enzyme of plasmid is cut evaluation
According to the collection of illustrative plates of pGEM T-Easy carrier, select for use EcoR I restriction enzyme that the plasmid that extracts is identified.Enzyme is cut the bacterium liquid of the positive colony correspondence of evaluation, be sent to connection polygene science and technology research institute of Shanghai associating gene group company order-checking portion and check order.Naming this carrier is pGEM-T-Vefad2, breeds intestinal bacteria E.coli DH 5 α that contain this carrier and extract just this carrier of energy mass production of plasmid then in the liquid LB substratum that adds Amp.
2.5 containing the VeFAD2 expression carrier makes up
With pGEM-T-XBfad2 and expression vector pBI121 Xbal I and BamH I double digestion.Reclaim corresponding fragment respectively, connect, Transformed E .coli DH 5 α competent cells with the T4DNA ligase enzyme.Bacterium liquid is coated on the LB flat board that contains Kan, is inverted overnight incubation for 37 ℃.Alkaline process extracts plasmid DNA, and the double digestion plasmid verifies whether correct the purpose fragment is inserted.Expression vector called after pBI-fad2, total length 15910bp is characterized in that contained VeFAD
2Gene can be expressed in plant, fungi, breeds intestinal bacteria E.coli DH 5 α that contain this carrier and extract just this carrier of energy mass production of plasmid then in the liquid LB substratum that adds Kan.
2.6 expression vector transforms Agrobacterium
Adopt freeze-thaw method, expression vector pBI-fad2 is imported among agrobacterium tumefaciens EHA105, the AGL-1.
(1) gets the 200uL competent cell, add 10uL expression vector plasmid, ice bath 30min;
(2) quick-frozen 5min in the liquid nitrogen places 37 ℃ of water-bath 5min rapidly;
(3) behind the ice bath 5min, add 800uL LB liquid nutrient medium, be coated on behind 28 ℃ of cultivations of 180rpm 3h and contain on the corresponding antibiotic LB solid plate, cultivated 1-2 days for 28 ℃.
(4) select single bacterium colony incubated overnight in containing corresponding antibiotic LB liquid nutrient medium, alkaline process extracts the Agrobacterium plasmid DNA.
(5) be template with corresponding bacterium liquid and plasmid DNA, carry out PCR and identify, judge whether the purpose fragment is inserted on the expression vector.The PCR reaction conditions is with reference to 2.3.
Show that through electrophoresis detection 2 Agrobacteriums have all imported expression vector plasmid pBI-fad2.
2.7 activation of Agrobacterium and pre-the cultivation
The mono-clonal bacterium colony (all containing plasmid vector pBI-fad2) of picking agrobacterium tumefaciens AGL-1 or EHA105 from the LB flat board, be inoculated in the LB liquid nutrient medium and (contain the 50ug/ml kantlex, the 50ug/ml Rifampin), 180r/min, 28 ℃ of overnight incubation, centrifugal collection thalline with the resuspended thalline of isopyknic IM inducing culture liquid, continues to shake the pre-4-5h to OD of cultivation of bottle
660Be about 0.6.
2.8 the preparation of fungal spore suspension
Wash fungal spore with sterile distilled water from the PDA slant medium of cultivating 5-7d, three layers of lens wiping paper filter, with an amount of distilled water diluting to OD
660(the blood counting chamber counting, spore concentration is about 1.0 * 10 to be about 0.45
7Individual/mL).
2.9 cultivate altogether
Drawing 50ul agrobacterium tumefaciens bacterium liquid mixes with 200ul rhizopus arrhizus spore suspension, only draw the mixed solution of 10ul, join in the IM inducing culture liquid of 100ul and dilute, after mixing, diluent all is coated on the IM solid medium that is covered with millipore filtration (contains 200umol/L AS), 28 ℃ of dark 24h that cultivate.
2.10 the screening of transformant
Filter membrane is transferred on the selection substratum SMI flat board (containing certain density selective agent and fungistat), behind 28 ℃ of dark cultivation 24h, picking resistance mycelia is transferred on the selection substratum SMII that contains the greater concn selective agent at random, continues screening to occurring the resistance bacterium colony once more.
2.11 the PCR Rapid identification of transformant
Resistance bacterium colony on the picking SM II is inoculated in the YEPD liquid nutrient medium at random, 180r/min, and 28 ℃ of overnight incubation are collected thalline, adopt the Benzyl Chloride method to extract the transformant genomic dna, and carry out VeFAD
2Can the pcr amplification of gene (reaction system and reaction conditions are with 2.3) obtain specific fragment and judge tentatively whether goal gene changes in the rhizopus arrhizus according to increasing.
2.10 the PCR-Southern of transformant identifies
Pcr amplification reclaims purifying VeFAD with 2.3
2Amplified production, as negative control, expression vector plasmid pBI-fad2 carries out agarose gel electrophoresis as positive control with unconverted wild bacterium.Press DIG High Prime DNALabeling and Detection Starter KitII operation steps probe mark, commentaries on classics film, the hybridization of Roche company, the analysis of developing at last.Results of hybridization shows Aleurites montana VeFAD
2Gene has been incorporated in the rhizopus arrhizus genome.
2.11 the fermentation culture of transgenosis produce oil fat rhizopus arrhizus
Picking is stored in a small amount of mycelia or the spore on inclined-plane, cultivates 3-5d for 28 ℃ on the PDA slant medium, until growing a large amount of spores.Draw respectively in the liquid seed culture medium that 50 μ l insert 50ml with the spore on the aseptic water washing inclined-plane and with liquid-transfering gun, in 28 ℃, 180r/min shaking culture 24h.Then seed liquor is inoculated in the 250ml triangular flask that fermention medium is housed in 10% ratio, the triangular flask liquid amount is and is 100ml, in 28 ℃, and 180r/min shaking culture 144h.
2.12 grease extracts and fatty acid component is measured
Grease extraction and application acid heat method is extracted grease, and potassium hydroxide-methyl alcohol room temperature esterification process is adopted in fatty esterification, and oil fatty acid is formed and the gas chromatographic analysis of relative content is measured on Agilent 6890N gas chromatograph.
Measurement result shows, changes Aleurites montana VeFAD
2The oleic acid content of the rhizopus arrhizus bacterial strain of gene all is higher than unconverted wild type strain, and average content is 38.13%, and high-content is 42.44%, and comparison is according to having improved 26.99%.
In addition to the implementation, the present invention can also have other embodiments.All employings are equal to the technical scheme of replacement or equivalent transformation formation, all drop on the protection domain of requirement of the present invention.
SEQUENCE?LISTING
＜110〉Inst. of Subtropical Forestry, Chinese Academy of Forestry Sciences
＜120〉construction process of the oleic filamentous fungus engineering strain of a kind of high yield
＜130〉do not have
<140>
<141>
<160>2
<210>1
<211>21
<212>DNA
＜213〉artificial sequence
<221>misc_feature
＜223〉primer
<400>1
ATAGGATCCATGGGTGCTGGT
<210>2
<211>21
<212>DNA
＜213〉artificial sequence
<221>misc_feature
＜223〉primer
<400>2
GCGTCTAGATCAGAACTTCCA
Claims (3)
1. the construction process of the oleic filamentous fungus engineering strain of high yield is characterized in that: contain Aleurites montana VeFAD in the filamentous fungus genome
2Expression casette, this expression cassette contain CaMV35S promotor, Aleurites montana VeFAD successively
2Sequence, terminator codon, described filamentous fungus is a rhizopus arrhizus; The step of this method is as follows:
(1), contains restriction enzyme site Aleurites montana VeFAD
2Gene cDNA encoding district full length sequence obtains
According to Aleurites montana VeFAD
2Gene nucleotide series design primer is a template with the total RNA of Aleurites montana immature seed, through the RT-PCR amplification, at VeFAD
2Xbal I restriction enzyme site is introduced in the upstream, and BamH I restriction enzyme site is introduced in the downstream, and electrophoresis reclaims VeFAD
2Gene cDNA fragment is cloned into pGEM T-Easy carrier, transformed into escherichia coli DH5 α, and order-checking, naming this carrier is pGEM-T-Vefad2;
(2), VeFAD
2Antisense expression vector makes up
Restriction site map in conjunction with expression vector pBI121, select for use two positions of Xbal I and BamH I to be used as inserting the segmental restriction enzyme site of purpose, the primer of design band Xbal I and BamH I restriction enzyme site is that template is carried out the PCR reaction with cloning vector plasmids pGEM-T-XBfad2; Amplified production is all used Xbal I and BamH I double digestion with expression vector pCAM2300; Reclaim corresponding fragment respectively, use T
4Dna ligase connects, Transformed E .coli DH 5 α competent cells.The extraction plasmid carries out enzyme and cuts evaluation.Expression vector called after pBI-fad2;
(3) acquisition of Agrobacterium-mediated Transformation
Employing is frozen molten method with recombinant expression vector pBI-fad2 agrobacterium strains EHA105, AGL-1;
(4) acquisition of rhizopus arrhizus transformant
Adopt agrobacterium-mediated transformation with VeFAD
2Oppositely import the rhizopus arrhizus genome, obtained commentaries on classics Aleurites montana VeFAD
2The rhizopus arrhizus engineering strain of gene.
2. the construction process of the oleic filamentous fungus engineering strain of high yield according to claim 1 is characterized in that: pcr amplification VeFAD2 gene contains restriction enzyme site cDNA coding region total length, according to the VeFAD that logins on GenBank
2Gene nucleotide and aminoacid sequence design degenerate primer, primer sequence is as follows:
Vefad2FP：ATA?GGA?TCC?ATG?GGT?GCT?GGT
Vefad2RP：GCG?TCT?AGA?TCA?GAA?CTT?CCA
Wherein Vefad2FP contains restriction enzyme site Xbal I, and Vefad2 RP contains restriction enzyme site BamH I, is template with synthetic cDNA, pcr amplification Aleurites montana VeSAD
2The gene cDNA encoding district; Amplification condition is: 94 ℃ of pre-sex change 4min, and 94 ℃ of 30S, 54 ℃ of 30S, 72 ℃ of 1min, 30 circulations, 72 ℃ are extended 10min; Amplified production detects with 1% agarose gel electrophoresis.
3. the construction process of the oleic filamentous fungus engineering strain of high yield according to claim 1 is characterized in that: described Aleurites montana VeFAD
2The oleaginous yeast expression vector pBI-fad2 of gene has oppositely inserted Aleurites montana VeFAD
2Gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010162005 CN101993881A (en) | 2010-04-08 | 2010-04-08 | Method for constructing engineered strain of filamentous fungi with high oleic acid yield |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010162005 CN101993881A (en) | 2010-04-08 | 2010-04-08 | Method for constructing engineered strain of filamentous fungi with high oleic acid yield |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101993881A true CN101993881A (en) | 2011-03-30 |
Family
ID=43784634
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010162005 Pending CN101993881A (en) | 2010-04-08 | 2010-04-08 | Method for constructing engineered strain of filamentous fungi with high oleic acid yield |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101993881A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509817A (en) * | 2013-09-16 | 2014-01-15 | 中国林业科学研究院亚热带林业研究所 | Construction method and application of high-yield oil and linoleic acid genetically-engineered bacterium of Rhodotorula glutinis |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101210242A (en) * | 2006-12-29 | 2008-07-02 | 河南农业大学 | Highly effective expression method for peanut delta12 fatty acid dehydrogenase gene |
-
2010
- 2010-04-08 CN CN 201010162005 patent/CN101993881A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101210242A (en) * | 2006-12-29 | 2008-07-02 | 河南农业大学 | Highly effective expression method for peanut delta12 fatty acid dehydrogenase gene |
Non-Patent Citations (2)
| Title |
|---|
| 《中国优秀硕士学位论文全文数据库（基础科学辑）》 20090415 范妙华 千年桐硬脂酸脱饱和酶_油酸脱氢酶基因克隆及真菌遗传转化研究 17-40 1-3 , 第4期 2 * |
| 《中国优秀硕士学位论文全文数据库（基础科学辑）》 20100115 刘明靖 反义千年桐油酸脱氢酶基因在产油真菌少根根霉中的遗传转化研究 16-19 1-3 , 第1期 2 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509817A (en) * | 2013-09-16 | 2014-01-15 | 中国林业科学研究院亚热带林业研究所 | Construction method and application of high-yield oil and linoleic acid genetically-engineered bacterium of Rhodotorula glutinis |
| CN103509817B (en) * | 2013-09-16 | 2015-09-09 | 中国林业科学研究院亚热带林业研究所 | The construction process of a kind of rhodotorula glutinis height Lipid-producing and linolic acid genetic engineering bacterium and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dexter et al. | Metabolic engineering of cyanobacteria for ethanol production | |
| CN101481695B (en) | Improved Rhizomucor miehei lipase gene and use thereof in yeast display | |
| CN103849576A (en) | Recombined saccharomyces cerevisiae strain with stress tolerance | |
| CN104593407B (en) | Pichia stipitis gene expression system and its structure and application | |
| CN101974441A (en) | Alpha-glucosidase genetic engineering bacterium and application thereof | |
| CN107937297A (en) | Mortifier stress tolerance saccharomyces cerevisiae more than one plant and preparation method, application | |
| CN107937296B (en) | Recombinant saccharomyces cerevisiae with acetic acid, furfural and vanillin tolerance, and preparation method and application thereof | |
| CN111088177B (en) | Construction and application of heat-resistant yeast engineering bacteria for producing glycerol under high-temperature aerobic condition | |
| CN101892250A (en) | Method for constructing cryptococcus albidus engineering bacterial strain for producing oleic acid in high yield | |
| CN103131720A (en) | Fungi xylose isomerase gene and application thereof | |
| CN115806922B (en) | Genetically engineered strain of zymomonas mobilis and application thereof | |
| CN114561303B (en) | Trichoderma reesei engineering strain secreting high-performance cellulase and application thereof | |
| CN101993881A (en) | Method for constructing engineered strain of filamentous fungi with high oleic acid yield | |
| CN105062906B (en) | A kind of production method optimizing organophosphor hydrolytic enzyme Yeast engineering bacteria and its enzyme | |
| CN103088434B (en) | Construction method and application of Pichia stipitis large-fragment DNA (deoxyribonucleic acid) genome library | |
| CN111893107A (en) | Pichia pastoris engineering strain for heterologous expression of cellulase gene EG IV and application | |
| CN114015634B (en) | Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof | |
| CN101665802A (en) | Oil-producing yeast expression vector utilizing Zeocin to screen aleurites montana SAD genes and construction method | |
| CN101514351A (en) | Method for preparing free fatty acid by using engineering colon bacillus | |
| CN112779174B (en) | Saccharomyces cerevisiae genetically engineered bacterium for knocking out Cln3 gene, construction method and application thereof | |
| CN104630257B (en) | One plant can utilize the expression system of the yeast Spathaspora passalidarum of xylose | |
| CN115851569B (en) | Sport zymomonas for co-production of lactic acid and ethanol by using non-grain biomass and application thereof | |
| CN116716321B (en) | Application of HMX1 and encoding gene thereof in improving fermentation performance and acetic acid tolerance of saccharomyces cerevisiae xylose | |
| CN107815461A (en) | Rumen Fungi xylose isomerase gene and its application | |
| CN114854607B (en) | High-temperature-resistant saccharomyces cerevisiae, fermenting agent, application of high-temperature-resistant saccharomyces cerevisiae and fermenting agent, and ethanol production method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20110330 |