CN101988037A - Monascus purpureus with antiseptic function - Google Patents
Monascus purpureus with antiseptic function Download PDFInfo
- Publication number
- CN101988037A CN101988037A CN 201010529973 CN201010529973A CN101988037A CN 101988037 A CN101988037 A CN 101988037A CN 201010529973 CN201010529973 CN 201010529973 CN 201010529973 A CN201010529973 A CN 201010529973A CN 101988037 A CN101988037 A CN 101988037A
- Authority
- CN
- China
- Prior art keywords
- purplish red
- monascus purpureus
- red aspergillus
- aspergillus
- food
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Coloring Foods And Improving Nutritive Qualities (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Food Preservation Except Freezing, Refrigeration, And Drying (AREA)
Abstract
The invention discloses monascus purpureus with antiseptic function, and belongs to the field of microbes. The invention aims to provide a monascus purpureus strain which has good bacteriostatic and antiseptic functions while keeping the original coloring function and has inhibiting effect on the common bacillus subtilis, Escherichia coli and saccharomycetes in food. The monascus purpureus with the antiseptic function is monascus purpureus W5S7 and collected in China General Microbiological Culture Collection Center, and the collection number is CGMCC No.4174. The monascus purpureus lays a foundation for application of biological preservatives in the antiseptic field of the food.
Description
Technical field
The invention belongs to microorganism field, be specifically related to a kind of purplish red aspergillus.
Background technology
In field of meat product processing, Sodium Nitrite is the foodstuff additive that are most widely used, and the effect that it has sanitas and toner is widely used in animal foods such as cold cuts class, bowel lavage class and can.But Sodium Nitrite has toxicity, and it can be oxidized to methemoglobin with the low Ferri-hemoglobin in the blood, makes it lose the ability of transportation oxygen and causes the histanoxia infringement, and human body is taken in 0.2～0.5g can cause food poisoning, and 3g can cause death.And Sodium Nitrite can generate inferior ammonium nitrate under certain condition, and inferior ammonium nitrate then is a carcinogenic substance.Therefore, the consumption of Sodium Nitrite and residual quantity are strictly controlled in the food processing process.In order to improve the quality of meat product, people also can add some auxiliary materials and other additive, and these all may influence the color of product.Along with improving constantly of health of people consciousness, that people seek is natural, safety is also more and more stronger with the hope of sanitas and toner efficiently, and the while, this also was the very important and anxious problem to be solved that the foodstuff additive field is faced.
Purplish red aspergillus (Monascus purpureus) is just on the books to its medicinal health effect in Compendium of Material Medica.In the modern food manufacture field, the research to Monascus anka Nakazawa et sato both at home and abroad concentrates on traditional wine brewing, system vinegar and tinting material field mostly with application.Monascus anka Nakazawa et sato is the microorganism of present unique in the world production food dye, and monascorubin promptly is the red natural pigment that Monascus anka Nakazawa et sato produces in the growth metabolism process.Utilizing purplish red aspergillus (Monascus purpureus) to extract the exquisite red colouring agent for food, also used as a Chinese medicine that forms through liquid submerged fermentation is a kind of pure natural, safe, the foodstuff additive that are of value to HUMAN HEALTH, contain saccharifying enzyme, proteolytic enzyme in the red colouring agent for food, also used as a Chinese medicine, be most commonly used to produce the red bean fermented bean curd, contain the red kojic rice powder of a small amount of decreasing cholesterol and other protective foodss etc.At present, purplish red aspergillus being used for food color having obtained extensive approval, also is its main application direction.But the rare report of its antibacterial preservative activity, though this mainly be because purplish red aspergillus bacteria resistance function is arranged, fungistatic effect a little less than.This shows, if can obtain the purplish red aspergillus of a strain good antimicrobial effect, be applied in the processing of relevant food such as traditional meat product, and then in the consumption that reduces Sodium Nitrite, play tinting material and sanitas dual function, will become an important breakthrough in foodstuff additive field.
Summary of the invention
The purpose of this invention is to provide a kind of purplish red aspergillus bacterial strain, it is when having kept original colouring function, has good antibacterial anti-corrosion function, subtilis common in the food, intestinal bacteria and yeast all there are the inhibition effect, have pure natural, advantage safe, that human body is safe from harm simultaneously.The present invention lays a good foundation in the food antiseptic Application for Field for biological preservative.
The purplish red aspergillus that the present invention has anti-corrosion function is purplish red aspergillus W5S7 (Monascus purpureus W5S7), is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center, and preserving number is CGMCC No.4174.
The purplish red aspergillus W5S7 of the present invention (Monascus purpureus W5S7) belongs to diffusing ascus Zoopagales (Eurotiales) red colouring agent for food, also used as a Chinese medicine Cordycepps (Monascaceae) the red colouring agent for food, also used as a Chinese medicine Pseudomonas (Monascus) of Ascomycota (Ascomycota) Euascomycetes (Euascomecetes), by subtilis common in the food, intestinal bacteria and yeast being carried out the biocidal property test, the result shows that purplish red aspergillus W5S7 all has the obvious suppression effect to above-mentioned several bacterium.
The purplish red aspergillus W5S7 of the present invention behind separation, the purifying, carries out mutagenesis screening through the microwave exposure induced-mutation technique and obtains from the fermented bean curd of Kedong.It is slower that the purplish red aspergillus W5S7 of the present invention goes up colony growth at wort agar substratum (MEA), 7 days colony diameter 18～20mm of 25 ℃ of uv irradiating dark culturing, tawny, gauffer is arranged, the surface flocciform, aerial hyphae is a small amount of: bacterium colony back side tawny, there is not water-soluble pigment.Mycelia is smooth, multi-branched, and tool is separated, and wide 2.5～5.0 μ m have fat to drip.The asexual spore mass production, subsphaeroidal, base portion is truncate, and wall is smooth or slightly coarse, and 5.5～9.0 μ m are born in unspecialized adnation stigma or mycelia top.Cleistothecium forms in a large number, and white singly is born on the short handle of similar mycelia to tawny, diameter 22～50 μ m, and ascus is cleared up in early days, thecaspore oval, subsphaeroidal, wall is smooth, 4.4-5.8 * 4.2-4.7 μ m.The purplish red aspergillus W5S7 of the present invention can well grow and produce spore on PDA substratum and Cha Shi synthetic medium, wherein optimum medium is the PDA substratum.
The fermented liquid of the purplish red aspergillus W5S7 of the present invention with the centrifugal 20min of the speed of 5000r/min, is kept fermented supernatant fluid, will precipitate with 95% ethanol and mix, at ultrasonic oscillator frequency extraction 60min during, again with extracting solution centrifugation, triplicate for 10kHz; Ethanol extract and fermented supernatant fluid are merged, place rotatory evaporator, under the condition of 60 ℃ of revolution 80r/min, vaporization temperature, be concentrated into original volume 1/4, concentrated solution is placed 80 ℃ of air dry ovens, be dried to constant weight, grind into powder promptly makes purplish red aspergillus W5S7 pulvis.The purplish red aspergillus W5S7 pulvis that the present invention makes have make simple, stable in properties, be easy to preserve, advantage with low cost.
Purplish red aspergillus W5S7 of the present invention (Monascus purpureus W5S7) belongs to red colouring agent for food, also used as a Chinese medicine Pseudomonas (Monascus), be deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center, the preservation address is No. 3 institutes of microbiology of the Chinese Academy of Sciences in Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, preservation date is on September 16th, 2010, and preserving number is CGMCC No.4174.
Description of drawings
Fig. 1 is the colonial morphology figure of the purplish red aspergillus W5S7 of the present invention (Monascus purpureus W5S7) bacterial strain on solid medium.
Fig. 2 is the conidium aspect graph of the purplish red aspergillus W5S7 of the present invention (Monascuspurpureus W5S7) bacterial strain.
Fig. 3 is the mycelia and the conidium aspect graph of the purplish red aspergillus W5S7 of the present invention (Monascus purpureus W5S7) bacterial strain.
Fig. 4 be in the embodiment one purplish red aspergillus W5S7 sanitas to the bacteriostatic experiment of Bacillus subtillis figure as a result.
Fig. 5 be in the embodiment one purplish red aspergillus W5S7 sanitas to saccharomycetic bacteriostatic experiment figure as a result.
Fig. 6 be in the embodiment one purplish red aspergillus W5S7 sanitas to colibacillary bacteriostatic experiment figure as a result.
Fig. 7 be in the embodiment one purplish red aspergillus W5S7 sanitas to the staphylococcic bacteriostatic experiment of white figure as a result.
Fig. 8 is the ripe streaky pork after handling with the purplish red aspergillus W5S7 of different concns aqueous preservative solution.
The close bacterial strain constructed phylogenetic tree of Fig. 9 for including among monascus purpureus bacterium W5S7 in the embodiment one and the Genbank.
Figure 10 is monascus purpureus bacterium W5S7 and the gene comparison result that has close bacterial strain now in the embodiment one.
Embodiment
Embodiment one: the purplish red aspergillus with anti-corrosion function of present embodiment is purplish red aspergillus W5S7 (Monascuspurpureus W5S7), be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, preserving number is CGMCC No.4174.
The purplish red aspergillus W5S7 of present embodiment behind separation, the purifying, carries out mutagenesis screening through the microwave exposure induced-mutation technique and obtains from the fermented bean curd of Kedong.Concrete steps are as follows: the separation and purification of (one) bacterial classification: with inoculating needle picking fritter fermented bean curd crust, the separation of on the Cha Shi synthetic medium, repeatedly ruling, 28～30 ℃ of constant temperature culture 5～6d observe colony growth, with the bacterium colony of redness or purple as the primary dcreening operation bacterium colony; The primary dcreening operation colony inoculation to the PDA solid medium, is cultivated at 28～30 ℃ of constant temperature purifying; (2) microwave irradiation of bacterial classification and seed selection: with the bacterial classification inoculation behind the purifying to the PDA slant medium, 30 ℃ of constant temperature culture 7d, with stroke-physiological saline solution spore is washed, pour in the triangular flask that the granulated glass sphere of sterilizing is housed, spore is broken up in concussion, the elimination mycelium, the spore suspension that obtains, and adjust spore concentration 10 with sterilized water
5Individual/mL; The 10mL spore suspension is moved in the sterile test tube, and test tube is placed microwave device, microwave frequency 2450MHz, irradiation power 100～800W (100W at interval); Under the condition of irradiation time 10～150S (10s at interval) spore suspension is carried out irradiation.Spore suspension behind the irradiation is carried out doubling dilution, coat on the PDA substratum,, write down total colony number and survival colony number, calculate lethality rate and mutation rate, determine that best mutagenic condition is: microwave power 500W, irradiation time 70s in 30 ℃ of constant temperature culture 3d; (3) primary dcreening operation: spore suspension behind the irradiation is coated on the PDA substratum, 30 ℃ of constant temperature culture, observe colonial morphology difference behind 7～10d, get colors and change bigger colony inoculation on the PDA slant medium, 30 ℃ of constant temperature culture 7d, wash spore with sterilized water, make spore suspension respectively, it is standby to carry out multiple sieve; (4) multiple sieve: the monascus ruber spore suspension that will just be sieved to is respectively drawn 10mL, be inoculated in the 150mL liquid fermentation medium, condition with 30 ℃ of culture temperature, shaking table revolution 200r/min is cultivated 14d, according to look valency in " GB4926-2008 foodstuff additive red kojic rice powder " GB measuring method---spectrophotometry detects fermented liquid, at wavelength is the 505nm place, what record fermented liquid absorbance maximum is the highest bacterial strain of antibacterial substance output, is chosen to be purplish red aspergillus W5S7 bacterial strain.Described liquid fermentation medium (g/L): Semen Maydis powder 60, analysis for soybean powder 5, glucose 3, NaNO
34, yeast powder 5, ZnSO
40.2, MgSO
41, K
2HPO
35.
With the spore concentration of the purplish red aspergillus W5S7 of the present invention is 10
5Bacteria suspension 5% be inoculated in the liquid fermentation medium by volume, 28～30 ℃ of culture temperature, shaking table revolution 180r/min, the initial pH4.5 of substratum obtains liquid state fermentation liquid after cultivating 14d.With fermented liquid centrifugal 20min under the condition of 5000r/min, keep supernatant liquor, will precipitate with 95% ethanol and mix, be that 10kHz extracts 60min in the ultrasonic oscillator frequency, again with extracting solution centrifugation, triplicate.Fermented supernatant fluid and ethanol extract are merged, and revolution 80r/min in rotatory evaporator is during 60 ℃ of vaporization temperatures, be concentrated into original volume 1/4, concentrated solution is placed 80 ℃ of air dry ovens, be dried to constant weight, grind into powder is promptly made purplish red aspergillus W5S7 sanitas pulvis.Described liquid fermentation medium (g/L): Semen Maydis powder 60, analysis for soybean powder 5, glucose 3, NaNO
34, yeast powder 5, ZnSO
40.2, MgSO
41, K
2HPO
35.
The present invention has carried out the biocidal property test to purplish red aspergillus W5S7 sanitas pulvis, and test is chosen intestinal bacteria, Staphylococcus albus, withered grass gemma, mould, yeast as indicator.Draw the concentration of cultivating in advance respectively with transfer pipet and be 10
5～10
6Each 0.5mL of bacterium liquid of the intestinal bacteria of cfu/mL, Bacillus subtillis, Staphylococcus albus, yeast and Penicillium notatum, respectively evenly coating on plate culture medium, sterilized neutral filter paper (diameter is 6mm) is attached on the plate culture medium of coating bacterium liquid.Wherein, intestinal bacteria, Bacillus subtillis and Staphylococcus albus adopt nutrient agar; Penicillium notatum adopts the PDA substratum; Yeast adopts malt extract medium.Getting purplish red aspergillus W5S7 sanitas pulvis 2g is dissolved in 100mL 95% ethanolic soln, getting purplish red aspergillus W5S7 sanitas ethanolic soln 10 μ L with microsyringe is added drop-wise on the filter paper, do blank to drip the neutral filter paper of 95% alcoholic acid simultaneously, bacterium is cultivated 24h for 37 ℃, yeast is cultivated 24h for 28 ℃, Penicillium notatum is cultivated 48h for 28 ℃, measures the antibacterial circle diameter size and calculates bacteriostasis rate, and test-results is as shown in table 1.Wherein the calculation formula of bacteriostasis rate is:
Bacteriostasis rate=(antibacterial circle diameter-filter paper diameter)/filter paper diameter * 100%
The purplish red aspergillus W5S7 of table 1 sanitas is to the fungistatic effect of indicator
Annotate: "-" expression does not have bacteriostatic action.
Test-results shows that purplish red aspergillus W5S7 sanitas Bacillus subtillis, yeast and intestinal bacteria all produce inhibition zone (seeing Fig. 4 to Fig. 6), and are wherein best to the Bacillus subtillis fungistatic effect, and the inhibition zone size is 4.29mm, and bacteriostasis rate is 71.0%; Better to intestinal bacteria and yeast fungistatic effect, the inhibition zone size is respectively 3.66mm, 2.66mm, and bacteriostasis rate is respectively 61.0%; Staphylococcus albus is suppressed and acts on not obvious (see figure 7), and the inhibition zone size is 0.22mm, and bacteriostasis rate is 3.70%; Inhibition zone is not appearred in Penicillium notatum, promptly do not have restraining effect.The biocidal property of purplish red aspergillus W5S7 sanitas is from high to low: subtilis＞intestinal bacteria＞yeast＞Staphylococcus albus.Test-results shows that the purplish red aspergillus W5S7 sanitas of present embodiment has certain bacteriostatic action to subtilis common in the food, enterobacteria, yeast and Staphylococcus albus.
The purplish red aspergillus W5S7 of the present invention delivers Institute of Microorganism, Academia Sinica and has carried out strain identification and RNA order-checking, and the check probation report is numbered: No. the 187th, (2010) little searching.It is slower that the purplish red aspergillus W5S7 of the present invention goes up colony growth at wort agar substratum (MEA), 7 days colony diameter 18～20mm of 25 ℃ of uv irradiating dark culturing, tawny, gauffer is arranged, the surface flocciform, aerial hyphae is a small amount of: bacterium colony back side tawny, there is not water-soluble pigment.Mycelia is smooth, multi-branched, and tool is separated, and wide 2.5～5.0 μ m have fat to drip.The asexual spore mass production, subsphaeroidal, base portion is truncate, and wall is smooth or slightly coarse, and 5.5～9.0 μ m are born in unspecialized adnation stigma or mycelia top.Cleistothecium forms in a large number, white is to tawny, singly be born on the short handle of similar mycelia, diameter 22～50 μ m, ascus is cleared up in early days, thecaspore oval, subsphaeroidal, and wall is smooth, 4.4-5.8 * 4.2-4.7 μ m, qualification result is purplish red aspergillus (Monascuspurpureus) for the purplish red aspergillus W5S7 of the present invention.Purplish red aspergillus W5S718S rRNA, 5.8S rRNA and 28S rRNA are shown in SEQ ID NO:1.Present embodiment monascus purpureus bacterium W5S7 homology is compared, and the constructed phylogenetic tree of the close bacterial strain of including among monascus purpureus bacterium W5S7 and the Genbank as shown in Figure 9.This sequence is Monascuspurpureus through NCBI blast comparison, close bacterial classification has M.purpureus ATCC 36114 (AY498578), M.purpureus ATCC 36113 (AY498577), M.purpureus ATCC 16379 (AY498573), as shown in figure 10.As seen from Figure 10, the gene order of the gene order of present embodiment monascus ruber W5S7 mensuration and above-mentioned three kinds of existing bacterial classifications exists than big-difference.Therefore, can conclude that present embodiment monascus purpureus bacterium W5S7 is the purplish red bent new bacterial strain that belongs to (Monascus purpureus).
Embodiment two: present embodiment has been carried out the applicability experiment to the purplish red aspergillus W5S7 sanitas of embodiment one: (one) is mixed with the aqueous preservative solution that concentration is 0.8mg/mL, 6.4mg/mL, 12.8mg/mL, 25.6mg/mL, 41.2mg/mL respectively with purplish red aspergillus W5S7 sanitas pulvis; (2) with 75% cotton ball soaked in alcohol wiping cutter and chopping board, with ripe streaky pork cooling, be cut into the cube meat about about 30g, divide 6 groups at random, 3 every group.If 1 group is control group, all the other 5 groups each take out soak 10～15min in the aqueous preservative solution of different concns after, drains naturally, and the food product pack bag hermetic package of sterilizing with ultraviolet then is placed on packaged sample under the room temperature and stores.Ripe streaky pork effect after purplish red aspergillus W5S7 aqueous preservative solution is handled as shown in Figure 8; (3) respectively the ripe streaky pork of storing 24h, 36h, 6d, 8d, 10d is pressed the method bacterial detection sum that GB4789.2-94 " microbiological test of food hygiene-total number of bacterial colony is measured " stipulates, experimental result is as shown in table 2.
The ripe streaky pork of table 2 is in lay up period total plate count result of variations total plate count (cfu/g)
Experimental result shows, according to total number of bacterial colony (cfu/g)≤8.0 * 10 in the regulation sauce halogen meat among the GB2726-2005 " cooked meat product hygienic standard "
4, after control group was at room temperature stored 36h, total plate count promptly reached 8.6 * 10
4, surpass national standard, can be considered corrupt.Anticorrosion 1 group and 2 groups in the time of the 6th day total number of bacterial colony (cfu/g) be respectively 5.6 * 10
5, 2.5 * 10
5, all above national standard; Anticorrosion 3 groups of total number of bacterial colony the 8th day time the (cfu/g) are 4.0 * 10
5, surpass national standard; Anticorrosion 4 groups and 5 groups in the time of the 8th day total number of bacterial colony (cfu/g) be respectively 7.0 * 104,4.3 * 10
4, all do not surpass national standard as yet.Above result shows, increase along with aqueous preservative solution concentration, the quality guaranteed period of ripe streaky pork after treatment also constantly prolongs, can extend to the 8th day by 36h, in 8 days storage period, anticorrosion group total plate count meets national standard, proves that purplish red aspergillus W5S7 sanitas pulvis brought into play tangible effect to the bacterial multiplication that suppresses ripe streaky pork duration of storage, and along with purplish red aspergillus W5S7 sanitas pulvis consumption strengthens, fungistatic effect is become better and better.Simultaneously, the purplish red aspergillus W5S7 aqueous preservative solution of different concns has all played pigmentation to ripe streaky pork, and concentration is high more, and coloring effect is good more; But excessive concentration can cause colouring too dark, thereby has influence on the food sensory effects.Therefore, working concentration is that the purplish red aspergillus W5S7 sanitas pulvis of 25.6mg/mL is ideal to the anticorrosion and coloring effect of ripe streaky pork.
＜110〉Harbin University of Commerce
＜120〉a kind of purplish red aspergillus with anti-corrosion function
<160>?1
<210>?1
<211>?535
<212>?RNA
＜213〉the purplish red sort of quyi (
Monascuspurpureus)
<220>
＜223〉purplish red aspergillus W5S7 18SrRNA, 5.8SrRNA and 28SrRNA.
<400>?1
aggttggagagggcaaaggccccggcccgacctactgagcgggtgacaaagccccatacg60
ctcgaggaccggacgcggcgccgccactgcctttcgggcccgtccccgttgcccggaggc120
gcaggggacggcggcccaacacacaagccgcgcttgaggggcagtaatgacgctcggaca180
ggcatgccccccggaataccagggggcgcaatgtgcgttcaaagattcgatgattcactg240
aattctgcaattcacattacttatcgcatttcgctgcgttcttcatcgatgccggaacca300
agagatccgttgttgaaagttttaaccgatttggtatgtttactcagacagcaatccttt360
tcaaagacagcgttcgagaagatgtctccggcgggccccagggggccgcgccgaagcaac420
aggaggtacaataatcacgggtgggaggttgggtcccacgaaggggacccgcactcggta480
atgatccttccgcaggttcacctacggaaaccttgttacgactttttacttccaa535
Claims (1)
1. purplish red aspergillus with anti-corrosion function, it is purplish red aspergillus W5S7(
Monascus purpureusW5S7), be deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center, preserving number is CGMCC No.4174.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105299736A CN101988037B (en) | 2010-11-03 | 2010-11-03 | Monascus purpureus with antiseptic function |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105299736A CN101988037B (en) | 2010-11-03 | 2010-11-03 | Monascus purpureus with antiseptic function |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101988037A true CN101988037A (en) | 2011-03-23 |
| CN101988037B CN101988037B (en) | 2012-05-23 |
Family
ID=43744831
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105299736A Expired - Fee Related CN101988037B (en) | 2010-11-03 | 2010-11-03 | Monascus purpureus with antiseptic function |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101988037B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113832046A (en) * | 2021-06-15 | 2021-12-24 | 安徽农业大学 | Difunctional Bacillus belgii and application thereof in red yeast rice fermentation |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1962849A (en) * | 2005-11-09 | 2007-05-16 | 朱兰琴 | Purple monascus strain Danxi-2 |
| CN101347476A (en) * | 2008-09-09 | 2009-01-21 | 北京东方红航天生物技术有限公司 | Health products capable of reducing blood pressure and preparation thereof |
-
2010
- 2010-11-03 CN CN2010105299736A patent/CN101988037B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1962849A (en) * | 2005-11-09 | 2007-05-16 | 朱兰琴 | Purple monascus strain Danxi-2 |
| CN101347476A (en) * | 2008-09-09 | 2009-01-21 | 北京东方红航天生物技术有限公司 | Health products capable of reducing blood pressure and preparation thereof |
Non-Patent Citations (2)
| Title |
|---|
| 《莱阳农学院学报(自然科学版)》 20061231 盖栋梁等人 紫红曲菌的诱变育种研究 293-296 1 第23卷, 第4期 2 * |
| 《贵州农业科学》 20091231 邹晓等人 紫红曲霉的复合诱变及培养条件优化 78-81 1 第37卷, 第6期 2 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113832046A (en) * | 2021-06-15 | 2021-12-24 | 安徽农业大学 | Difunctional Bacillus belgii and application thereof in red yeast rice fermentation |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101988037B (en) | 2012-05-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101250495B (en) | Plant pathogenic fungi antagonistic bacteria strain and its use in control of plant diseases | |
| CN107736379B (en) | Application of bacillus amyloliquefaciens in preventing and treating plant fungal diseases | |
| CN104480046B (en) | One plant of Brevibacillus laterosporus and its application | |
| CN106906172B (en) | One plant of Streptomycesalbidoflhaving and its application in terms of apple tree canker prevention and treatment | |
| CN102086444B (en) | Paenibacillus elgii strain and application thereof | |
| CN104673682B (en) | Aspergillus niger and its application in aflatoxin biology prevention and control | |
| CN104195074B (en) | A kind of deep brown Bacillus strain of Alpine Grasslands herbage endogenetic bacteria, microbial bacterial agent and its preparation method and application | |
| CN103865837A (en) | Streptomyces having antagonistic effect on penicillium viridicatum | |
| CN101698827B (en) | Erythrochromogenes and use thereof in biological control of diseases | |
| CN106119136B (en) | Epicoccum nigrum and its application | |
| CN105919110A (en) | Compound dark tea enzyme and preparation method thereof | |
| CN102199563A (en) | Biocontrol bacterium for controlling plant diseases and preparation method thereof | |
| CN108094794A (en) | A kind of complex microorganism drink of relieving alcoholism and protecting liver and preparation method thereof | |
| CN105613707A (en) | Bacillus subtilis biological preservative and application thereof to preservation of large yellow croakers | |
| CN102994419B (en) | Bacillus pumilus LNXM12 and application thereof | |
| CN101886047A (en) | Sophorolipid fruit preservative and use thereof in fruit preservation | |
| CN113604376B (en) | Sugarcane endophytic bacillus subtilis and application thereof | |
| CN102093965B (en) | Lactic acid bacteria and application thereof | |
| CN107384803B (en) | One plant of beauveria bassiana BB-T02 to hot-zone flowers and fruits thrips with strong infecting potential | |
| CN106906171B (en) | A kind of preparation method of apple tree canker biocontrol agent | |
| CN102206592A (en) | Biocontrol streptomyces for preventing and treating camellia oleifera diseases and its application | |
| CN101988037B (en) | Monascus purpureus with antiseptic function | |
| CN106811435A (en) | A kind of Alpine Grasslands herbage endogenetic bacteria Bacillus amyloliquefaciens strain, microbial bacterial agent and its preparation method and application | |
| CN103555616A (en) | Bacillus amyloliquefaciens and application of liquid preparations thereof in prevention and control of fusarium solani | |
| CN110527639A (en) | A kind of U.S. pole plum surprise yeast and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120523 Termination date: 20131103 |