CN101979560A - Promoter induced by chemical substance of probenazole and application thereof - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, in particular to a promoter induced by a chemical substance of probenazole and application thereof. The promoter comprises a promoter fragment which separates and utilizes nucleic acid; and the promoter is derived from a gene, namely AtNPR1, which is sensitive to pyribenzamine (PBZ) and related compounds thereof, of arabidopsis. Recombinant DNA is obtained by fusing a nucleotide sequence of a target gene product desired for encoding and the promoter fragment; and a new transgenic plant is obtained by transforming a plant by using the recombinant DNA. In the new plant, the expression of a target gene in the recombinant DNA is regulated and controlled by the chemical induction of the PBZ.

Description

A kind of promotor of induced by chemical probenazole and application thereof

Technical field

The invention belongs to gene engineering technology field, be specifically related to a kind of promoter fragment and application thereof that separates and utilize nucleic acid.

Background technology

Promotor is that the RNA polysaccharase can be discerned and combination with it, thereby the section of DNA sequence that initial gene is transcribed is usually located at upstream region of gene.A typical promotor comprises CAAT2box and TATA2box, and they are respectively identification and the binding sites that relies on the RNA polysaccharase of DNA, generally are positioned at tens base places, transcription initiation site upstream.Usually have some special DNA sequences in the core promoter upstream, i.e. cis-acting elements, thus transcription factor is with it in conjunction with activating or the transcribing of suppressor gene.In case RNA polysaccharase location also is combined on the promotor and can transcribes by promotor gene, therefore promotor is the critical elements of gene expression regulation, and the interaction of it and trans-acting factors such as RNA polysaccharase and other albumen cofactors is the essence of promoter regulation genetic transcription.Transcriptional profile according to promotor can be divided into it 3 classes: constitutive promoter, tissue or organ specific promoters and inducible promoter [wait quietly on the road, and 2004, natural science progress 14(8): 856-862].

Compare with the tissue and organ specificity promotor with constitutive promoter, inducible promoter has unique advantage: it can be as required under specific etap of plant, histoorgan or growing environment, the Push And Release of rapid induction genetic transcription.According to the source, inducible promoter can be divided into natural inducible promoter and artificial constructed inducible promoter [wait quietly on the road, 2004, natural science progress 14(8): 856-862].The promotor of natural induction type comprises light, temperature, hormone, arid, high-salt stress, pathogenic bacteria reply promotor etc. [wait quietly on the road, 2004, natural science progress 14(8): 856-862; Narusaka Y, et al. Int eraction between two cis2acting element s, ABRE and DRE, in ABA2dependent expression of Arabidopsis rd29A gene in response to dehydrat ion and high2salin ity stresses. Plant J, 2003,34 (2): 137; Song F M, et al. Cloning and identificat ion of the promot er of the tobacco Sar8. 2b gene, a gene involved in syst emic acquired resistance. Gene, 2002,290:115].Research at present at most, but the most deep artificial abduction delivering system is chemical-inducible expression systems, as tsiklomitsin inductive TetR system, the GR system of induced by dexamethasone, estradiol inductive ER system, sterilant inductive EcR (the Gatz C of system, et al. Tn10 encoded Tet repressor can regulate an operator containing plant promoter. ProcNalt cad Sci USA, 1988,85:1394; Aoyama T, et al. A glucocorticoid mediated transcriptional induction system in transgenic plant s. Plant J, 1999,11:605; Zuo J, et al. An estrogen receptor based transactivator XVE mediates highly inducible gene expression in transgenic plants. Plant J, 2000,24:265; Unger E, et al. A chimeric ecdyson receptor facilitates methoxyfe nozidedependent restoration of male fertility in ms45 maize. Transgenic Res, 2002,11:455).

In order to satisfy application need, people begin one's study and are convenient to the abduction delivering system that uses in the land for growing field crops, sterilant inductive EcR system is exactly a good example. and Unger etc. utilize the moulting hormone aglucon binding domains (EcR LBD) of European corn borer, corn C 1 activation domain (AD) and GAL4 DNA binding domains (DBD) make up chemical induction and activate son, it being linked to each other with corn ms45 minimal promoter, be built into and can be subjected to the sub-inducible system of sterilant inductive manual activation. they utilize this system successfully to induce the expression of fertility restorer gene MS45 in corn male sterility mutant strain ms45.But up to now, also do not have more sophisticated means in the big exercisable external source controlling plant of Tanaka genetic expression [wait quietly on the road, 2004, natural science progress 14(8): 856-862; Unger E, et al. A chimeric ecdyson receptor facilitates methoxyfe nozidedependent restoration of male fertility in ms45 maize. Transgenic Res, 2002,11:455].

The present invention concentrates on to derive from and is subjected to PBZ or its active metabolite BIT inductive DNA promoter fragment in the plant.These promoter fragments are used to set up the system of a cover PBZ or its active metabolite BIT induced gene, and regulate and control expression of exogenous gene in transgenic plant.Its advantage comprises the high reactivity that these promoter fragments show after handling with suitable chemical inducer, obvious expression is all arranged in the plant tissue of all experiments, and the pleiotropy that produces after the chemical substance treatment of no use etc.PBZ is the sterilant that be mainly used in control rice blast of Japanese Meiji Seika Kaisba company in registration in 1975, is a kind of bio protective agent of present Japanese turnout maximum.In isolated experiment, PBZ has antimicrobial acivity slightly.To the microorganism of no pathogenicity and warm-blooded animal low toxicity, safety, belong to a kind of environment amenable agricultural chemicals [Yi X.H., Lu Y.T. Residues and dynamics of probenazole in rice field ecosystem. Chemosphere, 2006,65 (4): 639-643].PBZ be a kind of control rice blast ( Magnaporthe grisea) the efficient disease-resistance inductor, become the disease-resistant inductor of South East Asia Dao Qu control rice blast usable floor area maximum.And this medicament is grown obviously influence of nothing to the normal growth of plant, pathogenic bacteria there is not direct toxicity yet, be difficult for causing resistance (Kessmann H. et al. Induction of systemic acquired disease resistance in plants by chemicals. Annu. ReV. Phytopathol. 1994,32:439-459).Therefore, this abduction delivering system is used in the expression of exogenous regulation and control goal gene in the transgenic plant of big Tanaka growth.

Summary of the invention

The objective of the invention is to the selective expression of gene in applied chemistry material control transgenic plant and the plant tissue, and a kind of promotor and application thereof of induced by chemical probenazole are provided thus.

The promotor of induced by chemical probenazole provided by the invention, derive from the Arabidopis thaliana good medicament: allyl isothiazole probenazole(3-allyloxy-1 to control rice blast, 2-benzisothiazole-1,1-dioxide, PBZ, trade(brand)name Oryzemate) and the gene of related compound sensitivity AtNPR1Nucleotide sequence and an above-mentioned promoter fragment fusion of the desirable purpose product gene of coding are obtained recombinant DNA, transform plant, will obtain new transgenic plant with this recombinant DNA.The expression of the goal gene in new plant in this recombinant DNA is regulated and control by suitable chemical inducer.

The promotor of induced by chemical probenazole provided by the invention, the gene of its regulation and control SEQID No:1 cDNA expression, its nucleotide sequence is shown in SEQID No:2, SEQID No:3, SEQID No:4, SEQID No:5 or SEQID No:6.These sequences comprise and are subjected to chemical substance allyl isothiazole (PBZ) or its active metabolite BIT inductive controlling element and different tissue specific expression element etc.

Of the present inventionly come from Arabidopis thaliana and inducing of PBZ or its active metabolite BIT made the nucleic acid promoter fragment of replying, after inducing with compound, the expression of gene level with the encode specific protein that is connected with this promoter fragment in the transgenic plant of promoter fragment will rise.

Another aspect of the present invention also provides a recombinant DNA carrier.This carrier contains above-mentioned nucleotide sequence as promotor.This carrier can transform plant, comprise a nucleic acid promoter fragment among the present invention, the DNA sequence of specific gene and 3 ' the suitable downstream sequence of encoding links to each other with this promotor, make the plant that transforms behind this recombinant vectors under the effect that Compound P BZ or its active metabolite BIT are arranged, specific gene product level rises.

Another aspect of the present invention comprises with recombinant DNA thaumatropy plant of the present invention, this transgenic plant increase with the DNA sequence expression that Compound P BZ or its active metabolite BIT handle the gene product that causes that coding is selected, and this DNA sequence is through being operatively connected 3 ' end at described promoter fragment.The seed of such transgenic plant is regarded as the embodiment of this invention equally.

Last aspect of this invention is included in the method that causes in the plant that selected gene product expression increases, and it is made up of several steps: the recombinant DNA thaumatropy plant of a) using foregoing description; B) handle transgenic plant with Compound P BZ or its active metabolite BIT; C) the render transgenic plant increases the expression of selected gene product in expectation.

Description of drawings

Fig. 1 on-line analysis NPR1The upstream cis-regulating element of Gene Partial promotor.

Fig. 2 pCAMBIA1301- NPR1Serial carrier makes up synoptic diagram.

Fig. 3 is in pcr analysis Agrobacterium GV3101 NPR1The conversion of each construction of promotor.

Fig. 4 different promoters fragment is subjected to the analysis alive of PBZ inductive GUS enzyme in transgene tobacco.

The transient expression analysis of pCAMBIA1301-1228 carrier GUS on Fig. 5 onion epidermis.

Embodiment

Embodiment 1The component analysis of AtNPR1 upstream region of gene promoter fragment

We do the cis element analysis by AGRIS (http://arabidopsis.med.ohio-state.edu/RGNet/) and two on-line analysis instruments of PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) to the long segment of the promotor of being cloned.According to predicting the outcome, ATG upstream-243bp place is possible TATA-box zone.Analytical results according to PlantCARE, have more than 30 kind of cis-regulating element (Fig. 1) in the 1228bp promoter sequence of being cloned, comprise mainly that wherein light response element is (as G-box, I-box, LAMP-element etc.), W-box (relevant) with the cause of disease reaction, WUN-motif(is relevant with the injury response), AuxRE(replys relevant with growth hormone), EIRE(exciton response element), ERE(is relevant with ethylene responses), HSE(and heat shock response is relevant) and GA(GARE-motif) and SA(TCA-element) relevant response element, DRE(is relevant with arid) etc.

Embodiment 2The vector construction and the Agrobacterium-mediated Transformation of NPR1 segmentation promotor:

2.1 the primer sequence of PCR correspondence:

。

NPR1/R1 is the public antisense primer of 3 ' end among the promotor clone, and all the other primers are the sense primer of 5 ' end, respectively with NPR1It is right to form a primer, the amplification different lengths NPR1The gene promoter fragment.Wherein the product length of P252, P479, P615, P936, P1228 correspondence is followed successively by 252bp, 479bp, 615bp, 936bp and 1228bp.Institute's numeral of marking general in the primer unquote NPR1A among the gene translation initiation site ATG is made as+serial number of 1 o'clock this primer two ends correspondence, and "-" represents that this base is positioned at the translation initiation site upstream.

2.2 NPR1The vector construction of gene different lengths fragment promotor:

Right with above-mentioned each primer, genomic dna with Arabidopis thaliana wild-type Col-0 is a template, the segmental promotor of the corresponding length that increases, the PCR product is inserted the T carrier, after order-checking is correct, with EcoRI and NcoI it is downcut from the T carrier, be connected and transformed into escherichia coli with same pCAMBIA1301 binary vector through EcoRI and NcoI double digestion, select positive colony, behind the extracting plasmid, with electric shocking method the positive colony plasmid is transformed Agrobacterium (GV3101), and evaluation positive transformant, select positive transformant and shake bacterium in the YEB liquid nutrient medium of three anti-(Rif+Gent+Kan), the glycerine with 30% is protected bacterium with volume ratio 1:1, and it is standby to deposit in 80 ℃ of ﹣.Fig. 2 is the qualification result of each transformant, illustrates that each segment has been inserted on the corresponding position of pCAMBIA1301 carrier.

2.3 common experimental method in the vector construction.

2.3.1 DNA digestion with restriction enzyme

(1) 20 μ l enzyme is cut system, 2 μ l DNA, an amount of enzyme cutting buffering liquid (referring to the Takara catalogue), enzyme amount (0.2 μ l enzyme is used for enzyme and cuts evaluation, and 0.5 μ l enzyme is used for enzyme cutting clone).System enlarges, and scales up respectively to become partial volume;

(2) add water in the following order, buffer, DNA, enzyme, mixing, 37 ℃ of reaction 1.5-3 h.(adding restriction endonuclease at last).

2.3.2 glass powder is made and glass powder reclaims dna segment

Glass powder is made:

(1) with clean mortar quartz sand is ground to enough carefully, gets sizeable glass powder particles with the sieve sieve;

(2) with the long-pending sterilized water suspension glass powder of monoploid, leave standstill a moment;

(3) when layering occurring, draw the muddy liquid in upper strata to new centrifuge tube, lower sediment repeats 2,3 operations;

(4) 2000-3000rpm, 1min is centrifugal, removes supernatant;

(5) after the sterile water wash degerming, with the 1:1 ratio with the sterilized water glass powder that suspends

Glass powder reclaims dna segment:

(1) claim empty centrifuge tube weight, cut glue after, weigh again, calculate the weight of glue;

(2) add NaI, fully dissolving in 55 degree baking ovens or the water-bath to add 3ul volume 6mol/L NaI ratio in the 1mg glue;

(3) add 5-10ul glass powder, mixing fully suspends;

(4) ice bath 15min, centrifuge tube is flicked every 5min in the centre, and sedimentary glass powder is suspended;

(5) 7000rpm, 1min is centrifugal, abandons supernatant;

(6) 50 times of glass powder volumes add Rince buffer and fully blow and beat washing;

(7) 5000rpm, 1min is centrifugal, repeats 6,7 twice again;

(8) remove most buffer, volatilization ethanol 5-10min in 55 degree water-baths or the baking oven;

(9) piping and druming of 10-20ulMili-Q water suspends, and Votex fully vibrates;

Dissolving DNA 15min in (10) 55 degree baking ovens or the water-baths is every 5min mixing gently;

(11) 13000rpm after 2min is centrifugal, gets supernatant

New wash stock solution:20 * rince buffer:H2O: dehydrated alcohol=1:9:10

20×rince?buffer:?0.2mol/L?Tris-Cl(pH7.5),?1mol/L?NaCl,?20mmol/L?EDTA。

Ethanol sedimentation reclaims dna segment:

(1) the 3M NaAc of adding 1/10 volume; (enzyme is cut system and is used earlier equal-volume phenol: chloroform extracting albumen)

(2) add 2 V-20 ℃ pre-cooled ethanol, place 30 min on ice;

(3) 12,000 rpm, centrifugal 10 min;

(4) 1 mL 70% washing with alcohol precipitation, 55 ℃ of oven dry are dissolved in TE.

2.3.3 carrier is connected with gene fragment

Connect damping fluid 5.5 μ l

Insert fragment 3.0 μ l

T4 ligase enzyme 1.0 μ l

Enzyme is cut back carrier 0.5 μ l

16 ℃ of connections are spent the night.

2.3.4 competent cell preparation and conversion

Bassoon prepares competent cell:

(1) with the ratio switching activatory bacterial classification evening before yesterday of 1:100, OD value 0.3 is cultivated in 280 commentaries on classics in 37 degree shaking tables, and what this experiment was adopted is intestinal bacteria Top10Strain system;

(2) nutrient solution is poured into the 50ml centrifuge tube, precooling a little on ice, 4000rpm, 10min is centrifugal;

(3) outwell supernatant, add the calcium chloride of 10ml 0.1mol/L CaCl2, break up the bacterium piece gently;

(4) place 30min on ice, 2500rpm, 10min centrifugal (it is good that ring-type appears in centrifuged deposit);

(5) outwell supernatant, be placed into fast on ice, add 2ml 0.1mol/L CaCl2, thalline gently suspends;

(6) be placed on ice, promptly can be used to after 2 hours transform.

Transform:

(1) prepares 42 ℃ of water-baths;

(2) with the 200ul competent cell be connected liquid (5-10ul) or plasmid (1ul) joins in the centrifuge tube mixing;

(3) behind the ice bath 30min, 42 ℃ of heat shock 90s are placed on 5min on ice;

(4) transform the direct coated plate of plasmid;

(5) transform the SOC nutrient solution that connects 2 times of cell volumes of liquid adding, 37 ℃ of shaking table 50-100 change pre-cultivate (Amp resistance 1 hour, Kan, Cm resistances 2 hours), and what this experiment was adopted is the Kan resistant panel;

(6) getting the 200ul mixture is coated in and contains on a certain amount of antibiotic LB flat board.Be inverted overnight incubation for 37 ℃;

(7) next day, obtained positive colony by resistance screening morning.

2.3.5 plasmid extraction

(1) choosing single bacterium colony shakes bacterium and spends the night to containing in a certain amount of antibiotic LB liquid nutrient medium 37 ℃;

(2) get 1ml bacterium liquid, 12000rpm collected thalline in 30 seconds, collected twice;

(3) add the solution I suspension thalline of 100ul ice precooling, add the 200ul solution II, the mixing that turns upside down adds the solution III of 150ul precooling again, and the mixing that turns upside down placed 5 minutes on ice;

(4) 12000rpm is centrifugal 3 minutes, shifts supernatant in new 1.5ml centrifuge tube;

(5) add equal-volume phenol: the chloroform extracting once, 12000rpm 3 minutes, gets phase;

(6) add the dehydrated alcohol that 2 times of volumes are iced precooling, mixing was placed on 30 minutes on ice;

(7) 12000rpm is centrifugal 5 minutes, removes supernatant, precipitates with 70% washing with alcohol;

Dried 5 minutes, and be dissolved in 50ul TE(pH 8.0 for (8) 55 ℃), add 0.5ugRNase, 37 ℃ digested 30 minutes.-20 ℃ of preservations.

Solution I: 50 mmol/L glucose; 25 mmol/L Tris-Cl, pH 8.0; 10 mmol/L EDTA, pH 8.0, autoclaving)

Solution II: 0.2 mol/L NaOH, 1%SDS(is now with the current, can not place on ice)

Solution III: per 100 ml, 60 ml, 5 mol/L potassium acetates, 11.5 ml glacial acetic acids, 28.5 ml deionized waters.

Preparation of Agrobacterium competence and electricity transform.

2.4.1 Agrobacterium competence preparation

(1) at Gent(25ug/ml), Rif(20ug/ml) dull and stereotyped going up rule, and 28 degree are cultivated;

(2) choose single bacterium colony in the same microbiotic YEB liquid nutrient medium, 28 degree are cultivated OD600=0.5;

(3) cooled on ice, 5000rpm, 4 degree, 10min collects thalline;

(4) 1mmol/L Hepes pH7.0 washing is three times;

(5) 10% glycerine wash once, and the suspension thalline is in 3ml 10% glycerine;

(6) be sub-packed in the centrifuge tube every pipe 40ul.

2 * Hepes(0.04mol/L): every 20ml adds sodium-chlor 0.32g, Repone K 0.0148g, and 12 water Sodium phosphate dibasic 0.0543g, dextran 0.04g, Hepes 0.2g regulates pH to 7.05, filtration sterilization

Rifampin: dissolve with methanol.

2.4.2 electricity transforms

(1) 200ng plasmid DNA, 40ul competent cell, mixing add in the electric revolving cup;

(2) at U(1.8KV), R(200 Ω), C(25uF) electricity transforms under the condition;

(3) 800ul SOC flushing electricity transforms cup, and washings is transferred to new centrifuge tube, and 28 degree were cultivated 1 hour;

(4) 4000rpm, 10min collects thalline;

(5) wash supernatant off, stay 200ul suspension thalline;

(6) the thalline suspension liquid is coated in adds corresponding microbiotic LB flat board, 28 degree are cultivated.

Embodiment 3The acquisition of transgene tobacco.

3.1 Agrobacterium cultivates 1) picking contains single bacterium colony of goal gene from the flat board, be inoculated in the 3 ml YEB liquid nutrient mediums (Gent 25 μ g/ml, Rif 20 μ g/ml, Kan 50 μ g/ml) on the constant temperature shaking table 28 ℃, 220 rpm shake training and spend the night to OD 600 and be 0.6-0.8.2) shake the ratio of the bacterium liquid that spends the night of training in 1%-2%, change in the same antibiotic YEB liquid nutrient medium of new configuration, cultivating under the condition same as described above about 6 h, when OD600 is 0.4-0.6, the centrifugal pipe that is collected into of bacterium liquid is used 1/2MS liquid nutrient medium (pH 5.4-5.8) to be suspended into OD600 behind the end to be 0.4, to be used for transforming.3.2 infect on Bechtop, bacterium liquid poured in the aseptic little culture dish.Get and do not have young tender, a healthy and strong blade of wild-type tobacco aseptic seedling of Kan resistance, remove master pulse, blade is cut into 0.5 cm ²Fritter, put into bacterium liquid, soak appropriate time (general 5-10 min).Take out blade and place the bacterium liquid of inhaling attachment removal on the aseptic filter paper.＜annotate: establish the leaf dish that infects without Agrobacterium simultaneously as negative control, following steps with.3.3 the tobacco leaf after cultivation will be infected altogether is seeded in and does not contain on any hormone and the antibiotic MS minimum medium (T1), seals culture dish with sealing film, cultivates 2-3 days in 28 ℃ of dark.3.4 select to cultivate the tobacco leaf of cultivating altogether in the dark 2-3 days transferred in the screening culture medium (T2), seal culture dish with sealing film, be 2 in illumination, select cultivation under the 000-10,000 lux, 25-28 ℃, 16/8 hd-1 light dark condition.＜annotate: the leaf plate edge gently is pressed in the substratum, to increase selective pressure.3.5 root culture and transplant seedlings about 2-3 after week when treating indefinite bud length to the 1 cm left and right sides, is downcut indefinite bud and is also transferred on the root media (T3) and carry out root culture, grows adventive root after 5-10 days.Treat that plant is long after a certain size, it is moved to continued growth in the basin alms bowl.

3.6 the evaluation of transfer-gen plant.

3.6.1 the CTAB tubule extracts DNA of plants

(1) sampling, liquid nitrogen is preserved, CTAB 65 degree preheatings;

(2) grinding rod grinds vegetable material, adds CTAB600ul, mixing;

(3) 65 degree water-bath 10-15min, middle jog is for several times;

(4) 13000rpm, 10min is centrifugal, shifts supernatant to new centrifuge tube;

(5) equal-volume phenol: chloroform: primary isoamyl alcohol, about 500ul, mixing;

(6) 13000rpm, 10min is centrifugal, shifts supernatant to new centrifuge tube;

The Virahol of (7) 2/3 volumes, about 400ul, mixing leaves standstill 10min;

(8) 13000rpm, 10min is centrifugal, abandons supernatant;

(9) 70% washing with alcohol 1-2 time, about 400ul;

(10) drying adds 50ulTE, 1ul RNA enzyme dissolution precipitation.

3.6.2 the PCR of transgenic plant detects

Adopt the forward primer and the reverse primer that is positioned on the gus gene coding region of each fragment promotor: the genomic dna with each candidate's transfer-gen plant is that template increases.

Primers designed: F: the forward primer of each promoter fragment

R：5’CTTCGCGCTGATACCAGACGTTG?3’?SEQ?ID?NO:?13

The annealing temperature of PCR reaction is 58 ℃

Embodiment 4Transfer-gen plant GUS enzyme activity determination

4.1 PBZ processing mode

The transgenic tobacco plant that grows in the basin alms bowl is handled in the mode of watering the back root absorption with the PBZ solution of 0.5mM, and the contrast water is cooked parallel processing.

4.2 transgene tobacco GUS enzyme activity determination (MUG method)

Gus gene coding beta-glucuronidase, it can be decomposed into MU with MUG, and MU can produce fluorescence at excitation wavelength 365nm, can understand the growing amount of MU by detecting fluorescence, thereby relative quantification is carried out in the total enzyme work of GUS in the total protein.

Quantitatively

Plant is pulverized in liquid nitrogen, and the 0.1 mol/L phosphoric acid buffer (pH7.0) that adds 3 times of volumes (contains Na ₂EDTA 10 mmol/L, 0.1% (V/V) Triton X-100,0.1% (V/V) Sarcosyl, β-mercaptoethanol 10 mmol/L), make homogenate.Centrifugal 10 min of 3900 * g collect supernatant liquor and are the GUS crude enzyme liquid.The active detection of GUS carried out with reference to Jefferson (1987) method.Enzyme activity unit is defined as: the enzyme amount that per minute hydrolysis 4-MUG generates 4-MU 1 nmol/L is a unit.The GUS expression activity is represented with every milligram of proteic enzyme activity.Protein content uses the BCA albuminimetry to measure.

4.2.2 protein quantification: BCA method

Working method with reference to Shanghai JaRa bio-engineering corporation

4.2.3 GUS enzyme activity determination

Operation steps:

(1) blade with vegetable material to be measured grinds with grinding rod after the precooling in liquid nitrogen, and the weightmeasurement ratio of pressing 1:3 adds GUS extraction buffer (50 mM NaPO ₄, pH 7.0,10 mM dithiothreitol (DTT), 1 mM Na ₂EDTA, 0.1% Sodium Lauryl Sarcosine, 0.1% Triton X 100).

(2) ice bath 10min with the centrifugal 5min of 8000rpm, collects supernatant liquor, obtains enzyme extract to be measured after rule of thumb diluting accordingly.

(3) get the respective numbers tubule, the MUG that adds 112.5 μ l prepares three times of respective numbers tubules simultaneously and adds the 1ml stop buffer (Na of 0.2mol/L in 37 ℃ of water-bath 5min preheating ₂CO ₃)

(4) the enzyme extract 75 μ l that obtain in adding 2 steps are in MUG, and mixing takes out 45 μ l immediately in stop buffer, as the reaction at zero point, and pick up counting.

(5) respectively getting 45 reaction solutions when 15min, 45min adds in the stop buffer.

(6) with the fluorescent spectrophotometer assay 100nmol/L MU reference liquid to 1 μ mol/L, at excitation wavelength 365nm, the fluorescent value when emission wavelength is 455nm is an X-coordinate with the concentration of MU, is ordinate zou with the fluorescent value of measuring, and mapping obtains typical curve.

(7) fluorescent value of the sample of typical curve and mensuration determines that total GUS enzyme of enzyme extract to be measured is alive thus, with itself and the corresponding total protein that obtains previously, promptly obtain the proteic GUS enzyme of unit weight and live, and to be converted into pmol MU/min/mg albumen be that the enzyme of unit is lived.

For each promoter fragment carrier, select 3 to 5 independent transgenic lines and be used for the GUS enzyme activity determination that PBZ induces front and back, each strain system measures twice.The GUS enzyme that each transgenic line detects after the mode that PBZ irritates with root is handled 3 days in the plant leaf tissue is lived, the result shows pCAMBIA1301-1228, pCAMBIA1301-936, pCAMBIA1301-615, pCAMBIA1301-479, the promoter fragment of these five different lengthss of pCAMBIA1301-252 induce after handled by PBZ GUSGene up-regulated expression, maximum are induced about about 4.5 times (Fig. 4) of multiple.

Embodiment 5In onion epidermis cell AtNPR1The transient expression situation analysis of promoters driven GUS

The pCAMBIA1301-1228 carrier that builds is at first made the induced activity analysis of promotor on onion epidermis of the method for particle gun bombardment, simultaneously with positive plasmid pCAMBIA1301 as experiment condition over against photograph.The onion epidermis of particle bombardment is positioned on the MS solid medium that is added with 0.5mM PBZ, and secretly cultivates 3 days poststainings under 28 degree, contrasts as negative with the onion epidermis of cultivating on the MS solid medium that does not add PBZ simultaneously.As shown in Figure 5, in the MS substratum that has PBZ to exist, the 1228bp that inserts among the constructed pCAMBIA1301-1228 NPR1Promoter fragment can drive GUS and express, and is not adding expression that almost cannot see GUS on the onion epidermis of cultivating on the MS substratum of PBZ.Therefore, particle gun instantaneous conversion experimental result shows 1228bp length AtNPR1Promotor shows certain induced activity under 0.5mM PBZ handles.

Claims (7)

1. a genomic dna molecular sequences, it is characterized in that, the gene of its regulation and control SEQID No:1 cDNA expression, its nucleotide sequence is shown in SEQID No:2, SEQID No:3, SEQID No:4, SEQID No:5 or SEQID No:6, and these sequences comprise and are subjected to chemical substance allyl isothiazole (PBZ) or its active metabolite BIT inductive controlling element and different tissue specific expression elements.

2. as the described application of genomic dna molecular sequences in transgenic plant of claim 1.

3. one group of carrier is characterized in that they contain the described genomic dna molecular sequences of claim 1 as promotor.

4. carrier according to claim 3, it is characterized in that this carrier can transform plant, it comprises a nucleic acid promoter fragment, the DNA sequence of specific gene and 3 ' the suitable downstream sequence of encoding links to each other with this promotor, make the plant that transforms behind this recombinant vectors under the effect that compound allyl isothiazole (PBZ) or its active metabolite BIT are arranged, specific gene product level rises; The gene of selecting is the gene of coding GUS.

5. transgenic plant, it is characterized in that with the described carrier plant transformed of claim 4, these transgenic plant increase with the DNA sequence expression that compound allyl isothiazole (PBZ) or its active metabolite BIT handle the gene product that causes that coding is selected, and this DNA sequence is through being operatively connected 3 ' end at described promoter fragment.

6. seed that obtains by the described transgenic plant of claim 5.

7. method that causes that in plant selected gene product expression increases is characterized in that concrete as follows as step:

A) with the described carrier plant transformed of claim 4;

B) handle transgenic plant with Compound P BZ;

C) the render transgenic plant increases the expression of selected gene product in expectation.

Images