CN101979560B - Promoter induced by chemical substance of probenazole and application thereof - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, in particular to a promoter induced by a chemical substance of probenazole and application thereof. The promoter comprises a promoter fragment which separates and utilizes nucleic acid; and the promoter is derived from a gene, namely AtNPR1, which is sensitive to pyribenzamine (PBZ) and related compounds thereof, of arabidopsis.Recombinant DNA is obtained by fusing a nucleotide sequence of a target gene product desired for encoding and the promoter fragment; and a new transgenic plant is obtained by transforming a plant by using the recombinant DNA. In the new plant, the expression of a target gene in the recombinant DNA is regulated and controlled by the chemical induction of the PBZ.

Description

A kind of promotor of induced by chemical probenazole and application thereof

Technical field

The invention belongs to gene engineering technology field, be specifically related to a kind of promoter fragment and application thereof that separates and utilize nucleic acid.

Background technology

Promotor is that the RNA polysaccharase can be identified and with it combination, thereby the section of DNA sequence that initial gene is transcribed is usually located at upstream region of gene.A typical promotor comprises CAAT2box and TATA2box, and they are respectively identification and the binding sites that relies on the RNA polysaccharase of DNA, generally are positioned at tens base places, transcription initiation site upstream.Usually have some special DNA sequences in the core promoter upstream, i.e. cis-acting elements, thus transcription factor is with it in conjunction with activating or the transcribing of suppressor gene.In case RNA polysaccharase location also is combined on the promotor and can transcribes by promotor gene, therefore promotor is the critical elements of gene expression regulation, and the interaction of it and the trans-acting factors such as RNA polysaccharase and other albumen cofactors is the essence of promoter regulation genetic transcription.Transcriptional profile according to promotor can be divided into it 3 classes: constitutive promoter, tissue or organ specific promoters and inducible promoter [wait quietly on the road, and 2004, natural science progress 14(8): 856-862].

Compare with the tissue and organ specificity promotor with constitutive promoter, inducible promoter has unique advantage: it can be as required under specific etap of plant, histoorgan or growing environment, the Push And Release of rapid induction genetic transcription.According to the source, inducible promoter can be divided into natural inducible promoter and artificial constructed inducible promoter [wait quietly on the road, 2004, natural science progress 14(8): 856-862].The promotor of natural induction type comprises light, temperature, hormone, arid, high-salt stress, pathogenic bacteria reply promotor etc. [wait quietly on the road, 2004, natural science progress 14(8): 856-862; Narusaka Y, et al. Int eraction between two cis2acting element s, ABRE and DRE, in ABA2dependent expression of Arabidopsis rd29A gene in response to dehydrat ion and high2salin ity stresses. Plant J, 2003,34 (2): 137; Song F M, et al. Cloning and identificat ion of the promot er of the tobacco Sar8. 2b gene, a gene involved in syst emic acquired resistance. Gene, 2002,290:115].But most study, the most deep artificial inducible expression are chemical-inducible expression systems at present, the TetR system that induces such as tsiklomitsin, the GR system of induced by dexamethasone, the ER system that estradiol is induced, (the Gatz C of EcR system that sterilant is induced, et al. Tn10 encoded Tet repressor can regulate an operator containing plant promoter. Proc Nalt Acad Sci USA, 1988,85:1394; Aoyama T, et al. A glucocorticoid mediated transcriptional induction system in transgenic plant s. Plant J, 1999,11:605; Zuo J, et al. An estrogen receptor based transactivator XVE mediates highly inducible gene expression in transgenic plants. Plant J, 2000,24:265; Unger E, et al. A chimeric ecdyson receptor facilitates methoxyfe nozidedependent restoration of male fertility in ms45 maize. Transgenic Res, 2002,11:455).

Use needs in order to satisfy, people begin one's study and are convenient to the inducible expression that uses in the land for growing field crops, the EcR system that sterilant is induced is exactly a good example. and Unger etc. utilize the moulting hormone aglucon binding domains (EcR LBD) of European corn borer, corn C 1 activation domain (AD) and GAL4 DNA binding domains (DBD) make up chemical induction and activate son, it being linked to each other with corn ms45 minimal promoter, be built into the sub-inducible system of the manual activation that induced by sterilant. they utilize this system successfully to induce the expression of fertility restorer gene MS45 in corn male sterility mutant strain ms45.But up to now, also the unripe means at the exercisable external source control of large Tanaka gene expression in plants [wait quietly on the road, 2004, natural science progress 14(8): 856-862; Unger E, et al. A chimeric ecdyson receptor facilitates methoxyfe nozidedependent restoration of male fertility in ms45 maize. Transgenic Res, 2002,11:455].

The present invention concentrates on and derives from the DNA promoter fragment that induced by PBZ or its active metabolite BIT.These promoter fragments are used to set up the system of a cover PBZ or its active metabolite BIT induced gene, and regulate and control the expression of foreign gene in transgenic plant.Its advantage comprises the high reactivity that these promoter fragments show after processing with suitable chemical inducer, obvious expression is arranged in the plant tissue of all experiments, and not with the pleiotropy that produces after the chemical substance treatment etc.PBZ be Japanese Meiji Seika Kaisba company in the sterilant that is mainly used in preventing and treating rice blast of registration in 1975, be a kind of bio protective agent of present Japanese turnout maximum.In isolated experiment, PBZ slightly has antimicrobial acivity.To the microorganism of no pathogenicity and warm-blooded animal low toxicity, safety, belong to a kind of environment amenable agricultural chemicals [Yi X.H., Lu Y.T. Residues and dynamics of probenazole in rice field ecosystem. Chemosphere, 2006,65 (4): 639-643].PBZ be a kind of control rice blast ( Magnaporthe grisea) Effective Anti characteristic of disease inductor, become the Plant elicitors of South East Asia Dao Qu control rice blast usable floor area maximum.And this medicament is grown the normal growth of plant and is had no significant effect, pathogenic bacteria there is not direct toxicity yet, be difficult for causing resistance (Kessmann H. et al. Induction of systemic acquired disease resistance in plants by chemicals. Annu. ReV. Phytopathol. 1994,32:439-459).Therefore, this inducible expression is used in the expression of gene regulation goal gene in the transgenic plant of large Tanaka growth.

Summary of the invention

The object of the invention is to the selective expression of gene in applied chemistry material control transgenic plant and the plant tissue, and a kind of promotor and application thereof of induced by chemical probenazole are provided thus.

The promotor of induced by chemical probenazole provided by the invention, derive from the Arabidopis thaliana the good medicament to control rice blast: allyl isothiazole probenazole(3-allyloxy-1,2-benzisothiazole-1,1-dioxide, PBZ, trade(brand)name Oryzemate) and the gene of related compound sensitivity AtNPR1Nucleotide sequence and an above-mentioned promoter fragment fusion of the desirable purpose product gene of coding are obtained recombinant DNA, with this recombinant DNA conversion of plant, will obtain new transgenic plant.The expression of the goal gene in new plant in this recombinant DNA is regulated and control by suitable chemical inducer.

The promotor of induced by chemical probenazole provided by the invention, the gene of its regulation and control SEQID No:1 cDNA expression, its nucleotide sequence is shown in SEQID No:2, SEQID No:3, SEQID No:4, SEQID No:5 or SEQID No:6.These sequences comprise and are subjected to controlling element that chemical substance allyl isothiazole (PBZ) or its active metabolite BIT induce and different tissue specific expression element etc.

Of the present inventionly come from Arabidopis thaliana and inducing of PBZ or its active metabolite BIT made the nucleic acid promoter fragment of replying, after inducing with compound, the expression level with gene of the encode specific protein that is connected with this promoter fragment in the transgenic plant of promoter fragment will rise.

Another aspect of the present invention also provides a recombinant DNA carrier.This carrier contains above-mentioned nucleotide sequence as promotor.But this carrier conversion of plant, comprise a nucleic acid promoter fragment among the present invention, the DNA sequence of specific gene and 3 ' the suitable downstream sequence of encoding links to each other with this promotor, make the plant that transforms behind this recombinant vectors under the effect that Compound P BZ or its active metabolite BIT are arranged, specific gene product level rises.

Another aspect of the present invention comprises with recombinant DNA thaumatropy plant of the present invention, this transgenic plant increase with the DNA sequence expression that Compound P BZ or its active metabolite BIT process the gene product that causes codes selection, and this DNA sequence is connected to 3 ' end of described promoter fragment through operation.The seed of such transgenic plant is regarded as the embodiment of this invention equally.

Last aspect of this invention is included in the method that causes in the plant that selected gene product expression increases, and it is comprised of several steps: the recombinant DNA thaumatropy plant of a) using foregoing description; B) process transgenic plant with Compound P BZ or its active metabolite BIT; C) the render transgenic plant increases the expression of selected gene product in expectation.

Description of drawings

Fig. 1 on-line analysis NPR1The upstream cis-regulating element of Gene Partial promotor.

Fig. 2 pCAMBIA1301- NPR1Serial carrier makes up schematic diagram.

Fig. 3 is in pcr analysis Agrobacterium GV3101 NPR1The conversion of each construction of promotor.

The GUS enzyme that Fig. 4 different promoters fragment is induced by PBZ in transgene tobacco is lived and is analyzed.

The transient expression analysis of pCAMBIA1301-1228 carrier GUS on Fig. 5 onion epidermis.

Embodiment

Embodiment 1The component analysis of AtNPR1 upstream region of gene promoter fragment

We do the cis element analysis by AGRIS (http://arabidopsis.med.ohio-state.edu/RGNet/) and two on-line analysis instruments of PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) to the long segment of the promotor of cloning.According to predicting the outcome, ATG upstream-243bp place is possible TATA-box zone.Analytical results according to PlantCARE, have more than 30 kind of cis-regulating element (Fig. 1) in the 1228bp promoter sequence of cloning, comprise mainly that wherein light response element is (such as G-box, I-box, LAMP-element etc.), W-box (relevant with the cause of disease reaction), WUN-motif(is relevant with the injury response), AuxRE(replys relevant with growth hormone), EIRE(exciton response element), ERE(is relevant with ethylene responses), HSE(and heat shock response is relevant) and GA(GARE-motif) and SA(TCA-element) relevant response element, DRE(is relevant with arid) etc.

Embodiment 2Vector construction and the Agrobacterium-mediated Transformation of NPR1 segmentation promotor:

2.1 the primer sequence that PCR is corresponding:

。

NPR1/R1 is the public antisense primer of 3 ' end among the promotor clone, and all the other primers are the sense primer of 5 ' end, respectively with NPR1Form a primer pair, the amplification different lengths NPR1Promoter gene fragment.Wherein P252, P479, P615, P936, product length that P1228 is corresponding are followed successively by 252bp, 479bp, 615bp, 936bp and 1228bp.Institute's numeral of marking general in the primer unquote NPR1A among the gene translation initiation site ATG is made as+1 o'clock serial number corresponding to these primer two ends, and "-" represents that this base is positioned at the translation initiation site upstream.

2.2 NPR1The vector construction of gene different lengths fragment promotor:

With above-mentioned each primer pair, take the genomic dna of Arabidopis thaliana wild-type Col-0 as template, the promotor of the corresponding length fragment that increases, with PCR product access T carrier, after order-checking is correct, with EcoRI and NcoI it is downcut from the T carrier, be connected the pCAMBIA1301 binary vector with the NcoI double digestion through EcoRI and be connected and transform intestinal bacteria with same, select positive colony, behind the extracting plasmid, with electric shocking method with positive colony Plasmid Transformation Agrobacterium (GV3101), and evaluation positive transformant, select positive transformant and shake bacterium in the YEB liquid nutrient medium of three anti-(Rif+Gent+Kan), the glycerine with 30% is protected bacterium with volume ratio 1:1, deposits in 80 ℃ of ﹣ for subsequent use.Fig. 2 is the qualification result of each transformant, illustrates that each segment has been inserted on the corresponding position of pCAMBIA1301 carrier.

2.3 common experimental method in the vector construction.

2.3.1 DNA digestion with restriction enzyme

(1) 20 μ l enzyme is cut system, 2 μ l DNA, an amount of enzyme cutting buffering liquid (referring to the Takara catalogue), enzyme amount (0.2 μ l enzyme is used for enzyme and cuts evaluation, and 0.5 μ l enzyme is used for enzyme cutting clone).System enlarges, and scales up respectively to become partial volume;

(2) add in the following order water, buffer, DNA, enzyme, mixing, 37 ℃ of reaction 1.5-3 h.(adding at last restriction endonuclease).

2.3.2 glass powder is made and glass powder reclaims dna segment

Glass powder is made:

(1) with clean mortar quartz sand is ground to enough carefully, gets sizeable glass powder particles with the sieve sieve;

(2) with the long-pending sterilized water suspension glass powder of monoploid, leave standstill a moment;

(3) when layering occurring, draw the upper strata dirty solution to new centrifuge tube, lower sediment repeats 2,3 operations;

(4) 2000-3000rpm, 1min is centrifugal, removes supernatant;

(5) after the sterile water wash degerming, with the 1:1 ratio with the sterilized water glass powder that suspends

Glass powder reclaims dna segment:

(1) claim empty centrifuge tube weight, cut glue after, weigh again, calculate the weight of glue;

(2) add NaI, fully dissolving in 55 degree baking ovens or the water-bath to add 3ul volume 6mol/L NaI ratio in the 1mg glue;

(3) add 5-10ul glass powder, mixing fully suspends;

(4) ice bath 15min, centrifuge tube is flicked every 5min in the centre, and the glass powder of precipitation is suspended;

(5) 7000rpm, 1min is centrifugal, abandons supernatant;

(6) 50 times of glass powder volumes add Rince buffer and fully blow and beat washing;

(7) 5000rpm, 1min is centrifugal, repeats 6,7 twice again;

(8) remove most buffer, volatilization ethanol 5-10min in 55 degree water-baths or the baking oven;

(9) piping and druming of 10-20ulMili-Q water suspends, and Votex fully vibrates;

Dissolving DNA 15min in (10) 55 degree baking ovens or the water-baths is every 5min mixing gently;

(11) 13000rpm after 2min is centrifugal, gets supernatant

New wash stock solution:20 * rince buffer:H2O: dehydrated alcohol=1:9:10

20×rince buffer: 0.2mol/L Tris-Cl(pH7.5), 1mol/L NaCl, 20mmol/L EDTA。

The ethanol precipitation reclaims dna segment:

(1) the 3M NaAc of adding 1/10 volume; (enzyme is cut system and is used first equal-volume phenol: chloroform extracting albumen)

(2) add 2 V-20 ℃ pre-cooled ethanol, place 30 min on ice;

(3) 12,000 rpm, centrifugal 10 min;

(4) 1 mL 70% washing with alcohol precipitation, 55 ℃ of oven dry are dissolved in TE.

2.3.3 carrier is connected with gene fragment

Connect damping fluid 5.5 μ l

Insert Fragment 3.0 μ l

T4 ligase enzyme 1.0 μ l

Enzyme is cut rear carrier 0.5 μ l

16 ℃ of connections are spent the night.

2.3.4 competent cell preparation and conversion

Bassoon prepares competent cell:

(1) with the bacterial classification of the ratio of the 1:100 switching activation evening before yesterday, 280 turn and cultivate OD value 0.3 in 37 degree shaking tables, this experiment employing be intestinal bacteria Top10Strain;

(2) nutrient solution is poured into the 50ml centrifuge tube, a little precooling on ice, 4000rpm, 10min is centrifugal;

(3) outwell supernatant, add the calcium chloride of 10ml 0.1mol/L CaCl2, break up gently the bacterium piece;

(4) place 30min on ice, 2500rpm, 10min centrifugal (it is good that ring-type appears in centrifuged deposit);

(5) outwell supernatant, be placed into fast on ice, add 2ml 0.1mol/L CaCl2, thalline gently suspends;

(6) be placed on ice, namely can be used to after 2 hours transform.

Transform:

(1) prepares 42 ℃ of water-baths;

(2) 200ul competent cell and connecting fluid (5-10ul) or plasmid (1ul) are joined in the centrifuge tube mixing;

(3) behind the ice bath 30min, 42 ℃ of heat shock 90s are placed on 5min on ice;

(4) transform the direct coated plate of plasmid;

(5) transform the SOC nutrient solution that connecting fluid adds 2 times of cell volumes, 37 ℃ of shaking table 50-100 turn preculture (Amp resistance 1 hour, Kan, Cm resistance 2 hours), and what this experiment was adopted is the Kan resistant panel;

(6) getting the 200ul mixture is coated in and contains on a certain amount of antibiotic LB flat board.Be inverted overnight incubation for 37 ℃;

(7) next day, obtained positive colony by resistance screening morning.

2.3.5 plasmid extraction

(1) choosing single bacterium colony shakes bacterium and spends the night to containing in a certain amount of antibiotic LB liquid nutrient medium 37 ℃;

(2) get 1ml bacterium liquid, 12000rpm collected thalline in 30 seconds, collected twice;

(3) add the solution I suspension thalline of 100ul ice precooling, add the 200ul solution II, the mixing that turns upside down adds the solution III of 150ul precooling again, and the mixing that turns upside down placed 5 minutes on ice;

(4) 12000rpm is centrifugal 3 minutes, shifts supernatant in new 1.5ml centrifuge tube;

(5) add equal-volume phenol: the chloroform extracting once, 12000rpm 3 minutes, gets phase;

(6) add the dehydrated alcohol that 2 times of volumes are iced precooling, mixing is placed on 30 minutes on ice;

(7) 12000rpm is centrifugal 5 minutes, removes supernatant, precipitates with 70% washing with alcohol;

Dried 5 minutes, and be dissolved in 50ul TE(pH 8.0 for (8) 55 ℃), add 0.5ugRNase, 37 ℃ digested 30 minutes.-20 ℃ of preservations.

Solution I: 50 mmol/L glucose; 25 mmol/L Tris-Cl, pH 8.0; 10 mmol/L EDTA, pH 8.0, autoclaving)

Solution II: 0.2 mol/L NaOH, 1%SDS(is now with the current, can not place on ice)

Solution III: per 100 ml, 60 ml, 5 mol/L potassium acetates, 11.5 ml glacial acetic acids, 28.5 ml deionized waters.

The preparation of Agrobacterium competence and electricity transform.

2.4.1 Agrobacterium competence preparation

(1) at Gent(25ug/ml), Rif(20ug/ml) dull and stereotyped upper line, 28 degree are cultivated;

(2) choose single bacterium colony in the same microbiotic YEB liquid nutrient medium, 28 degree are cultivated OD600=0.5;

(3) cooled on ice, 5000rpm, 4 degree, 10min collects thalline;

(4) 1mmol/L Hepes pH7.0 washing is three times;

(5) 10% glycerine wash once, and the suspension thalline is in 3ml 10% glycerine;

(6) be sub-packed in the centrifuge tube every pipe 40ul.

2 * Hepes(0.04mol/L): every 20ml adds sodium-chlor 0.32g, Repone K 0.0148g, and 12 water Sodium phosphate dibasic 0.0543g, dextran 0.04g, Hepes 0.2g regulates pH to 7.05, filtration sterilization

Rifampin: dissolve with methanol.

2.4.2 electricity transforms

(1) 200ng plasmid DNA, 40ul competent cell, mixing add in the electric revolving cup;

(2) at U(1.8KV), R(200 Ω), C(25uF) electricity transforms under the condition;

(3) 800ul SOC flushing electricity transforms cup, and washings is transferred to new centrifuge tube, and 28 degree were cultivated 1 hour;

(4) 4000rpm, 10min collects thalline;

(5) wash supernatant off, stay 200ul suspension thalline;

(6) the thalline suspension liquid is coated in to add corresponding microbiotic LB dull and stereotyped, 28 degree are cultivated.

Embodiment 3The acquisition of transgene tobacco.

3.1 Agrobacterium cultivates 1) picking contains single bacterium colony of goal gene from the flat board, be inoculated in the 3 ml YEB liquid nutrient mediums (Gent 25 μ g/ml, Rif 20 μ g/ml, Kan 50 μ g/ml) on constant-temperature table 28 ℃, 220 rpm shake training and spend the night to OD 600 and be 0.6-0.8.2) shake the bacterium liquid that spends the night of training in the ratio of 1%-2%, change in the same antibiotic YEB liquid nutrient medium of new configuration, cultivating under the condition same as described above about 6 h, when OD600 is 0.4-0.6, the centrifugal pipe that is collected into of bacterium liquid is used 1/2MS liquid nutrient medium (pH 5.4-5.8) to be suspended into OD600 behind the end to be 0.4, to be used for transforming.3.2 infect on Bechtop, bacterium liquid poured in the aseptic little culture dish.Get and do not have young tender, a healthy and strong blade of wild-type tobacco aseptic seedling of Kan resistance, remove master pulse, blade is cut into 0.5 cm ²Fritter, put into bacterium liquid, soak appropriate time (general 5-10 min).The taking-up blade places and sucks the bacterium liquid that adheres on the aseptic filter paper.＜annotate: establish simultaneously the leaf dish that infects without Agrobacterium as negative control, following steps with.3.3 the tobacco leaf after cultivation will be infected altogether is seeded in and does not contain on any hormone and the antibiotic MS minimum medium (T1), seals culture dish with sealed membrane, cultivates 2-3 days in 28 ℃ of dark.3.4 select to cultivate the tobacco leaf of cultivating altogether in the dark 2-3 days transferred in the screening culture medium (T2), seal culture dish with sealed membrane, be 2,000-10 in illumination, select to cultivate under 000 lux, 25-28 ℃, 16/8 hd-1 light dark condition.＜annotate: the leaf plate edge gently is pressed in the substratum, to increase selective pressure.3.5 root culture and transplant seedlings approximately 2-3 after week when treating indefinite bud length to the 1 cm left and right sides, is downcut indefinite bud and is also transferred on the root media (T3) and carry out root culture, grows adventive root after 5-10 days.Plant to be planted is long after a certain size, and it is moved to continued growth in the basin alms bowl.

3.6 the evaluation of transfer-gen plant.

3.6.1 the CTAB tubule extracts DNA of plants

(1) sampling, liquid nitrogen is preserved, CTAB 65 degree preheatings;

(2) grinding rod grinds vegetable material, adds CTAB600ul, mixing;

(3) 65 degree water-bath 10-15min, middle jog is for several times;

(4) 13000rpm, 10min is centrifugal, shifts supernatant to new centrifuge tube;

(5) equal-volume phenol: chloroform: primary isoamyl alcohol, about 500ul, mixing;

(6) 13000rpm, 10min is centrifugal, shifts supernatant to new centrifuge tube;

The Virahol of (7) 2/3 volumes, about 400ul, mixing leaves standstill 10min;

(8) 13000rpm, 10min is centrifugal, abandons supernatant;

(9) 70% washing with alcohol 1-2 time, approximately 400ul;

(10) drying adds 50ulTE, 1ul RNA enzyme dissolution precipitation.

3.6.2 the PCR of transgenic plant detects

Adopt the forward primer of each fragment promotor and be positioned at reverse primer on the gus gene coding region: increase take the genomic dna of each candidate's transfer-gen plant as template.

Primers designed: F: the forward primer of each promoter fragment

R：5’CTTCGCGCTGATACCAGACGTTG 3’ SEQ ID NO: 13

The annealing temperature of PCR reaction is 58 ℃

Embodiment 4Transfer-gen plant GUS enzyme activity determination

4.1 PBZ processing mode

The transgenic tobacco plant that grows in the basin alms bowl is processed in the mode of watering rear root absorption with the PBZ solution of 0.5mM, and the contrast water is cooked parallel processing.

4.2 transgene tobacco GUS enzyme activity determination (MUG method)

Gus gene coding beta-glucuronidase, it can be decomposed into MU with MUG, and MU can produce fluorescence at excitation wavelength 365nm, can understand the growing amount of MU by detecting fluorescence, thereby relative quantification is carried out in the total enzyme work of GUS in the total protein.

Quantitatively

Plant is pulverized in liquid nitrogen, and the 0.1 mol/L phosphoric acid buffer (pH7.0) that adds 3 times of volumes (contains Na ₂EDTA 10 mmol/L, 0.1% (V/V) Triton X-100,0.1% (V/V) Sarcosyl, β-mercaptoethanol 10 mmol/L), make homogenate.Centrifugal 10 min of 3900 * g collect supernatant liquor and are the GUS crude enzyme liquid.The active detection of GUS carried out with reference to Jefferson (1987) method.Enzyme activity unit is defined as: the enzyme amount that per minute hydrolysis 4-MUG generates 4-MU 1 nmol/L is a unit.The GUS expression activity represents with the enzyme activity of every milligram of albumen.Protein content uses the BCA albuminimetry to measure.

4.2.2 protein quantification: BCA method

Working method with reference to Shanghai JaRa bio-engineering corporation

4.2.3 GUS enzyme activity determination

Operation steps:

(1) blade with vegetable material to be measured grinds with grinding rod after the precooling in liquid nitrogen, and the weightmeasurement ratio of pressing 1:3 adds GUS extraction buffer (50 mM NaPO ₄, pH 7.0,10 mM dithiothreitol (DTT), 1 mM Na ₂EDTA, 0.1% Sodium Lauryl Sarcosine, 0.1% Triton X 100).

(2) ice bath 10min with the centrifugal 5min of 8000rpm, collects supernatant liquor, obtains enzyme extract to be measured after rule of thumb diluting accordingly.

(3) get the respective numbers tubule, add the MUG of 112.5 μ l in 37 ℃ of water-bath 5min preheating, prepare simultaneously three times of respective numbers tubules and add the 1ml stop buffer (Na of 0.2mol/L ₂CO ₃)

(4) the enzyme extract 75 μ l that obtain in adding 2 steps are in MUG, and mixing takes out 45 μ l immediately in stop buffer, as the reaction at zero point, and the beginning timing.

(5) respectively getting 45 reaction solutions when 15min, 45min adds in the stop buffer.

(6) with the fluorescent spectrophotometer assay 100nmol/L MU reference liquid to 1 μ mol/L, at excitation wavelength 365nm, the fluorescent value when emission wavelength is 455nm, take the concentration of MU as X-coordinate, take the fluorescent value measured as ordinate zou, mapping obtains typical curve.

(7) fluorescent value of the sample of typical curve and mensuration determines that total GUS enzyme of enzyme extract to be measured is alive thus, with itself and the corresponding total protein that obtains previously, the GUS enzyme that namely obtains unit weight albumen is lived, and the enzyme that is converted into take pmol MU/min/mg albumen as unit is lived.

For each promoter fragment carrier, to select 3 to 5 independent transgenic lines and be used for the GUS enzyme activity determination that PBZ induces front and back, each strain is measured twice.The GUS enzyme that each transgenic line detects after the mode that PBZ fills with root is processed 3 days in the plant leaf tissue is lived, the result shows pCAMBIA1301-1228, pCAMBIA1301-936, pCAMBIA1301-615, pCAMBIA1301-479, the promoter fragment of these five different lengthss of pCAMBIA1301-252 induce after processed by PBZ GUSGene up-regulated expression, maximum are induced multiple approximately (Fig. 4) about 4.5 times.

Embodiment 5In onion epidermis cell AtNPR1The transient expression situation analysis of promoters driven GUS

The pCAMBIA1301-1228 carrier that builds is at first made the induced activity analysis of promotor at onion epidermis of the method for particle gun bombardment, simultaneously with the positive control of positive plasmid pCAMBIA1301 as experiment condition.The onion epidermis of particle bombardment is positioned on the MS solid medium that is added with 0.5mM PBZ, and secretly cultivates 3 days poststainings under 28 degree, contrasts as negative with the onion epidermis of cultivating on the MS solid medium that does not add PBZ simultaneously.As shown in Figure 5, in the MS substratum that has PBZ to exist, the 1228bp that inserts among the constructed pCAMBIA1301-1228 NPR1Promoter fragment can drive GUS and express, and almost cannot see the expression of GUS on the onion epidermis that the MS substratum that does not add PBZ is cultivated.Therefore, particle gun instantaneous conversion experimental result shows 1228bp length AtNPR1Promotor shows certain induced activity under 0.5mM PBZ processes.

＜110〉Fudan University

＜120〉a kind of promotor of induced by chemical probenazole and application thereof

<130> 001

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 1782

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 1

atggacacca ccattgatgg attcgccgat tcttatgaaa tcagcagcac tagtttcgtc 60

gctaccgata acaccgactc ctctattgtt tatctggccg ccgaacaagt actcaccgga 120

cctgatgtat ctgctctgca attgctctcc aacagcttcg aatccgtctt tgactcgccg 180

gatgatttct acagcgacgc taagcttgtt ctctccgacg gccgggaagt ttctttccac 240

cggtgcgttt tgtcagcgag aagctctttc ttcaagagcg ctttagccgc cgctaagaag 300

gagaaagact ccaacaacac cgccgccgtg aagctcgagc ttaaggagat tgccaaggat 360

tacgaagtcg gtttcgattc ggttgtgact gttttggctt atgtttacag cagcagagtg 420

agaccgccgc ctaaaggagt ttctgaatgc gcagacgaga attgctgcca cgtggcttgc 480

cggccggcgg tggatttcat gttggaggtt ctctatttgg ctttcatctt caagatccct 540

gaattaatta ctctctatca gaggcactta ttggacgttg tagacaaagt tgttatagag 600

gacacattgg ttatactcaa gcttgctaat atatgtggta aagcttgtat gaagctattg 660

gatagatgta aagagattat tgtcaagtct aatgtagata tggttagtct tgaaaagtca 720

ttgccggaag agcttgttaa agagataatt gatagacgta aagagcttgg tttggaggta 780

cctaaagtaa agaaacatgt ctcgaatgta cataaggcac ttgactcgga tgatattgag 840

ttagtcaagt tgcttttgaa agaggatcac accaatctag atgatgcgtg tgctcttcat 900

ttcgctgttg catattgcaa tgtgaagacc gcaacagatc ttttaaaact tgatcttgcc 960

gatgtcaacc ataggaatcc gaggggatat acggtgcttc atgttgctgc gatgcggaag 1020

gagccacaat tgatactatc tctattggaa aaaggtgcaa gtgcatcaga agcaactttg 1080

gaaggtagaa ccgcactcat gatcgcaaaa caagccacta tggcggttga atgtaataat 1140

atcccggagc aatgcaagca ttctctcaaa ggccgactat gtgtagaaat actagagcaa 1200

gaagacaaac gagaacaaat tcctagagat gttcctccct cttttgcagt ggcggccgat 1260

gaattgaaga tgacgctgct cgatcttgaa aatagagttg cacttgctca acgtcttttt 1320

ccaacggaag cacaagctgc aatggagatc gccgaaatga agggaacatg tgagttcata 1380

gtgactagcc tcgagcctga ccgtctcact ggtacgaaga gaacatcacc gggtgtaaag 1440

atagcacctt tcagaatcct agaagagcat caaagtagac taaaagcgct ttctaaaacc 1500

gtggaactcg ggaaacgatt cttcccgcgc tgttcggcag tgctcgacca gattatgaac 1560

tgtgaggact tgactcaact ggcttgcgga gaagacgaca ctgctgagaa acgactacaa 1620

aagaagcaaa ggtacatgga aatacaagag acactaaaga aggcctttag tgaggacaat 1680

ttggaattag gaaattcgtc cctgacagat tcgacttctt ccacatcgaa atcaaccggt 1740

ggaaagaggt ctaaccgtaa actctctcat cgtcgtcggt ga 1782

<210> 2

<211> 1228

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 2

acttaaaatc atacaaatct tatcctaatt taacttatca tttaagaaat acaaaagtaa 60

aaaacgcgga aagcaataat ttatttacct tattataact cctatataaa gtactctgtt 120

tattcaacat aatcttacgt tgttgtattc ataggcatct ttaacctatc ttttcatttt 180

ctgatctcga tcgttttcga tccaacaaaa tgagtctacc ggtgaggaac caagaggtga 240

ttatgcagat tccttcttct tctcagtttc cagcaacatc gagtccggaa aacaccaatc 300

aagtgaagga tgagccaaat ttgtttagac gtgttatgaa tttgctttta cgtcgtagtt 360

attgaaaaag ctgatttatc gcatgattca gaacgagaag ttgaaggcaa ataactaaag 420

aagtctttta tatgtataca ataattgttt ttaaatcaaa tcctaattaa aaaaatatat 480

tcattatgac tttcatgttt ttaatgtaat ttattcctat atctataatg attttgttgt 540

gaagagcgtt ttcatttgct atagaacaag gagaatagtt ccaggaaata ttcgacttga 600

tttaattata gtgtaaacat gctgaacact gaaaattact ttttcaataa acgaaaaata 660

taatatacat tacaaaactt atgtgaataa agcatgaaac ttaatatacg ttccctttat 720

cattttactt caaagaaaat aaacagaaat gtaactttca catgtaaatc taattcttaa 780

atttaaaaaa taatatttat atatttatat gaaaataacg aaccggatga aaaataaatt 840

ttatatattt atatcatctc caaatctagt ttggttcagg ggcttaccga accggattga 900

acttctcata tacaaaaatt agcaacacaa aatgtctccg gtataaatac taacatttat 960

aacccgaacc ggtttagctt cctgttatat ctttttaaaa aagatctctg acaaagattc 1020

ctttcctgga aatttaccgg ttttggtgaa atgtaaaccg tgggacgagg atgcttcttc 1080

atatctcacc accactctcg ttgacttgac ttggctctgc tcgtcaatgg ttatcttcga 1140

tctttaacca aatccagttg ataaggtctc ttcgttgatt agcagagatc tctttaattt 1200

gtgaatttca attcatcgga acctgttg 1228

<210> 3

<211> 936

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 3

caccaatcaa gtgaaggatg agccaaattt gtttagacgt gttatgaatt tgcttttacg 60

tcgtagttat tgaaaaagct gatttatcgc atgattcaga acgagaagtt gaaggcaaat 120

aactaaagaa gtcttttata tgtatacaat aattgttttt aaatcaaatc ctaattaaaa 180

aaatatattc attatgactt tcatgttttt aatgtaattt attcctatat ctataatgat 240

tttgttgtga agagcgtttt catttgctat agaacaagga gaatagttcc aggaaatatt 300

cgacttgatt taattatagt gtaaacatgc tgaacactga aaattacttt ttcaataaac 360

gaaaaatata atatacatta caaaacttat gtgaataaag catgaaactt aatatacgtt 420

ccctttatca ttttacttca aagaaaataa acagaaatgt aactttcaca tgtaaatcta 480

attcttaaat ttaaaaaata atatttatat atttatatga aaataacgaa ccggatgaaa 540

aataaatttt atatatttat atcatctcca aatctagttt ggttcagggg cttaccgaac 600

cggattgaac ttctcatata caaaaattag caacacaaaa tgtctccggt ataaatacta 660

acatttataa cccgaaccgg tttagcttcc tgttatatct ttttaaaaaa gatctctgac 720

aaagattcct ttcctggaaa tttaccggtt ttggtgaaat gtaaaccgtg ggacgaggat 780

gcttcttcat atctcaccac cactctcgtt gacttgactt ggctctgctc gtcaatggtt 840

atcttcgatc tttaaccaaa tccagttgat aaggtctctt cgttgattag cagagatctc 900

tttaatttgt gaatttcaat tcatcggaac ctgttg 936

<210> 4

<211> 615

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 4

taaacatgct gaacactgaa aattactttt tcaataaacg aaaaatataa tatacattac 60

aaaacttatg tgaataaagc atgaaactta atatacgttc cctttatcat tttacttcaa 120

agaaaataaa cagaaatgta actttcacat gtaaatctaa ttcttaaatt taaaaaataa 180

tatttatata tttatatgaa aataacgaac cggatgaaaa ataaatttta tatatttata 240

tcatctccaa atctagtttg gttcaggggc ttaccgaacc ggattgaact tctcatatac 300

aaaaattagc aacacaaaat gtctccggta taaatactaa catttataac ccgaaccggt 360

ttagcttcct gttatatctt tttaaaaaag atctctgaca aagattcctt tcctggaaat 420

ttaccggttt tggtgaaatg taaaccgtgg gacgaggatg cttcttcata tctcaccacc 480

actctcgttg acttgacttg gctctgctcg tcaatggtta tcttcgatct ttaaccaaat 540

ccagttgata aggtctcttc gttgattagc agagatctct ttaatttgtg aatttcaatt 600

catcggaacc tgttg 615

<210> 5

<211> 479

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 5

tgtaactttc acatgtaaat ctaattctta aatttaaaaa ataatattta tatatttata 60

tgaaaataac gaaccggatg aaaaataaat tttatatatt tatatcatct ccaaatctag 120

tttggttcag gggcttaccg aaccggattg aacttctcat atacaaaaat tagcaacaca 180

aaatgtctcc ggtataaata ctaacattta taacccgaac cggtttagct tcctgttata 240

tctttttaaa aaagatctct gacaaagatt cctttcctgg aaatttaccg gttttggtga 300

aatgtaaacc gtgggacgag gatgcttctt catatctcac caccactctc gttgacttga 360

cttggctctg ctcgtcaatg gttatcttcg atctttaacc aaatccagtt gataaggtct 420

cttcgttgat tagcagagat ctctttaatt tgtgaatttc aattcatcgg aacctgttg 479

<210> 6

<211> 252

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 6

gcttcctgtt atatcttttt aaaaaagatc tctgacaaag attcctttcc tggaaattta 60

ccggttttgg tgaaatgtaa accgtgggac gaggatgctt cttcatatct caccaccact 120

ctcgttgact tgacttggct ctgctcgtca atggttatct tcgatcttta accaaatcca 180

gttgataagg tctcttcgtt gattagcaga gatctcttta atttgtgaat ttcaattcat 240

cggaacctgt tg 252

<210> 7

<211> 31

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 7

tgctccatgg caacaggttc cgatgaattg a 31

<210> 8

<211> 28

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 8

tactgaattc gcttcctgtt atatcttt 28

<210> 9

<211> 28

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 9

tactgaattc tgtaactttc acatgtaa 28

<210> 10

<211> 28

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 10

tactgaattc taaacatgct gaacactg 28

<210> 11

<211> 27

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 11

tactgaattc caccaatcaa gtgaagg 27

<210> 12

<211> 32

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 12

tactgaattc acttaaaatc atacaaatct ta 32

<210> 13

<211> 23

<212> DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400> 13

cttcgcgctg ataccagacg ttg 23

Claims (5)

1. a genomic dna molecule is characterized in that, the expression of its regulation and control SEQID No:1 gene, and its nucleotide sequence is shown in SEQID No:2, SEQID No:3, SEQID No:4, SEQID No:5 or SEQID No:6.

2. such as the described application of genomic dna molecular sequences in transgenic plant of claim 1.

3. one group of carrier is characterized in that they contain the described genomic dna molecular sequences of claim 1 as promotor.

4. carrier according to claim 3, but it is characterized in that this carrier conversion of plant, it comprises a nucleic acid promoter fragment, the DNA sequence of specific gene and 3 ' the suitable downstream sequence of encoding links to each other with this promotor, make the plant that transforms behind this recombinant vectors under the effect that the compound allyl isothiazole is arranged, specific gene product level rises; The gene of selecting is the gene of coding GUS.

5. method that causes that in plant selected gene product expression increases is characterized in that concrete as follows such as step:

A) plant that transforms with carrier claimed in claim 4;

B) process transgenic plant with the compound allyl isothiazole;

C) the render transgenic plant increases the expression of selected gene product in expectation.

Images