CN101955939B - Aptamer for grouping different subtype non-small cell lung cancers and screening method thereof - Google Patents
Aptamer for grouping different subtype non-small cell lung cancers and screening method thereof Download PDFInfo
- Publication number
- CN101955939B CN101955939B CN2010102560936A CN201010256093A CN101955939B CN 101955939 B CN101955939 B CN 101955939B CN 2010102560936 A CN2010102560936 A CN 2010102560936A CN 201010256093 A CN201010256093 A CN 201010256093A CN 101955939 B CN101955939 B CN 101955939B
- Authority
- CN
- China
- Prior art keywords
- aptamer
- cell
- cell lung
- small cell
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses an aptamer for grouping different subtype non-small cell lung cancers and a screening method thereof. The aptamer provided by the invention is a DNA fragment having a nucleotide sequence represented by sequences from No.1 to No.2 in a sequence table. The aptamer can be applied to grouping of different subtype non-small cell lung cancers. The aptamer of the invention can group different subtypes of the non-small cell lung cancers according to a molecular response signal under the situation that a tumor marker of non-small cell lung cancer is unknown. The identification of a combination target of the aptamer by using the aptamer is favorable for finding the tumor marker of non-small cell lung cancer, for earlier diagnosis and more accurate grouping of the non-small cell lung cancers, and for finding a new medicinal function target of oncotherapy.
Description
The application is that application number is 200910083075.X, the applying date to be on 04 28th, 2009, invention and created name dividing an application for " aptamer and the screening method thereof that are used for classification of different-subtype non-small cell lung cancers ".
Technical field
The present invention relates to a kind of aptamer and screening method thereof that is used for classification of different-subtype non-small cell lung cancers.
Background technology
Lung cancer is one of the most fatal cancer, on histology, is divided into small cell lung cancer and nonsmall-cell lung cancer, and wherein the latter accounts for 80% of lung cancer case.Nonsmall-cell lung cancer is divided into gland cancer again, three types of hypotypes of squama cancer and large cell carcinoma.Gland cancer accounts for 40% of nonsmall-cell lung cancer as a kind of topmost hypotype.It is by stages residing that the prognosis of nonsmall-cell lung cancer depends critically upon when making a definite diagnosis disease, and according to existing treatment level, 5 years survival rates of patient drop to 1% of the IV phase from 60% of the I phase.Although on the detection method of lung cancer, obtained bigger progress, 70% the patient of still having an appointment at present has been in lung cancer late period when making a definite diagnosis.Treatment to the nonsmall-cell lung cancer different subtype applies similar treat-ment and does not consider that the heterogeneity between the hypotype is the major reason that influences the nonsmall-cell lung cancer result of treatment.Although tumor markerses such as neuronspecific enolase, cytokeratin fragment 21-1, CEACAMS, sugar antigen are used for the detection and the postoperative evaluation of lung cancer at present; But these tumor markerses are to lung cancer, and the specificity and the susceptibility of especially different lung cancer hypotypes are not enough.The somatotype of nonsmall-cell lung cancer still mainly relies on the cell physical aspect to judge with diagnosis; Development can reflect the novel agent of nonsmall-cell lung cancer characteristic from molecular level, and hypotype is classified and early diagnosis is to reduce non-small cell lung mortality of carcinoma important means in order to carry out.
Aptamer (Aptamer claims aptamers again, adaptive son) is the few nucleic acid molecule (ssDNA or ssRNA) of strand of certain biological target of combination of ability high-affinity, high specific.The target of having reported aptamer comprises metals ion, organic molecule, polypeptide, protein, cell even tissue etc.The molecular recognition function of aptamer and antibody class are seemingly; But compare with antibody and to have a lot of excellent characteristic; As non-immunogenicity, easily synthetic and mark, product can not there are differences and have fine chemicalstability between penetrate tissue, good dynamic metabolism, the different batches fast, has important application prospects in fields such as biological detection, medical diagnosis on disease treatments.
Summary of the invention
The purpose of this invention is to provide a kind of aptamer and screening method thereof that is used for classification of different-subtype non-small cell lung cancers.
Aptamer provided by the invention is the dna fragmentation that contains the Nucleotide shown in arbitrary in sequence 1 to the sequence 9 of ordered list.
Said aptamer specifically can be the dna fragmentation shown in arbitrary in sequence 1 to the sequence 16 of sequence table.
Aptamer 1:5 '-CGCG TGTGGGGAGGGGGGTGGGTTTTATAG CGCG-3 '; See the sequence 10 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 1 of seeing sequence table;
Aptamer 2:5 '-
CAATTGGGTGTAGGGGTGGGGATTGTGGGTTG-3'; See the sequence 2 of sequence table;
Aptamer 3a:5 '-ATGCCAC
AGTGGGGGGGTGGGTGGGTGGCAT-3 '; See the sequence 11 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 3 of seeing sequence table;
Aptamer 3b:5 '-TCGGATGC
TGGGTGGGGGGGAAGAGCATCCGA-3 '; See the sequence 12 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 4 of seeing sequence table;
Aptamer 3c:5 '-CCACTAC
GAGGGTGGGCGGGTGGAGTAGTGG-3 '; See the sequence 13 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 5 of seeing sequence table;
Aptamer 3d:5 '-GATC
GGTGGGTGGGGGGGTTGGAGATC-3 '; See the sequence 14 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 6 of seeing sequence table;
Aptamer 3e:5 '-CGAACA
GGTGGGTGGGTTGGGTGGATTGTTCG-3 '; See the sequence 15 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 7 of seeing sequence table;
Aptamer 3f:5 '-GATTAA
GTGGGTGGGGGGGTGGAAGTTAATC-3 '; See the sequence 16 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 8 of seeing sequence table;
Aptamer 4:5 '-
GCTATCTTATGGAAATTTCGTGTAGGGTTTGGTGTGGCGGGGCTA-3 '; See the sequence 9 of sequence table.
Wherein, the Nucleotide beyond the target sequence can use other complementary Nucleotide to replace in every dna sequence dna.
Wherein, aptamer 3a, aptamer 3b, aptamer 3c, aptamer 3d, aptamer 3e and aptamer 3f comprise a conserved sequence G
1T
1GGGTGGGG
2GGGT
2G
3GA.G wherein
1Can delete T
1G can be replaced by Nucleotide A
2Can be replaced T by Nucleotide C or TT
2G can be replaced by Nucleotide A
3Can be replaced or deletion by Nucleotide A.
Also can said aptamer modified or transform, obtain the verivate of said aptamer, the verivate of said aptamer can be:
A) with said aptamer deletion or increase part complementary Nucleotide, what obtain has the verivate of the aptamer of identical function with said aptamer.
B) said aptamer is carried out Nucleotide replaces or part is modified, what obtain has the verivate of the aptamer of identical function with said aptamer.
C) skeleton with said aptamer transform phosphorothioate backbone as, and what obtain has the verivate of the aptamer of identical function with said aptamer.
D) transform aptamer as PNAG3, what obtain has the verivate of the aptamer of identical function with said aptamer.
E) with said aptamer connect go up fluorescence, radioactivity and therapeutic substance after, what obtain has the verivate of the aptamer of identical function with said aptamer.
The present invention also protects the application of said aptamer in the different non-small cell lung cancer subtypes cell typing.
Said aptamer is different with the affinity of the non-small cell lung cancer cell of different subtype.Can obtain different binding signals after both are hatched, thereby can distinguish the nonsmall-cell lung cancer different subtype through the form of single aptamer signal or a plurality of aptamer molecular linkage maps.Also can said aptamer be carried out fluorescent mark, the tissue slice to lung cancer patient dyes then, thereby realizes the differentiation of clinical sample nonsmall-cell lung cancer different subtype.Certainly, on the aptamer basis different with the affinity of the non-small cell lung cancer cell of different subtype, the technical selection any means of prior art is carried out somatotype to the different non-small cell lung cancer subtypes cell again.
The non-small cell lung cancer cell of said different subtype can be gland cancer hypotype cell, large cell carcinoma hypotype cell or squama cancer hypotype cell.
Said gland cancer hypotype cell specifically can be the A549 cell; Said large cell carcinoma hypotype cell specifically can be HLAMP cell or NCI-H460 cell; Said squama cancer hypotype cell specifically can be NCI-H520 cell or NCI-H157 cell.
The present invention also protects screening to state the method for aptamer, comprises the steps: with target cell nucleic acid library to be screened, and obtains the aptamer with the target cell specific combination; Said nucleic acid library is a library of single stranded random nucleotide sequence; Said target cell is the hypotype cell in the non-small cell lung cancer cell.
Said method for screening specifically comprises the steps:
(1) be the initial nucleic acid library with said nucleic acid library;
(2) solution and the target cell with said initial nucleic acid library hatches, and the part nucleotide sequence combines in target cell and the initial nucleic acid library, separates, and obtains and target cell bonded nucleotide sequence library;
(3) hatch with solution and non-target cell target cell bonded nucleotide sequence library said, separate and remove and said non-target cell bonded nucleotide sequence, obtain nucleotide sequence with the target cell specific combination;
(4) obtain aptamer.
In the said step (2), also can comprise the steps: obtain with target cell bonded nucleotide sequence library after, pcr amplification said with target cell bonded nucleotide sequence library, and be prepared into strand.
In the said step (3), also can comprise the steps: behind the nucleotide sequence that obtains with the target cell specific combination, the nucleotide sequence of pcr amplification and target cell specific combination, and be prepared into strand.
In the said method for screening; Said step (3) afterwards, step (4) before; Comprise operation below at least 1 time: with said and the nucleotide sequence target cell specific combination is the initial nucleic acid library; Repeating step (2) and (3), before each operation all in the single job that obtain and the nucleotide sequence target cell specific combination be the initial nucleic acid library.
In the said screening method, but each take turns screening and progressively increase screening pressure, to promote the enrichment degree of aptamer.Said increase screening pressure can be linear incubation time of nucleotide sequence library and target cell and the incubation time that corresponding linear increases nucleotide sequence library and non-target cell of reducing.
Said target cell specifically can be gland cancer hypotype cell; Said non-target cell specifically can be large cell carcinoma hypotype cell.
The formation of lung cancer is the tumorigenesis process of a multistep.Some molecule abnormalities are also followed the formation of tumour and are taken place, and in tumour, express or express excessively like some molecules, or change.Utilize aptamer of the present invention, can under present nonsmall-cell lung cancer tumor markers condition of unknown, realize the differentiation of nonsmall-cell lung cancer different subtype from the molecules in response signal rather than from cell physics pattern.Utilize aptamer of the present invention; It is combined the evaluation of target; To help the discovery of the tumor markers of nonsmall-cell lung cancer different subtype, help nonsmall-cell lung cancer diagnosis and somatotype more accurately more early, help the drug target of finding that oncotherapy is new.
Description of drawings
Fig. 1 is the fit enrichment process with the screening round of embodiment 1 amplifying nucleic acid; On behalf of A549 cell and fluorescein isothiocyanate (FITC) mark library and the 1st, peak shape take turns, the 6th take turns, the 21st is taken turns product bonded situation
Fig. 2 discerns the result of nonsmall-cell lung cancer tissue slice for the aptamer of using tetramethyl-rhodamine mark.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment like no specified otherwise, is ordinary method.Used test materials among the following embodiment like no specified otherwise, is to buy from routine biochemistry reagent shop and obtains.
Gland cancer A549 clone is available from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences/preclinical medicine institute of China Concord Medical Science University cell centre, and catalog number is CCC0002.Squama cancer NCI-H520 clone is available from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences/preclinical medicine institute of China Concord Medical Science University cell centre, and catalog number is CCC0197.Squama cancer NCI-H157 clone is available from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences/preclinical medicine institute of China Concord Medical Science University cell centre, and catalog number is CCC0113.Large cell carcinoma HLAMP is available from Zhongshan Medical Univ.'s Experimental Animal Center.Large cell carcinoma NCI-H460 clone is available from typical case's culture collection council of Chinese Academy of Sciences cell bank, and catalog number is TCHu39.
Embodiment 1, be used for the screening of the aptamer of classification of different-subtype non-small cell lung cancers
One, the design in random nucleic acid library is with synthetic
The synthetic two ends of design comprise 20 Nucleotide, centres and comprise that the random nucleic acid sequence library of 45 Nucleotide is following: 5 '-ACGCTCGGATGCCACTACAG (N
45) CTCATGGACGTGCTGGTGAC-3 '.
Two, the screening of aptamer
The random nucleic acid library is dissolved in (PBS, 150mM NaCl, 5mM MgCl in the binding buffer liquid
2, 1mg/ml yeast transfer RNA(tRNA)), with lung adenocarcinoma cell be that the A549 cell was hatched on ice 1 hour; Through washing buffer solution (PBS, 150mMNaCl, 5mM MgCl
2) after the washing, the A549 cell is scraped from getting off, will dissociate with cell surface bonded DNA through heating then; Dissociated DNA and maxicell lung cancer cell line HLAMP cell were hatched 1 hour on ice; Collect supernatant and be template, utilize primer (FITC-5 '-ACGCTCGGATGCCACTACAG-3 ' and Biotin-5 '-GTCACCAGCACGTCCATGAG-3 ') to carry out pcr amplification with wherein DNA; The PCR product of the plain mark of the dextran bead separating bio that encapsulates through avidin after the amplification utilizes the sodium hydroxide of 0.2M that the double-stranded DNA sex change is unwind then, collects the dna single chain of FITC mark, is used for the next round screening after these dna single chain desalinations.
Aptamer for the different non-small cell different subtypes of the differentiation that obtains high-affinity; In the process of screening; Through gradually reducing the time that DNA library and target cell hatch, increase washing times and washing time and strengthen screening pressure with time that control cells is hatched.Aptamer is seen Fig. 1 with the enrichment process of screening round.
25 take turns screening after, be that template is passed through primer (5 '-ACGCTCGGATGCCACTACAG-3 ' and 5 '-GTCACCAGCACGTCCATGAG-3 ') and carried out pcr amplification with the screening product, the PCR product is checked order, obtain following aptamer sequence:
Aptamer 1:5 '-CGCG
TGTGGGGAGGGGGGTGGGTTTTATAGCGCG-3 ';
Aptamer 2:5 '-
CAATTGGGTGTAGGGGTGGGGATTGTGGGTTG-3 ';
Aptamer 3a:5 '-ATGCCAC
AGTGGGGGGGTGGGTGGGTGGCAT-3 ';
Aptamer 3b:5 '-TCGGATGC
TGGGTGGGGGGGAAGAGCATCCGA-3 ';
Aptamer 3c:5 '-CCACTAC
GAGGGTGGGCGGGTGGAGTAGTGG-3 ';
Aptamer 3d:5 '-GATC
GGTGGGTGGGGGGGTTGGAGATC-3 ';
Aptamer 3e:5 '-CGAACA
GGTGGGTGGGTTGGGTGGATTGTTCG-3 ';
Aptamer 3f:5 '-GATTAA
GTGGGTGGGGGGGTGGAAGTTAATC-3 ';
Aptamer 4:5 '-
GCTATCTTATGGAAATTTCGTGTAGGGTTTGGTGTGGCGGGGCTA-3 '.
The aptamer that obtains is processed molecular probe at 5 ' end mark fluorescent molecule respectively, get 0,5,10,20,40,80,100,120 respectively, the molecular probe solution of 200nM, with 5 * 10
5Individual lung adenocarcinoma cell is that the A549 cell is after hatching 50 minutes on ice; With twice of binding buffer liquid washing; Use the fluorescence intensity of cells were tested by flow cytometry cell surface then; Like the aptamer of cell ability combined with fluorescent mark, then concentration and probe concentration is mapped with fluorescence intensity, calculate the equilibrium dissociation constant Kd of aptamer with formula Y=BmaxX/ (Kd+X).The result shows, the equilibrium dissociation constant of aptamer is all being received in the scope of rubbing.
Embodiment 2, application aptamer carry out somatotype to the small cell lung cancer that carries out different subtype
4 aptamers that obtain with fluorescein isothiocyanate (FITC) mark embodiment 1.Random nucleic acid library with fluorescein isothiocyanate (FITC) mark embodiment 1.
With the different tumour cells of cultivating with PBS washed twice, 0.02%EDTA processing 3 minutes then, use the PBS washed twice again.
Every kind of tumour cell carries out following four groups of processing respectively, and each processing is provided with three repetitions, results averaged:
Handle one: the cell of getting respectively about 300,000 through the cell numeration is scattered in the binding buffer solution, adds fit 1 (ultimate density is 100nM) of fluorescein isothiocyanate (FITC) labeling nucleic acid then.
Handle two: the cell of getting respectively about 300,000 through the cell numeration is scattered in the binding buffer solution, adds fit 2 (ultimate density is 100nM) of fluorescein isothiocyanate (FITC) labeling nucleic acid then.
Handle three: the cell of getting respectively about 300,000 through the cell numeration is scattered in the binding buffer solution, adds the fit 3e of fluorescein isothiocyanate (FITC) labeling nucleic acid (ultimate density is 100nM) then.
Handle four: the cell of getting respectively about 300,000 through the cell numeration is scattered in the binding buffer solution, adds fit 4 (ultimate density is 100nM) of fluorescein isothiocyanate (FITC) labeling nucleic acid then.
The mixed solution of four processing was hatched on ice 50 minutes, utilized flow cytometer to detect aptamer behind twice of the centrifuge washing and different tumour cells combine situation.Do flow cytometer after the random library of cell and FITC mark hatched and detect, set a fluorescence intensity level greater than 95% cell fluorescence intensity as flow cytometer background fluorescence value.Combine the back fluorescence intensity to surpass the binding ability strong and weak (0:＜15% of the percentage of cells of this threshold value with aptamer with cell as measurement aptamer and cell; +: 15-30%; ++: 30-65%; +++: 65-85%; ++ ++＞85%).
The result sees table 1.
Table 1 aptamer carries out the flow cytometer detected result of somatotype to the nonsmall-cell lung cancer different subtype
Aptamer 1 for fluorescein isothiocyanate (FITC) mark; The cell of gland cancer hypotype has 65-85% with the percentage of cells that fluorescence intensity after it combines is higher than threshold value; The cell of large cell carcinoma hypotype has 15-30% with the percentage of cells that fluorescence intensity after it combines is higher than threshold value, the cell of squama cancer hypotype and fluorescence intensity after it combines in the percentage of cells of threshold value less than 15%; Aptamer 2 for fluorescein isothiocyanate (FITC) mark; The cell of gland cancer hypotype has more than 85% with the percentage of cells that fluorescence intensity after it combines is higher than threshold value; The cell of large cell carcinoma hypotype has 30-65% with the percentage of cells that fluorescence intensity after it combines is higher than threshold value, and the percentage of cells that the cell of squama cancer hypotype and fluorescence intensity after it combines are higher than threshold value is less than 15%; Aptamer 3e for fluorescein isothiocyanate (FITC) mark; The cell of gland cancer hypotype has more than 85% with the percentage of cells that fluorescence intensity after it combines is higher than threshold value; The cell of large cell carcinoma hypotype has 65-85% with the percentage of cells that fluorescence intensity after it combines is higher than threshold value, and the cell of squama cancer hypotype has 15-65% with the percentage of cells that fluorescence intensity after it combines is higher than threshold value; Aptamer 4 for fluorescein isothiocyanate (FITC) mark; The cell of gland cancer hypotype has more than 85% with the percentage of cells that fluorescence intensity after it combines is higher than threshold value; The cell of large cell carcinoma hypotype has 65-85% with the percentage of cells that fluorescence intensity after it combines is higher than threshold value, and the percentage of cells that the cell of squama cancer hypotype and fluorescence intensity after it combines are higher than threshold value is less than 15%.
The result shows: utilize above aptamer all can realize the differentiation of different non-small cell lung cancer subtypes with the strong and weak collection of illustrative plates that combines of different non-small cell lung cancer subtypes.
Embodiment 3, detect the listed aptamer of table 1 and combine with cancerous lung tissue is cut into slices
Be dipped in the YLENE room temperature dewaxing 2 times from the paraffin-embedded tissue slice of different patients with lung cancer volunteers' formaldehyde fixed, each 20 minutes, be dipped in subsequently aquation in the serial ethanol (100%, twice, each 1 minute; 95% ethanol, 1 time, 1 minute; 70% ethanol, 1 time, 1 minute).Subsequently the tissue slice of aquation is dipped in the buffered soln 95 ℃ of heating 15 minutes.After treating that tissue slice recovers room temperature; Hatched 1 hour with the binding buffer liquid chamber temperature that contains 20% foetal calf serum and calf thymus DNA, tissue slice after washing respectively with the aptamer (200nM) of tetramethyl-Luo Dan name mark incubated at room 1 hour in binding buffer liquid.Tissue slice is washed 3 times with lavation buffer solution in the dyeing back, waits to do the back mounting and detects.
The result sees Fig. 2.
After the different somatotype patients' of three kinds of nonsmall-cell lung cancers tissue slice was hatched with the aptamer 1 of tetramethyl-Luo Dan name mark respectively, the fluorescence intensity level of the tissue slice of gland cancer hypotype was 357.59, and large cell carcinoma and squama cancer are respectively 214.99 and 181.06.After the different somatotype patients' of nonsmall-cell lung cancer tissue slice was hatched with the aptamer 2 of tetramethyl-Luo Dan name mark respectively, the fluorescence intensity level of the tissue slice of gland cancer hypotype was 289.79, and large cell carcinoma and squama cancer are respectively 220.05 and 182.20.After the different somatotype patients' of nonsmall-cell lung cancer tissue slice was hatched with the aptamer 3e of tetramethyl-Luo Dan name mark respectively, the fluorescence intensity level of the tissue slice of gland cancer hypotype was 492.38, and large cell carcinoma and squama cancer are respectively 203.48 and 212.54.After the different somatotype patients' of nonsmall-cell lung cancer tissue slice was hatched with the aptamer 4 of tetramethyl-Luo Dan name mark respectively, the fluorescence intensity level of the tissue slice of gland cancer hypotype was 482.83, and large cell carcinoma and squama cancer are respectively 219.33 and 218.31.
Experimental result shows that resulting aptamer can combine with the adenocarcinoma of lung high-affinity, thereby can be used for the detection and the diagnosis of adenocarcinoma of lung clinically.
Claims (1)
1. aptamer is the sequence 3 of sequence table, sequence 4, sequence 5, sequence 6, sequence 7, sequence 8, sequence 11, sequence 12, sequence 13, sequence 14, sequence 15 and sequence 16 dna fragmentation shown in arbitrary.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102560936A CN101955939B (en) | 2009-04-28 | 2009-04-28 | Aptamer for grouping different subtype non-small cell lung cancers and screening method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102560936A CN101955939B (en) | 2009-04-28 | 2009-04-28 | Aptamer for grouping different subtype non-small cell lung cancers and screening method thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910083075XA Division CN101538570B (en) | 2009-04-28 | 2009-04-28 | Aptamer for typing different subtypes of non-small cell lung cancer and method for screening the same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101955939A CN101955939A (en) | 2011-01-26 |
| CN101955939B true CN101955939B (en) | 2012-07-25 |
Family
ID=43483526
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102560936A Expired - Fee Related CN101955939B (en) | 2009-04-28 | 2009-04-28 | Aptamer for grouping different subtype non-small cell lung cancers and screening method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101955939B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102229932B (en) * | 2011-06-03 | 2013-02-27 | 湖南大学 | Nucleic acid aptamer capable of identifying HCV E1E2 (hepatitis C virus E1E2), nucleic acid aptamer derivatives and screening method and application thereof |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102628047B (en) * | 2011-05-26 | 2013-09-11 | 中国科学院化学研究所 | Nucleic acid aptamer rich in guanine and application thereof |
| CN102628046B (en) * | 2011-05-26 | 2013-09-11 | 中国科学院化学研究所 | Nucleic acid aptamer rich in guanine |
| CN102220335B (en) * | 2011-05-26 | 2012-07-25 | 中国科学院化学研究所 | Guanine-rich nucleic acid aptamer and application thereof |
| CN102864150B (en) * | 2011-06-03 | 2013-08-21 | 湖南大学 | Nucleic acid aptamer capable of recognizing HCV NS5A protein, and derivatives, screening method and application thereof |
| CN102229933A (en) * | 2011-06-03 | 2011-11-02 | 湖南大学 | Aptamer capable of identifying hepatitis C virus (HCV) nonstructural 5A (NS5A) protein, derivatives thereof and screening method and use thereof |
| CN103305521B (en) * | 2012-03-06 | 2016-06-08 | 复旦大学附属华山医院 | The sequence of the aptamer of a kind of stomach cancer cell and application |
| CN102719430B (en) * | 2012-06-13 | 2013-06-12 | 湖南大学 | Nucleic acid aptamer molecular beacon probe for detecting histidine-tag recombinant proteins and detection method thereof |
| CN102980844B (en) * | 2012-12-10 | 2014-09-17 | 同济大学 | Method for detecting washed surface of optical substrate used for laser thin film element |
| CN103642810B (en) * | 2013-11-20 | 2016-01-20 | 中山大学附属第三医院 | Application in a kind of aptamer and screening method, the before detection strain of row adenocarcinoma cell |
| WO2016129531A1 (en) * | 2015-02-10 | 2016-08-18 | 日産化学工業株式会社 | Dna aptamer capable of binding to non-small cell lung cancer cell (h1975) |
-
2009
- 2009-04-28 CN CN2010102560936A patent/CN101955939B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| Hui William Chen et al..Molecular Recognition of Small-Cell Lung Cancer Cells Using Aptamers.《ChemMedChem》.2008,第3卷(第6期),991-1001. * |
| Zilong Zhao et al..Recognition of non-small-cell cell lung cancer bu DNA aptamers selected from living cells.《Analyst》.2009,第134卷1808-1814. * |
| 张贝等.核酸适配子及其在肿瘤诊断与治疗中的应用.《国际肿瘤学杂志》.2006,第33卷(第10期),756-759. * |
| 齐永志等.适配子在实验诊断中的应用进展.《国际检验医学杂志》.2006,第27卷(第8期),724-728. * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102229932B (en) * | 2011-06-03 | 2013-02-27 | 湖南大学 | Nucleic acid aptamer capable of identifying HCV E1E2 (hepatitis C virus E1E2), nucleic acid aptamer derivatives and screening method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101955939A (en) | 2011-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101955939B (en) | Aptamer for grouping different subtype non-small cell lung cancers and screening method thereof | |
| CN101538570B (en) | Aptamer for typing different subtypes of non-small cell lung cancer and method for screening the same | |
| Dickey et al. | Oligonucleotide aptamers: A next-generation technology for the capture and detection of circulating tumor cells | |
| Chang et al. | Using aptamers for cancer biomarker discovery | |
| CN101475984A (en) | Non-small cell lung cancer detection marker, detection method thereof, related biochip and reagent kit | |
| JP2009526242A (en) | Gene expression assays performed by elemental analysis | |
| CN101424640A (en) | Method for detecting miRNA in blood serum, detection kit, biochip, making method thereof and application method | |
| US11047858B2 (en) | Method for detecting and typing rare tumor cells in body fluid sample and kit therefor | |
| CN106460053A (en) | MIRNA expression signature in classification of thyroid tumors | |
| CN103387989A (en) | Aptamer EpCAM (epithelial cell adhesion molecule) D of EpCAM and preparation method thereof | |
| CN101914542B (en) | Aptamer for typing different non-small cell lung cancer subtypes and screening method thereof | |
| CN110257382A (en) | The aptamer and its screening technique and purposes of identification intestinal cancer serum markers | |
| CN101988061A (en) | Breast cancer detecting marker as well as detecting method, kit and biological chip thereof | |
| CN109337909B (en) | Aptamer for detecting liver cancer drug-resistant cell strain and application thereof | |
| CN112501173B (en) | GPC1 DNA aptamer and application thereof | |
| Luo et al. | Plasma exosomal miR-450b-5p as a possible biomarker and therapeutic target for transient ischaemic attacks in rats | |
| CN101914543B (en) | Nucleic acid aptamer for classification of different-subtype non-small cell lung cancers and screening method thereof | |
| CN112680452A (en) | Oligonucleotide aptamer specifically binding to lung cancer serum and application thereof | |
| CN110004149A (en) | A kind of aptamer of programmed death receptor-ligand 1 and its application | |
| CN105624166B (en) | A kind of aptamer for detecting Human Bladder Transitional Cell Carcinoma cell and its application in detection preparation is prepared | |
| CN101307361A (en) | Method for identifying miRNA in blood serum of patient with lung cancer by Solexa technology | |
| CN101988062A (en) | cervical cancer detection markers and detection method, kit and biochip thereof | |
| CN102851283B (en) | MicroRNA markers for discriminating metastatic and non-metastatic squamous cell lung carcinoma | |
| CN108103178A (en) | The high-throughput detection kit and detection method of neoplastic hematologic disorder fusion | |
| CN107299129A (en) | Circle nucleic acid as breast cancer biomarker application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120725 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |