CN101914542B - Aptamer for typing different non-small cell lung cancer subtypes and screening method thereof - Google Patents

Aptamer for typing different non-small cell lung cancer subtypes and screening method thereof Download PDF

Info

Publication number
CN101914542B
CN101914542B CN 201010256095 CN201010256095A CN101914542B CN 101914542 B CN101914542 B CN 101914542B CN 201010256095 CN201010256095 CN 201010256095 CN 201010256095 A CN201010256095 A CN 201010256095A CN 101914542 B CN101914542 B CN 101914542B
Authority
CN
China
Prior art keywords
aptamer
cell
lung cancer
cell lung
small cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN 201010256095
Other languages
Chinese (zh)
Other versions
CN101914542A (en
Inventor
方晓红
赵子龙
徐丽
上官棣华
谭蔚泓
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Chemistry CAS
Original Assignee
Institute of Chemistry CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Chemistry CAS filed Critical Institute of Chemistry CAS
Priority to CN 201010256095 priority Critical patent/CN101914542B/en
Publication of CN101914542A publication Critical patent/CN101914542A/en
Application granted granted Critical
Publication of CN101914542B publication Critical patent/CN101914542B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an aptamer for typing different non-small cell lung cancer subtypes and a screening method thereof. The aptamer provided by the invention is a DNA segment containing a nucleotide shown as any one of formulae 1 to 9 in a sequence table, can be applied to the cell typing of the different non-small cell lung cancer subtypes, can realize the distinguishing of the different non-small cell lung cancer subtypes by molecule response signals under the condition that tumor markers of non-small cell lung cancer are unknown, and is combined with targets for identification so as to be favorable for discovering the tumor markers of the different non-small cell lung cancer subtypes, earlier diagnosing and more accurately typing the non-small cell cancer and discovering novel medicament functional targets for tumor treatment.

Description

A kind of aptamer and the screening method thereof that are used for classification of different-subtype non-small cell lung cancers
The application is that application number is 200910083075.X, the applying date to be on 04 28th, 2009, invention and created name dividing an application for " aptamer and the screening method thereof that are used for classification of different-subtype non-small cell lung cancers ".
Technical field
The present invention relates to a kind of aptamer for classification of different-subtype non-small cell lung cancers and screening method thereof.
Background technology
Lung cancer is one of the most fatal cancer, is divided into small cell lung cancer and nonsmall-cell lung cancer in histology, and wherein the latter accounts for 80% of lung cancer case.Nonsmall-cell lung cancer is divided into again gland cancer, squama cancer and large cell carcinoma three class hypotypes.Gland cancer accounts for 40% of nonsmall-cell lung cancer as a kind of topmost hypotype.It is by stages residing that the prognosis of nonsmall-cell lung cancer depends critically upon when making a definite diagnosis disease, and according to existing treatment level, 5 years survival rates of patient drop to 1% of the IV phase from 60% of the I phase.Although the detection method in lung cancer has obtained greater advance, 70% the patient of still having an appointment at present has been in advanced lung cancer when making a definite diagnosis.Treatment on the nonsmall-cell lung cancer different subtype applies similar methods for the treatment of and does not consider that the heterogeneity between the hypotype is the major reason that affects the Treatment for Non-small Cell Lung effect.Although the tumor markerses such as neuronspecific enolase, CYFRA21-1, carcinomebryonic antigen, sugar antigen are used for detection and the postoperative evaluation of lung cancer at present, but these tumor markerses are to lung cancer, and specificity and the susceptibility of especially different lung cancer hypotypes are inadequate.The somatotype of nonsmall-cell lung cancer and diagnosis still mainly rely on the cell physical aspect to judge, development can be from the novel agent of molecular level reflection nonsmall-cell lung cancer feature, and is to reduce non-small cell lung mortality of carcinoma important means in order to carry out Subtypes and early diagnosis.
Aptamer (Aptamer claims again aptamers, aptamer) is the few nucleic acid molecule (ssDNA or ssRNA) of the strand in conjunction with certain biological target of energy high-affinity, high specific.The target of having reported aptamer comprises metal ion, organic molecule, polypeptide, protein, cell even tissue etc.The molecular recognition function of aptamer and antibody class are seemingly, but compare with antibody and to have a lot of good characteristics, as non-immunogenicity, easily synthetic and mark, product can not there are differences and have fine chemical stability between penetrate tissue, good dynamic metabolism, the different batches fast, has important application prospect in fields such as biological detection, medical diagnosis on disease treatments.
Summary of the invention
The purpose of this invention is to provide a kind of aptamer for classification of different-subtype non-small cell lung cancers and screening method thereof.
The dna fragmentation of aptamer provided by the invention is the sequence 1 that the contains ordered list Nucleotide shown in arbitrary to the sequence 9.
Dna fragmentation shown in the sequence 1 that described aptamer specifically can be sequence table is arbitrary to the sequence 16.
Aptamer 1:5 '-CGCG TGTGGGGAGGGGGGTGGGTTTTATAG CGCG-3 '; See the sequence 10 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 1 of seeing sequence table;
Aptamer 2:5 '- CAATTGGGTGTAGGGGTGGGGATTGTGGGTTG-3 '; See the sequence 2 of sequence table; Aptamer 3a:5 '-ATGCCAC AGTGGGGGGGTGGGTGGGTGGCAT-3 '; See the sequence 11 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 3 of seeing sequence table;
Aptamer 3b:5 '-TCGGATGC TGGGTGGGGGGGAAGAGCATCCGA-3 '; See the sequence 12 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 4 of seeing sequence table;
Aptamer 3c:5 '-CCACTAC GAGGGTGGGCGGGTGGAGTAGTGG-3 '; See the sequence 13 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 5 of seeing sequence table;
Aptamer 3d:5 '-GATC GGTGGGTGGGGGGGTTGGAGATC-3 '; See the sequence 14 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 6 of seeing sequence table;
Aptamer 3e:5 '-CGAACA GGTGGGTGGGTTGGGTGGATTGTTCG-3 '; See the sequence 15 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 7 of seeing sequence table;
Aptamer 3f:5 '-GATTAA GTGGGTGGGGGGGTGGAAGTTAATC-3 '; See the sequence 16 of sequence table; What wherein add the thick underline mark is target sequence, the sequence 8 of seeing sequence table;
Aptamer 4:5 '- GCTATCTTATGGAAATTTCGTGTAGGGTTTGGTGTGGCGGGGCTA-3 '; See the sequence 9 of sequence table.
Wherein, the Nucleotide beyond the target sequence can be with other complementary Nucleotide replacement in every dna sequence dna.
Wherein, aptamer 3a, aptamer 3b, aptamer 3c, aptamer 3d, aptamer 3e and aptamer 3f comprise a conserved sequence G 1T 1GGGTGGGG 2GGGT 2G 3GA.G wherein 1Can delete T 1G can be replaced by Nucleotide A 2Can be replaced T by Nucleotide C or TT 2G can be replaced by Nucleotide A 3Can be replaced by Nucleotide A or delete.
Also described aptamer can be modified or transformed, obtain the derivative of described aptamer, the derivative of described aptamer can be:
A) with described aptamer deletion or increase the complementary Nucleotide of part, what obtain has the derivative of the aptamer of identical function with described aptamer.
B) described aptamer is carried out Nucleotide replaces or part is modified, what obtain has the derivative of the aptamer of identical function with described aptamer.
C) skeleton with described aptamer transform phosphorothioate backbone as, and what obtain has the derivative of the aptamer of identical function with described aptamer.
D) transform aptamer as peptide nucleic acid(PNA), what obtain has the derivative of the aptamer of identical function with described aptamer.
E) described aptamer is connected upper fluorescence, radioactivity and therapeutic substance after, what obtain has the derivative of the aptamer of identical function with described aptamer.
The present invention also protects the application of described aptamer in the different non-small cell lung cancer subtypes cell typing.
Described aptamer is different from the affinity of the non-small cell lung cancer cell of different subtype.Can obtain different binding signals after both are hatched, thereby can distinguish the nonsmall-cell lung cancer different subtype by the form of single aptamer signal or a plurality of aptamer molecular linkage maps.Also described aptamer can be carried out fluorescent mark, then the tissue slice of lung cancer patient be dyeed, thus the differentiation of realization clinical sample nonsmall-cell lung cancer different subtype.Certainly, on the aptamer basis different from the affinity of the non-small cell lung cancer cell of different subtype, the technical selection any means of prior art is carried out somatotype to the different non-small cell lung cancer subtypes cell again.
The non-small cell lung cancer cell of described different subtype can be gland cancer hypotype cell, large cell carcinoma hypotype cell or squama cancer hypotype cell.
Described gland cancer hypotype cell specifically can be the A549 cell; Described large cell carcinoma hypotype cell specifically can be HLAMP cell or NCI-H460 cell; Described squama cancer hypotype cell specifically can be NCI-H520 cell or NCI-H157 cell.
The present invention also protects screening to state the method for aptamer, comprises the steps: with target cell nucleic acid library to be screened, and obtains the aptamer with the target cell specific combination; Described nucleic acid library is the library of the random nucleotide sequence of strand; Described target cell is the hypotype cell in the non-small cell lung cancer cell.
The method of described screening specifically comprises the steps:
(1) take described nucleic acid library as the initial nucleic acid library;
(2) solution and the target cell with described initial nucleic acid library hatches, and target cell part nucleotide sequence in the initial nucleic acid library is combined, and separates, and obtains the nucleotide sequence library of being combined with target cell;
(3) solution and the non-target cell in described nucleotide sequence library of being combined with target cell are hatched, separate and remove the nucleotide sequence of being combined with described non-target cell, obtain the nucleotide sequence with the target cell specific combination;
(4) obtain aptamer.
In the described step (2), also can comprise the steps: behind the nucleotide sequence library that obtains being combined with target cell, the described nucleotide sequence library of being combined with target cell of pcr amplification, and be prepared into strand.
In the described step (3), also can comprise the steps: behind the nucleotide sequence that obtains with the target cell specific combination, the nucleotide sequence of pcr amplification and target cell specific combination, and be prepared into strand.
In the method for described screening, described step (3) afterwards, step (4) before, comprise below 1 time operation at least: take the nucleotide sequence of described and target cell specific combination as the initial nucleic acid library, repeating step (2) and (3), before each operation all in the single job that obtain and the nucleotide sequence target cell specific combination be the initial nucleic acid library.
In the described screening method, but each take turns screening and progressively increase screening pressure, to promote the enrichment degree of aptamer.Described increase screening pressure can be linear incubation time and the corresponding linear incubation time that increases nucleotide sequence library and non-target cell that reduces nucleotide sequence library and target cell.
Described target cell specifically can be gland cancer hypotype cell; Described non-target cell specifically can be large cell carcinoma hypotype cell.
The formation of lung cancer is the tumorigenesis process of a multistep.Some molecule abnormalities are also followed the formation of swelling and ache and are occured, and express in tumour or excessively express such as some molecules, or change.Utilize aptamer of the present invention, can be in the situation that at present nonsmall-cell lung cancer tumor markers the unknown, from the molecules in response signal rather than realize the differentiation of nonsmall-cell lung cancer different subtype from the cell physical pattern.Utilize aptamer of the present invention, to its evaluation in conjunction with target, to be conducive to the discovery of the tumor markers of nonsmall-cell lung cancer different subtype, be conducive to nonsmall-cell lung cancer diagnosis and somatotype more accurately more early, be conducive to the drug target of finding that oncotherapy is new.
Description of drawings
Fig. 1 is the fit enrichment process with the screening round of embodiment 1 amplifying nucleic acid; Peak shape represents A549 cell and fluorescein isothiocyanate (FITC) mark library, and the 1st take turns, the 6th take turns, the 21st situation of taking turns the product combination
The result that Fig. 2 cuts into slices for the aptamer identification Non-Small Cell Lung Carcinoma of using tetramethyl-rhodamine mark.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is ordinary method.Used test materials among the following embodiment if no special instructions, is and purchases available from routine biochemistry reagent shop.
Gland cancer A549 clone is available from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences/preclinical medicine institute of China Concord Medical Science University cell centre, and catalog number is CCC0002.Squama cancer NCI-H520 clone is available from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences/preclinical medicine institute of China Concord Medical Science University cell centre, and catalog number is CCC0197.Squama cancer NCI-H157 clone is available from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences/preclinical medicine institute of China Concord Medical Science University cell centre, and catalog number is CCC0113.Large cell carcinoma HLAMP is available from Zhongshan Medical Univ.'s Experimental Animal Center.Large cell carcinoma NCI-H460 clone is available from typical case's culture collection council of Chinese Academy of Sciences cell bank, and catalog number is TCHu39.
Embodiment 1, be used for the screening of the aptamer of classification of different-subtype non-small cell lung cancers
One, the design in random nucleic acid library is with synthetic
The synthetic two ends of design comprise 20 Nucleotide, centres and comprise that the random nucleic acid sequence library of 45 Nucleotide is as follows: 5 '-ACGCTCGGATGCCACTACAG (N 45) CTCATGGACGTGCTGGTGAC-3 '.
Two, the screening of aptamer
The random nucleic acid library is dissolved in (PBS, 150mM NaCl, 5mM MgCl in the binding buffer liquid 2, 1mg/ml yeast transfer RNA (tRNA)), hatched on ice 1 hour with the lung adenocarcinoma cell line A549 cell; Through washing buffer solution (PBS, 150mMNaCl, 5mM MgCl 2) after the washing, the A549 cell is scraped from getting off, the DNA that then will be combined with cell surface by heating dissociates; The DNA that dissociates and maxicell lung cancer cell line HLAMP cell were hatched 1 hour on ice, collect supernatant liquor and take wherein DNA as template, utilize primer (FITC-5 '-ACGCTCGGATGCCACTACAG-3 ' and Biotin-5 '-GTCACCAGCACGTCCATGAG-3 ') to carry out pcr amplification; By the PCR product of the coated dextran bead separating bio element mark of avidin, then utilize the sodium hydroxide of 0.2M that the double-stranded DNA sex change is unwind after the amplification, collect the dna single chain of FITC mark, be used for the next round screening after these dna single chain desalinations.
Aptamer for the different non-small cell different subtypes of the differentiation that obtains high-affinity, in the process of screening, the time of hatching by gradually reducing DNA library and target cell, increase washing times and washing time and strengthen screening pressure with time that control cells is hatched.Aptamer is seen Fig. 1 with the enrichment process of screening round.
25 take turns screening after, pass through primer (5 '-ACGCTCGGATGCCACTACAG-3 ' and 5 '-GTCACCAGCACGTCCATGAG-3 ') take the screening product as template and carry out pcr amplification, the PCR product is checked order, obtain following aptamer sequence:
Aptamer 1:5 '-CGCG TGTGGGGAGGGGGGTGGGTTTTATAGCGCG-3 ';
Aptamer 2:5 '- CAATTGGGTGTAGGGGTGGGGATTGTGGGTTG-3';
Aptamer 3a:5 '-ATGCCAC AGTGGGGGGGTGGGTGGGTGGCAT-3 ';
Aptamer 3b:5 '-TCGGATGC TGGGTGGGGGGGAAGAGCATCCGA-3 ';
Aptamer 3c:5 '-CCACTAC GAGGGTGGGCGGGTGGAGTAGTGG-3 ';
Aptamer 3d:5 '-GATC GGTGGGTGGGGGGGTTGGAGATC-3 ';
Aptamer 3e:5 '-CGAACA GGTGGGTGGGTTGGGTGGATTGTTCG-3 ';
Aptamer 3f:5 '-GATTAA GTGGGTGGGGGGGTGGAAGTTAATC-3 ';
Aptamer 4:5 '- GCTATCTTATGGAAATTTCGTGTAGGGTTTGGTGTGGCGGGGCTA-3 '.
The aptamer that obtains is made molecular probe at 5 ' end mark fluorescent molecule respectively, get respectively 0,5,10,20,40,80,100,120, the molecular probe solution of 200nM, with 5 * 10 5Individual lung adenocarcinoma cell line A549 cell is after hatching 50 minutes on ice, with twice of binding buffer liquid washing, then use the fluorescence intensity of cells were tested by flow cytometry cell surface, aptamer such as cell energy combined with fluorescent mark, then with fluorescence intensity concentration and probe concentration is mapped, calculate the equilibrium dissociation constant Kd of aptamer with formula Y=BmaxX/ (Kd+X).The result shows, the equilibrium dissociation constant of aptamer is all being received in the scope of rubbing.
Embodiment 2, application aptamer carry out somatotype to the small cell lung cancer that carries out different subtype
4 aptamers that obtain with fluorescein isothiocyanate (FITC) mark embodiment 1.Random nucleic acid library with fluorescein isothiocyanate (FITC) mark embodiment 1.
With the different tumour cells cultivated with PBS washed twice, then 0.02%EDTA processing 3 minutes, use the PBS washed twice again.
Every kind of tumour cell carries out respectively following four groups of processing, and each processing arranges three repetitions, results averaged:
Process one: the cell of getting respectively about 300,000 by cell count is scattered in the binding buffer solution, then adds fit 1 (ultimate density is 100nM) of fluorescein isothiocyanate (FITC) labeling nucleic acid.
Process two: the cell of getting respectively about 300,000 by cell count is scattered in the binding buffer solution, then adds fit 2 (ultimate density is 100nM) of fluorescein isothiocyanate (FITC) labeling nucleic acid.
Process three: the cell of getting respectively about 300,000 by cell count is scattered in the binding buffer solution, then adds the fit 3e of fluorescein isothiocyanate (FITC) labeling nucleic acid (ultimate density is 100nM).
Process four: the cell of getting respectively about 300,000 by cell count is scattered in the binding buffer solution, then adds fit 4 (ultimate density is 100nM) of fluorescein isothiocyanate (FITC) labeling nucleic acid.
The mixed solution of four processing was hatched on ice 50 minutes, utilized flow cytometer to detect aptamer and different tumour cells in conjunction with situation behind twice of the centrifuge washing.Do flow cytometer after the random library of cell and FITC mark hatched and detect, set a fluorescence intensity level greater than 95% cell fluorescence intensity as flow cytometer background fluorescence value.Be combined rear fluorescence intensity with aptamer with cell and surpass the percentage of cells of this threshold value as weighing the binding ability power (0:＜15% of aptamer with cell; +: 15-30%; ++: 30-65%; +++: 65-85%; ++ ++＞85%).
The results are shown in Table 1.
Table 1 aptamer carries out the flow cytometer detected result of somatotype to the nonsmall-cell lung cancer different subtype
Figure BSA00000233884900061
Aptamer 1 for fluorescein isothiocyanate (FITC) mark, the percentage of cells that fluorescence intensity after the cell of gland cancer hypotype and its combination is higher than threshold value has 65-85%, the cell of large cell carcinoma hypotype and its in conjunction with after the fluorescence intensity percentage of cells that is higher than threshold value 15-30% is arranged, the fluorescence intensity after the cell of squama cancer hypotype and its combination in the percentage of cells of threshold value less than 15%; Aptamer 2 for fluorescein isothiocyanate (FITC) mark, the percentage of cells that fluorescence intensity after the cell of gland cancer hypotype and its combination is higher than threshold value has more than 85%, the percentage of cells that fluorescence intensity after the cell of large cell carcinoma hypotype and its combination is higher than threshold value has 30-65%, and the fluorescence intensity after the cell of squama cancer hypotype and its combination is higher than the percentage of cells of threshold value less than 15%; Aptamer 3e for fluorescein isothiocyanate (FITC) mark, the percentage of cells that fluorescence intensity after the cell of gland cancer hypotype and its combination is higher than threshold value has more than 85%, the percentage of cells that fluorescence intensity after the cell of large cell carcinoma hypotype and its combination is higher than threshold value has 65-85%, and the percentage of cells that the fluorescence intensity after the cell of squama cancer hypotype and its combination is higher than threshold value has 15-65%; Aptamer 4 for fluorescein isothiocyanate (FITC) mark, the percentage of cells that fluorescence intensity after the cell of gland cancer hypotype and its combination is higher than threshold value has more than 85%, the percentage of cells that fluorescence intensity after the cell of large cell carcinoma hypotype and its combination is higher than threshold value has 65-85%, and the fluorescence intensity after the cell of squama cancer hypotype and its combination is higher than the percentage of cells of threshold value less than 15%.
The result shows: utilize the strong and weak collection of illustrative plates of combination of above aptamer and different non-small cell lung cancer subtypes all can realize the differentiation of different non-small cell lung cancer subtypes.
Embodiment 3, detect the combination that the listed aptamer of table 1 and cancerous lung tissue are cut into slices
Be dipped in the dimethylbenzene room temperature dewaxing 2 times from the fixing paraffin-embedded tissue slice of different patients with lung cancer volunteers' formaldehyde, each 20 minutes, be dipped in subsequently aquation in the serial ethanol (100%, twice, each 1 minute; 95% ethanol, 1 time, 1 minute; 70% ethanol, 1 time, 1 minute).Subsequently the tissue slice of aquation is dipped in the buffered soln 95 ℃ of heating 15 minutes.After tissue slice recovers room temperature, hatched 1 hour with the binding buffer liquid chamber temperature that contains 20% foetal calf serum and calf thymus DNA, tissue slice after washing respectively with the aptamer (200nM) of tetramethyl-Luo Dan name mark incubated at room 1 hour in binding buffer liquid.Wash tissue slice 3 times with lavation buffer solution after the dyeing, mounting detects after doing.
The results are shown in Figure 2.
After the different somatotype patients' of three kinds of nonsmall-cell lung cancers tissue slice was hatched with the aptamer 1 of tetramethyl-Luo Dan name mark respectively, the fluorescence intensity level of the tissue slice of gland cancer hypotype was 357.59, and large cell carcinoma and squama cancer are respectively 214.99 and 181.06.After the different somatotype patients' of nonsmall-cell lung cancer tissue slice was hatched with the aptamer 2 of tetramethyl-Luo Dan name mark respectively, the fluorescence intensity level of the tissue slice of gland cancer hypotype was 289.79, and large cell carcinoma and squama cancer are respectively 220.05 and 182.20.After the different somatotype patients' of nonsmall-cell lung cancer tissue slice was hatched with the aptamer 3e of tetramethyl-Luo Dan name mark respectively, the fluorescence intensity level of the tissue slice of gland cancer hypotype was 492.38, and large cell carcinoma and squama cancer are respectively 203.48 and 212.54.After the different somatotype patients' of nonsmall-cell lung cancer tissue slice was hatched with the aptamer 4 of tetramethyl-Luo Dan name mark respectively, the fluorescence intensity level of the tissue slice of gland cancer hypotype was 482.83, and large cell carcinoma and squama cancer are respectively 219.33 and 218.31.
Experimental result shows that resulting aptamer can be combined with the adenocarcinoma of lung high-affinity, thereby can be used for clinically the diagnosis and detection of adenocarcinoma of lung.
Figure ISA00000233885100011
Figure ISA00000233885100021
Figure ISA00000233885100031
Figure ISA00000233885100041
Figure ISA00000233885100061
Figure ISA00000233885100071

Claims (1)

1. aptamer is the dna fragmentation shown in the sequence 9 of sequence table.
CN 201010256095 2009-04-28 2009-04-28 Aptamer for typing different non-small cell lung cancer subtypes and screening method thereof Expired - Fee Related CN101914542B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 201010256095 CN101914542B (en) 2009-04-28 2009-04-28 Aptamer for typing different non-small cell lung cancer subtypes and screening method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 201010256095 CN101914542B (en) 2009-04-28 2009-04-28 Aptamer for typing different non-small cell lung cancer subtypes and screening method thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN200910083075XA Division CN101538570B (en) 2009-04-28 2009-04-28 Aptamer for typing different subtypes of non-small cell lung cancer and method for screening the same

Publications (2)

Publication Number Publication Date
CN101914542A CN101914542A (en) 2010-12-15
CN101914542B true CN101914542B (en) 2013-03-06

Family

ID=43322183

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 201010256095 Expired - Fee Related CN101914542B (en) 2009-04-28 2009-04-28 Aptamer for typing different non-small cell lung cancer subtypes and screening method thereof

Country Status (1)

Country Link
CN (1) CN101914542B (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102229933A (en) * 2011-06-03 2011-11-02 湖南大学 Aptamer capable of identifying hepatitis C virus (HCV) nonstructural 5A (NS5A) protein, derivatives thereof and screening method and use thereof
CN103305521B (en) * 2012-03-06 2016-06-08 复旦大学附属华山医院 The sequence of the aptamer of a kind of stomach cancer cell and application
JP2017516501A (en) * 2014-05-30 2017-06-22 ジーンセントリック ダイアグノスティクス， インコーポレイテッド Lung cancer typing method
EP3257940A4 (en) * 2015-02-10 2018-07-04 Nissan Chemical Industries, Ltd. Dna aptamer capable of binding to non-small cell lung cancer cell (h1975)
CN105925582B (en) * 2016-05-03 2019-03-29 中南大学湘雅医院 Non-alcoholic fatty liver cell aptamer and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101287758A (en) * 2005-07-21 2008-10-15 天主教大学基金会 Plexin D1 as a target for tumor diagnosis and therapy

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101287758A (en) * 2005-07-21 2008-10-15 天主教大学基金会 Plexin D1 as a target for tumor diagnosis and therapy

Also Published As

Publication number Publication date
CN101914542A (en) 2010-12-15

Similar Documents

Publication Publication Date Title
CN101955939B (en) Aptamer for grouping different subtype non-small cell lung cancers and screening method thereof
CN101538570B (en) Aptamer for typing different subtypes of non-small cell lung cancer and method for screening the same
Dickey et al. Oligonucleotide aptamers: A next-generation technology for the capture and detection of circulating tumor cells
Wu et al. Ultrasensitive and simultaneous SERS detection of multiplex microRNA using fractal gold nanotags for early diagnosis and prognosis of hepatocellular carcinoma
Chang et al. Using aptamers for cancer biomarker discovery
Ye et al. Asymmetric signal amplification for simultaneous SERS detection of multiple cancer markers with significantly different levels
JP5777269B2 (en) Gene expression assays performed by elemental analysis
CN101475984A (en) Non-small cell lung cancer detection marker, detection method thereof, related biochip and reagent kit
CN101914542B (en) Aptamer for typing different non-small cell lung cancer subtypes and screening method thereof
US11047858B2 (en) Method for detecting and typing rare tumor cells in body fluid sample and kit therefor
CN106460053A (en) MIRNA expression signature in classification of thyroid tumors
CN109337909B (en) Aptamer for detecting liver cancer drug-resistant cell strain and application thereof
CN101988061A (en) Breast cancer detecting marker as well as detecting method, kit and biological chip thereof
CN101914543B (en) Nucleic acid aptamer for classification of different-subtype non-small cell lung cancers and screening method thereof
CN105063194B (en) The diagnosis marker of Parkinson a kind of and its application
Sousa et al. Recent advances in the selection of cancer-specific aptamers for the development of biosensors
CN105624166B (en) A kind of aptamer for detecting Human Bladder Transitional Cell Carcinoma cell and its application in detection preparation is prepared
CN101307361A (en) Method for identifying miRNA in blood serum of patient with lung cancer by Solexa technology
Zhao et al. Dual-aptamer recognition of DNA Logic Gate Sensor-based specific exosomal proteins for ovarian Cancer diagnosis
CN109628594B (en) One kind long-chain non-coding RNA relevant to liver cancer and its application
CN101988062A (en) cervical cancer detection markers and detection method, kit and biochip thereof
CN102851283B (en) MicroRNA markers for discriminating metastatic and non-metastatic squamous cell lung carcinoma
US20120252856A1 (en) Pi3k/akt pathway subgroups in cancer: methods of using biomarkers for diagnosis and therapy
CN108103178A (en) The high-throughput detection kit and detection method of neoplastic hematologic disorder fusion
US20230167504A1 (en) Method for aiding detection of pancreatic cancer

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20130306