CN101955934B - Hemibarbus maculates microsatellite sites and primers - Google Patents
Hemibarbus maculates microsatellite sites and primers Download PDFInfo
- Publication number
- CN101955934B CN101955934B CN 201010518245 CN201010518245A CN101955934B CN 101955934 B CN101955934 B CN 101955934B CN 201010518245 CN201010518245 CN 201010518245 CN 201010518245 A CN201010518245 A CN 201010518245A CN 101955934 B CN101955934 B CN 101955934B
- Authority
- CN
- China
- Prior art keywords
- satellite
- hemibarbus
- primers
- dna
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to hemibarbus maculates microsatellite sites and primers. The invention has the characterized in that the nucleotide sequence of the microsatellite sites is SEQ ID NO:1-10, and the sequence of the microsatellite primers is SEQ ID NO:11-30. In the invention, 10 microsatellite sites are screened out form the DNA of a hemibarbus maculates genome, and specific primers are designed according to the flanking sequence of the sites on both ends of each microsatellite site. Amplification results show that the acquired primers have high polymorphism and stability and can be applied to the fields of population genetic diversity detection, individual identification and molecular-assisted breeding of hemibarbus maculates.
Description
Technical field
The invention belongs to molecular biology dna marker technical field, be specifically related to hemibarbus maculatus microsatellite locus and primer.
Background technology
Flower fish bone (Hemibarbus? Maculates), under the carp, minnow subfamily, fish bone fish are widely distributed in the rivers and lakes, is a common small natural water wild economic fish.But in the more than ten years in past, owing to overfishing, build a dam and dig sand and water pollution, the wild resource of hemibarbus maculatus is by serious destruction.In order to satisfy the demand in market; Hemibarbus maculatus has been carried out propagating artificially on a large scale; But present seed does not pass through artificially breeding; Exist phenomenons such as growth velocity is low, disease resistance difference, therefore, obtaining good breed variety has become one of important topic that China's hemibarbus maculatus aquaculture industry is healthy, Sustainable development is suddenly to be solved.
Family selective breeding is one of important means that obtains improved seeds, in the family selective breeding process, is kept perfectly, pedigree information just can effectively instruct the parent to select and remain accurately, thereby avoids the inbreeding depression phenomenon.In prevalent variety cultivation,, need in early days selected strain to be carried out mark in order to realize the accurate assessment of family genetic parameter.And adopt physical markings that the young is identified the bigger limitation of existence, and short like the mark survival time, cost is high, workload is big, and the young reaches mark size ability mark, can't eliminate problems such as environmental error fully.Therefore, select effective molecule marker for use, carry out the management of high-throughout paternity test and family and become hemibarbus maculatus aquaculture problem demanding prompt solution.
Summary of the invention
The purpose of this invention is to provide hemibarbus maculatus microsatellite locus and polymorphism primer; The microsatellite locus of 10 hemibarbus maculatus promptly is provided; And corresponding polymorphic micro-satellite primer, for providing, the hereditary and selection of hemibarbus maculatus can be used for the molecule marker that population, family are identified, to remedy the deficiency of prior art.
The present invention filters out 10 microsatellite locus through the magnetic bead hybrid method from the hemibarbus maculatus genomic dna, its nucleotide sequence is respectively SEQ ID NO:1-10.
Microsatellite sequence also is included under the stringent condition with above-mentioned nucleotide sequence hybridization, comprises the nucleotide sequence molecule of identical little satellite repeating unit.
Micro-satellite primers of the present invention is forward, the reverse primer that the little satellite repeated flanking sequences from sequence SEQ ID NO:1-10 designs.
The micro-satellite primers sequence is respectively SEQ ID NO:11-30.
Microsatellite locus, site sequence and corresponding primer information such as table 1:
Show 1:10 microsatellite locus and corresponding primer information
Microsatellite polymorphism primer of the present invention is used for hemibarbus maculatus population Diversity Detection, comprises the steps:
1) extraction of genomic dna: adopt the phenol extraction process to extract the hemibarbus maculatus genomic dna;
2) little satellite pcr amplification: with the fluorescently-labeled micro-satellite primers amplification of FMM, HEX and TMR hemibarbus maculatus gene
Group DNA; Obtain the individual little satellite amplified production of hemibarbus maculatus;
3) amplified production electrophoresis: on the MBI3100 automatic DNA sequencer DNA, detect, as marking in the molecular weight, individual little satellite amplified production comes analyzing molecules amount size with software GeneMMpper 3.2 with ROX500;
4) analysis of genetic diversity: the molecular weight size according to each individual little satellite amplified production is confirmed genotype, utilizes GENEPOP Version 3.4 to calculate the genetic diversity parameter;
Above-mentioned micro-satellite primers is selected from the micro-satellite primers that sequence is respectively SEQ ID NO:11-30.
The present invention filters out 10 microsatellite locus from the hemibarbus maculatus genomic dna; And according to the flanking sequence design specific primers of these sites at the microsatellite locus two ends; Use the amplification of the primer that obtains to have high polymorphum and stability; The population Diversity Detection that can be used for hemibarbus maculatus, the individual evaluation and the marker assisted selection field.
Embodiment
One, the screening of microsatellite locus
1, extracting genome DNA, enzyme are cut and are reclaimed:
Extract the hemibarbus maculatus genomic dna with the phenol extraction process: each individuality takes by weighing 100mg muscle, after twice of sterile water wash, shreds the back and adds 10mM Tris-Hcl pH 8.0; 20mM EDTA pH 8.0,10mM NaCl, 1%SDS; The lysate 600 μ l of 100 μ g/mlproteinase K, after 55 ℃ of digestive muscular, the centrifugal 10min of 12000rpm; Get supernatant in new 1.5ml centrifuge tube, additional proportion is 25: 24: 1 phenol, chloroform and primary isoamyl alcohol and extracting twice, after ratio is 24: 1 chloroforms and primary isoamyl alcohol extracting once; Water is transferred to the absolute ethyl alcohol that adds-20 ℃ in the new pipe, 12, the centrifugal 10min of 000rpm; 75% ethanol washing and precipitating twice is dried under the room temperature, is dissolved among 100 μ l, 0.1 * TE.
2, enzyme is cut, recovery and joint connect:
Get 100 μ g genomic dnas, partially digested with restriction enzyme SAu 3aI, make the endonuclease bamhi major part at 250～750bp, organic extraction process termination reaction, the absolute ethyl alcohol deposition reclaims, and is dissolved among 200Ml 0.1 * TE.The fragment that enzyme is cut connects with Brown joint (5 ' GTCAAGAATTCGGTACCGTCGAC3 '), and 16 ℃ of connections are spent the night, and 65 ℃ of 10min termination reactions, and cuts glue once more and reclaims.
3, microsatellite sequence separates and pcr amplification:
The enzyme that joint connects is cut genomic DNA fragment and biotin labeled (CA)
15Probe is hybridized.Comprise the dna fragmentation that 15 μ l reclaim in the 50 μ l hybridization solutions, 3 μ l10pmol/ μ l (CA)
15Probe, 15 μ l, 20 * SSC, 0.5 μ l 10%SDS and 17.5 μ l 10pmol/ μ l DDW.After mixing, hybridization solution is behind 95 ℃ of processing 10min, at 60 ℃ of hybridization 1h.Be resuspended to after during this time 100 μ l magnetic beads (Dynal a-280) being cleaned in the 50 μ l hybridization solutions (6 * SSC, 0.1%SDS).Hybridization mixes hybridization reaction solution after finishing with magnetic bead, 30min vibrates under the room temperature.At room temperature use 6 * SSC/0.1%SDS to clean twice, 43 ℃ of 6 * SSC/0.1%SDS cleaning twice down then, 6 * SSC cleans under last twice room temperature.With 50 μ l DDW suspension magnetic beads, on the magnetic post, shift out elutriant fast behind 95 ℃ of processing 5min, as the DNA isolation template.
PCR reaction system 25 μ l include the dna profiling of 5 μ l wash-outs and the primer OligoA of 10pmol, and response procedures is: behind 94 ℃ of sex change 5min, and 94 ℃ of sex change 30s of 20 circulations, the 60 ℃ of 30s that anneal, 72 ℃ are extended 1min, and last 72 ℃ are extended 7min.Amplified production appears in the 500-1000bp scope, and rubber tapping is reclaimed.
4, dna fragmentation clone, order-checking:
Transformed competence colibacillus bacillus coli DH 5 alpha behind the target DNA fragment insertion pGEM-T carrier that rubber tapping is reclaimed.37 ℃ of shaking tables of the bacterium that transforms are applied on penbritin (0.1mg/ml) the LB flat board that adds IPTG (0.024mg/ml) and X-GAl (0.04mg/ml) 37 ℃ of overnight cultures after cultivating 1h.Select single bacterium colony in 96 well culture plates that fill 500 μ l LB/AMP substratum after, 200r/min, 37 ℃ cultivate 7h after, microsatellite locus is confirmed in order-checking.
10 microsatellite locus that the present invention filters out, its dna sequence dna is respectively SEQ ID NOS:1-10, lists the information such as little satellite repeating unit of 10 microsatellite locus in the table 2.
Two, under stringent condition with the hybridization of above-mentioned dna sequence dna, comprise the dna sequence dna of identical little satellite repeating unit
Microsatellite sequence of the present invention also be included under the stringent condition with above-mentioned sequence be that the dna sequence dna of SEQ ID NOS:1-10 can be hybridized respectively, comprise the dna sequence dna molecule of identical little satellite repeating unit; Because can there be different multiplicity in the repeating unit of microsatellite locus, thereby cause little satellite repeat length to change, this also is the reason that the microsatellite locus polymorphum produces.In addition; The diversity sequence that occurs in insertion, disappearance, conversion and the transversion of little satellite repetition flanking sequence and produce; Under stringent condition, being the sequence that the dna sequence dna of SEQ ID NO:1-10 can be hybridized respectively with above-mentioned sequence, also is the hemibarbus maculatus microsatellite locus that the present invention will protect.
Above-mentioned stringent hybridization condition is following, uses the DIG hybridizing method:
(1) the efficient hybridization solution of 10-15ml Hyb added be equipped with in the hybrid pipe or hybridization bag of film, 68 ℃ prehybridization 1-2 hour, discard prehybridization solution;
(2) with the probe of 400ng Dig mark 95 ℃ of sex change 5 minutes, cooling 5 minutes in ice bath fast then; Probe sequence is SEQ ID NO:1-10;
(3) probe is added in the efficient hybridization solution of Hyb of 68 ℃ of preheatings of 10-15ml, mixing adds in hybrid pipe or the hybridization bag, and 68 ℃ of hybridization are spent the night;
(4) remove hybridization solution, wash film;
(5) wash film
A: at room temperature, with 30ml 2xSSC/0.1%SDS washing 2 times, each 5 minutes,
B: next at 65 ℃, with 1x SSC/0.1%SDS washing 2 times, each 15 minutes.
After washing the film end, press the DIG hybridizing method and detect results of hybridization.
Can with the dna sequence dna of the isolating little satellite hybridization of the present invention, for example identical, but little satellite repeating unit (GT) with the flanking sequence of site HMAC1
nMultiplicity n be the DNA of 13 HMAC1v1, its sequence is SEQ ID NO:31.Or it is identical with other the flanking sequence of microsatellite locus; But the multiplicity different sequences of repeating unit; It is identical to comprise that also little satellite repeats, but the different dna molecular of flanking sequence, for example sequence is the HMAC2v1 of SEQ ID NO:32; Compare with SEQ ID NO:2, just variation has taken place in several bases of 5 ' end.
Three, micro-satellite primers
Micro-satellite primers of the present invention is from the design of the flanking sequence at little satellite Tumor-necrosis factor glycoproteins two ends, uses primer of the present invention and can amplify at the PCR product that can hybridize under the above-mentioned stringent condition on the DNA that sequence is SEQ ID NO:1-10.Design of primers adopts software Primer Premier 5.0, and rigorous degree below design of primers adopts: (1) primer length is 15-40bp; (2) GC content 30%-70%; (3) annealing temperature 40-65 ℃; (4) expection PCR product length is 80-350bp.Designed primer can be corresponding hybridizing on the DNA that sequence is SEQ ID NO:1-10 under the stringent condition as above.
Microsatellite polymorphism primer of the present invention, its sequence are respectively SEQ ID NO:11-30.
Four, hemibarbus maculatus population Diversity Detection
1) extraction of genomic dna: adopt the phenol extraction process to extract the hemibarbus maculatus genomic dna of 30 individuals;
2) little satellite pcr amplification:
With the fluorescently-labeled micro-satellite primers amplification of FMM, HEX and TMR hemibarbus maculatus genomic dna;
Reaction system is 25 μ l, comprises 10 * PCR buffer, 2.5 μ l, 25mM MgCl22.0 μ l, 10mM dNTPs 0.5 μ l, each 1 μ l of 10pmol/ μ l upstream and downstream primer, 5U/ μ l Taq archaeal dna polymerase 0.2 μ l, genomic dna 1 μ l (10～20ng).The PCR response procedures is 94 ℃ of sex change 5min, 94 ℃ of sex change 30s next, and the annealing temperature 30s that primer is specific, 72 ℃ are extended 45s, carry out 30 circulating reactions, and last 72 ℃ are extended 7min.
3) amplified production electrophoresis: on the MBI3100 automatic DNA sequencer DNA, detect, as marking in the molecular weight, individual little satellite amplified production comes analyzing molecules amount size with software GeneMMpper 3.2 with ROX500;
4) analysis of genetic diversity: the molecular weight size according to each individual little satellite amplified production is confirmed genotype; After converting genotype data to (0,1) data that GENEPOP Version 3.4 can discern, utilize GENEPOP Version 3.4 to calculate the genetic diversity parameters; Parameter information such as table 2.
The repeating unit of 2:10 microsatellite locus of table, the relevant information of primer
Wherein, TM represents the annealing temperature of micro-satellite primers, and n represents the allelotrope number, and heterozygosity is observed in the Ho representative, He representative expectation heterozygosity
With primer of the present invention 30 hemibarbus maculatus genomic dnas are increased, the analysis of genetic diversity result shows that from 6 to 18 of the allelotrope numbers of each microsatellite locus do not wait, and average allelotrope number is 10.7.Observe the scope from 0.5873 to 0.8750 of heterozygosity (Ho), the scope from 0.7451 to 0.9379 of expectation heterozygosity (He).
Micro-satellite primers of the present invention can be used for the evaluation of hemibarbus maculatus population Diversity Detection, quantitative character linkage mapping (QTL), genetic linkage mapping and family, individuality.
Claims (4)
1. the little satellite Nucleotide of hemibarbus maculatus, it is characterized in that: the sequence of described little satellite Nucleotide is SEQID NO:1.
2. the hemibarbus maculatus micro-satellite primers that on the flanking sequence of the described little satellite Nucleotide of claim 1, designs is characterized in that described micro-satellite primers sequence is SEQ ID NO:11-12.
3. the described hemibarbus maculatus micro-satellite primers of claim 2 is used for hemibarbus maculatus population Diversity Detection.
4. hemibarbus maculatus population Diversity Detection as claimed in claim 3 comprises the steps:
1) extraction of genomic dna: adopt the phenol extraction process to extract the hemibarbus maculatus genomic dna;
2) little satellite pcr amplification:, obtain the individual little satellite amplified production of hemibarbus maculatus with the fluorescently-labeled micro-satellite primers amplifying genom DNA of FAM, HEX and TMR;
3) amplified production electrophoresis: on the ARI3100 automatic DNA sequencer DNA, detect, as marking in the molecular weight, individual little satellite amplified production comes analyzing molecules amount size with software GeneMapper 3.2 with ROX500;
4) analysis of genetic diversity: the molecular weight size according to each individual little satellite amplified production is confirmed genotype, utilizes GENEPOP Version 3.4 to calculate the genetic diversity parameter.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010518245 CN101955934B (en) | 2010-10-25 | 2010-10-25 | Hemibarbus maculates microsatellite sites and primers |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010518245 CN101955934B (en) | 2010-10-25 | 2010-10-25 | Hemibarbus maculates microsatellite sites and primers |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101955934A CN101955934A (en) | 2011-01-26 |
| CN101955934B true CN101955934B (en) | 2012-01-25 |
Family
ID=43483521
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010518245 Expired - Fee Related CN101955934B (en) | 2010-10-25 | 2010-10-25 | Hemibarbus maculates microsatellite sites and primers |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101955934B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305508A (en) * | 2013-06-03 | 2013-09-18 | 中国水产科学研究院黄海水产研究所 | Marbled flounder microsatellite locus and primer |
| CN104488759B (en) * | 2014-11-20 | 2016-06-15 | 上海海洋大学 | A kind of method of molecule assist-breeding grass carp excellent strain and Breeding Effect checking |
| CN109536620B (en) * | 2018-12-25 | 2021-09-10 | 浙江省淡水水产研究所 | Method and kit for paternity test of xenocypris davidi |
-
2010
- 2010-10-25 CN CN 201010518245 patent/CN101955934B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN101955934A (en) | 2011-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nelson et al. | The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula | |
| CN108060262B (en) | KASP marker related to wheat root system character and application thereof | |
| CN113913533B (en) | SNP molecular marker related to grass carp characters and application thereof | |
| CN110760599B (en) | Cannabis harfish microsatellite molecular marker locus, polymorphism primer and application | |
| CN101955934B (en) | Hemibarbus maculates microsatellite sites and primers | |
| Abd El-Twab et al. | FISH physical mapping of 5S, 45S and Arabidopsis-type telomere sequence repeats in Chrysanthemum zawadskii showing intra-chromosomal variation and complexity in nature | |
| CN114292925A (en) | SSR molecular marker primer related to growth traits of procambarus clarkii and application of SSR molecular marker primer in auxiliary selection | |
| CN103484459A (en) | Primer group, marking method and application of EST-SSR (Expressed Sequence Tag-Simple Sequence Repeats) molecular marker of macrobrachium nipponense | |
| CN108085404B (en) | Strong female-like molecular marker of pumpkin indicum and primer pair for identifying strong female-like character of pumpkin indicum | |
| CN112662802B (en) | Wheat root length molecular marker and application thereof | |
| KR20160096755A (en) | Molecular marker for selecting tomato leaf mold resistant and selection method using the same molecular marker | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| KR101803077B1 (en) | Primer set and method for selection fusarium wilt resistant in cabbage | |
| CN114891897A (en) | Method for screening molecular marker of large yellow croaker DNA methylation and qRT-PCR primer | |
| CN105950729A (en) | SNP (single nucleotide polymorphism) marker related to hevea brasiliensis stem girth and application thereof | |
| Amin et al. | Identification of novel submergence tolerant local rice cultivars of Bangladesh | |
| CN114574597B (en) | SNP marker on chitin binding protein gene related to vibrio parahaemolyticus infection resistance of litopenaeus vannamei and application thereof | |
| CN104762299A (en) | Rice seedling-stage salt-resistant gene qST2 and molecular marking method thereof | |
| CN107574167B (en) | Hyriopsis cumingii microsatellite marker and application thereof | |
| Matoba et al. | Physical mapping of 5S rDNA, 18S rDNA and telomere sequences in three species of the genus Artemisia (Asteraceae) with distinct basic chromosome numbers | |
| CN114438245B (en) | SNP molecular marker linked with peanut bacterial wilt-resistant major QTL locus and application thereof | |
| CN112226519B (en) | Sinocyclocheilus sinensis paternity test kit based on microsatellite marker and method thereof | |
| Setiawan et al. | Repetitive DNA sequences accelerate molecular cytogenetic research in plants with small chromosomes | |
| CN113621709B (en) | Microsatellite marked primer for yellow river carp and method for evaluating release effect of yellow river carp | |
| CN113637777B (en) | SNP molecular marker and primer pair related to eriocheir sinensis anti-vibrio anguillarum, screening method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120125 Termination date: 20121025 |