CN112226519B - A microsatellite marker-based paternity test kit and method for Chinese barb carp - Google Patents

Abstract

The invention discloses a microsatellite marker-based parentage identification kit for Chinese barb and a method thereof. Extract genomic DNA from individual samples of Chinese barb; PCR amplification: The 5' end of the forward primer of each pair of 15 pairs of microsatellite primers in the primer set for Chinese barb paternity test is labeled with a fluorescent substance, using the above Each labeled fluorescent primer in the primer set performs gradient PCR amplification on the obtained DNA genome, and the amplified products are subjected to capillary electrophoresis on a sequencer to read the allele size of each individual to obtain genotyping data; Chinese barbs Paternity test analysis of barb family: Based on genotype data, parent and offspring data are analyzed, and the parent-child relationship between offspring and parent is determined according to the correlation between offspring genotype and parental genotype. The method of the invention is simple and fast, can be popularized and applied in the germplasm identification and family genetic management of Chinese barb, and provides a new technical means for evaluating the effect of proliferation and release.

Description

Microsatellite marker-based paternity test kit and method for Chinese barb carp

technical field

The invention relates to the technical field of fish breeding and molecular markers, and relates to a technology for parentage identification of Chinese barb based on microsatellite markers, in particular to a Chinese barb paternity test kit and a microsatellite PCR identification method.

Background technique

Spinibarbus sinensis belongs to the order Cypriniformes, Cyprinidae, and Spinibarbus, commonly known as "Qingbo". The proportion of fish catch was higher in the Wujiang River Basin and the middle and lower reaches of the Chishui River. Chinese barbs are large in size and lively in nature. They like rapids and rivers with clear water. They grow rapidly and are omnivorous. They are deeply loved by the people. However, in recent years, due to factors such as overfishing, serious water pollution, and habitat destruction caused by the construction and operation of water conservancy projects, the wild resources of Chinese barb have been increasingly depleted. It is very important to carry out research on the protection, restoration and proliferation of seed resources.

The protection of Chinese barb resources mainly adopts the method of artificial proliferation, that is, by breeding Chinese barb parents, after large-scale reproduction and emergence, they are artificially released to rivers to supplement their wild populations and rapidly increase the amount of wild resources. Due to its large size, rapid growth, and wide sources of feeding bait, Chinese barb is suitable for intensive farming in ponds, lakes, reservoirs, and fish breeding stations. Over the years, the research on the nutritional characteristics, artificial breeding and breeding technology of Chinese barbs has been very mature, and large-scale production of adult fish can basically be realized, which has laid the foundation for the large-scale proliferation and release of fry. However, on the one hand, the continuous captive breeding of the breeding population of Chinese barb may easily lead to the inbreeding of the parents, thus resulting in a decrease in the level of genetic diversity of the population; How to quickly and effectively identify different families and sources of Chinese barb, and how to efficiently evaluate their proliferation and release effects, has become one of the main obstacles and important issues for the recovery of Chinese barb population resources.

Microsatellites are a class of simple repetitive DNA sequences with high variability that are widely present in eukaryotic genomes. It has the characteristics of separation according to Mendelian method, rich polymorphism information, and co-dominant inheritance. It can be used for simple and rapid genotype detection and is a widely used genetic molecular marker. At the same time, because of the simple use, stable results and low cost of microsatellite markers, they have been widely used in paternity testing. At present, there is no research report on the application of microsatellite markers to the paternity test of Chinese barb. The invention aims to establish a paternity identification technology for Chinese barbs based on microsatellite markers, and provides a technical approach for family management, population genetic management and effect evaluation of proliferation and release of Chinese barbs.

SUMMARY OF THE INVENTION

The invention relates to a microsatellite marker-based parentage identification kit for Chinese barb and a microsatellite PCR identification method.

The technical scheme adopted in the present invention is as follows:

Provides primer sets for paternity testing of Chinese barb based on microsatellite markers: ZDCB24, ZDCB27, ZHDCB28, ZDCB29, ZDCB33, ZDCB35, ZDCB41, ZDCB43, ZDCB50, ZDCB57, ZDCB58, ZDCB66, ZDCB79, ZDCB80, ZDCB88 , the sequence of each primer is as follows:

。

.

According to the above scheme, the 5' end of the forward primer of each pair of primers is labeled with a fluorescent substance. The fluorescent substance can be selected as FAM fluorescent substance.

A microsatellite marker-based paternity test kit for Chinese barbs is provided, comprising a Taq enzyme PCR premix and the above-mentioned primer set for Chinese barb paternity testing, wherein the main components of the Taq PCR premix are 0.1U/μl TaqDNA polymerase, 2X PCR reaction buffer, 3mM MgCl ₂ , and 0.4mM dNTPs; the concentration of genomic DNA of Chinese barb is 30-50ng/uL; the primer set (15 primers) for Chinese barb paternity test are respectively : ZDCB24, ZDCB27, ZDCB28, ZDCB29, ZDCB33, ZDCB35, ZDCB41, ZDCB43, ZDCB50, ZDCB57, ZDCB58, ZDCB66, ZDCB79, ZDCB80, ZDCB88.

According to the above scheme, the described kit for paternity test of Chinese barb also includes double distilled water.

A microsatellite PCR identification method is provided, comprising the following steps:

(1) Extracting the genomic DNA of the individual samples of Chinese barb: the fin rays and offspring fry individuals of the Chinese barb parent were obtained by high-salt extraction method to obtain the genomic DNA of each individual, and stored for future use;

(2) PCR amplification: 15 pairs of microsatellite primers ZDCB24, ZHDCB27, ZHDCB28, ZHDCB29, ZHDCB33, ZDCB35, ZHDCB41, ZDCB43, ZHDCB50, ZHDCB57, ZHDCB58, ZHDCB66, ZDCB79, The 5' end of the forward primer of each pair of primers in ZHDCB80 and ZHDCB88 is labeled with a FAM fluorescent substance, and the DNA genome obtained in step (1) is subjected to gradient PCR amplification using each labeled fluorescent primer in the above-mentioned primer set, and the amplified product Perform capillary electrophoresis on the sequencer, read the allele size of each individual, and obtain genotyping data;

(3) Paternity identification analysis of the Chinese barb family: Based on the genotype data obtained in step (3), convert the genotype data obtained in step (3) into a format that can be read by biological software, and analyze the parent and offspring data. Correlation between offspring and parents to determine the parent-child relationship.

According to the above scheme, the PCR amplification procedure is as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30s, 62°C→52°C gradient temperature (touch down) annealing for 30s, 72°C extension for 30s, 10 cycles; 95°C Denaturation for 30 s, annealing at 52 °C for 30 s, and extension at 72 °C for 30 s were performed for 22 cycles; the final extension was at 72 °C for 20 min.

According to the above scheme, the PCR reaction system is: 5.0uL Taq enzyme PCR premix (the main components are 0.1U/μl Taq DNA polymerase, 2X PCR reaction buffer, 3mM MgCl ₂ , and 0.4mM dNTPs), 1.0 uL template genomic DNA (concentration 30-50ng/uL), upstream and downstream amplification primers each 0.4uL (concentration 10uM), add 3.2uL ddH2O to the total volume of 10uL.

The present invention is based on carefully selected 15 polymorphic microsatellite sites. After obtaining clear and stable effects, fluorescently labeled microsatellite primers (according to laboratory self-screening and isolation of Chinese barb microsatellite sequences screened for stable amplification) , primers with clear results, strong specificity and high heterozygosity), a total of 15 pairs were screened: ZHDCB24, ZDCB27, ZHDCB28, ZHDCB29, ZHDCB33, ZDCB35, ZDCB41, ZDCB43, ZDCB50, ZDCB57, ZDCB58, ZHDCB66, ZDCB79, ZDCB80, ZDCB88 ) to carry out PCR amplification experiments to obtain microsatellite typing information of parents and offspring, obtain genotype data of parents and offspring in the family, and finally conduct parent-child identification analysis to analyze the correlation between parent and offspring genotypes, so as to determine offspring Parent-child relationship with parents.

Compared with the prior art, the present invention has the following advantages:

(1) The present invention utilizes the combination of fluorescently labeled microsatellite sites and capillary electrophoresis technology, and based on the microsatellite typing of high-throughput sequencing, a parent-child analysis is carried out on the Chinese barb family lineage;

(2) The 15 polymorphic microsatellite sites screened by the present invention are mainly sites of three-base or four-base repeat units, and their amplification effect is stable and clear, which provides a more objective basis for later data regularization .

(3) The establishment of the present invention provides a new technical means for germplasm identification, family genetic management and effect evaluation of proliferation and release of Chinese barb.

Description of drawings

Figure 1 shows the sequencing map of primer ZHDCB027 (in order, parental F1 (genotype: 203/207), parental M1 (genotype: 199/203), and offspring Z1-1 (genotype: 199/207)), two offspring The alleles come from the male and female parents, respectively, in accordance with Mendel's law of segregation

Figure 2 shows the sequence diagram of primer ZHDCB043 (in order, parental F1 (genotype: 228/232), parental M1 (genotype: 228/232), offspring Z1-1 (genotype: 228/228)), two offspring The alleles come from the male and female parents, respectively, in accordance with Mendel's law of segregation

Figure 3 shows the sequencing map of primer ZHDCB080 (in order, parental F1 (genotype: 274/274), parental M1 (genotype: 274/278), and offspring Z1-1 (genotype: 274/278)). The alleles come from the male and female parents, respectively, in accordance with Mendel's law of segregation

Detailed ways

Example:

The present invention will be further described below in conjunction with examples.

A microsatellite marker-based paternity test method for Chinese barb, the steps of which are:

(1) Extraction of genomic DNA from individual samples of Chinese barb: Take out samples of 6 parents and 96 offspring fry obtained by manual pairing, and extract genomic DNA according to the high-salt method. The specific steps are: cut about 0.5g of fin ray tissue (the individual offspring fry is used for all the fry), wash the alcohol adhered to the preserved sample with double-distilled water, fully cut it into pieces, and put it into a 1.5mL centrifuge tube; Add 500 μL of cell lysate and 6 μL of proteinase K to the centrifuge tube, digest in a water bath at 55°C overnight, shake several times in the first 30 minutes; add 500 μL of sodium chloride (4.5 mol/L), 300 μL of chloroform, and mix quickly in a shaker Homogenize for 20 minutes, centrifuge at 13,000 rpm for 10 minutes at 10°C; transfer the supernatant to a new tube (about 850 μL), add 595 μL of anhydrous isopropanol, and mix at medium speed on a shaker for 20 minutes at 13,000 rpm and 10° C. Centrifuge for 10 minutes, discard the supernatant; add 500 μL of 75% ethanol, digest in a water bath at 55°C for 5 minutes, centrifuge at 13,000 rpm and 10°C for 20 minutes, and discard the supernatant; place the centrifuge tube on a clean bench to dry for 1 hours, add 50-100 μL of TE 8.0, dissolve the DNA at 4°C overnight, and store it in a -20°C refrigerator for later use.

(2) Screening of polymorphic microsatellite loci: According to the microsatellite sequences of Chinese barb isolated from the laboratory, a series of upstream and downstream primers were designed and synthesized, and 8 individuals of Chinese barb were extracted (step (1)) PCR amplification of genomic DNA) was performed, and primers with stable amplification, clear results, strong specificity and high heterozygosity were screened out. The PCR reaction system is: 5.0uL 2×Power Taq PCR premix (the main components are 0.1U/μl Taq DNA polymerase, 2X PCR reaction buffer, 3mM MgCl ₂ , and 0.4mM dNTPs), 1.0uL template genomic DNA ( Concentration 30-50ng/uL), upstream and downstream amplification primers each 0.4uL (concentration 10uM), add 3.2uL ddH ₂ O to a total volume of 10uL. The PCR amplification program was as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30s, 62°C→52°C gradient temperature (touch down) annealing for 30s, 72°C extension for 30s, 10 cycles; 95°C denaturation for 30s, 52°C annealing for 30s , extended at 72°C for 30s, and performed 22 cycles; the final extension was at 72°C for 20min. After quantitative dilution of the obtained PCR product, 1 ul of the PCR diluted product was taken, 7 ul of formamide (containing 4‰ fluorescent internal standard LIZ500) was added for denaturation, and then the capillary fluorescence electrophoresis detection and genotyping were carried out on the ABI 3730xl DNA sequencer. A total of 15 pairs of available Chinese barb microsatellite primers are screened out in the present invention: ZHDCB24, ZDCB27, ZHDCB28, ZHDCB29, ZDCB33, ZDCB35, ZDCB41, ZDCB43, ZDCB50, ZDCB57, ZDCB58, ZDCB66, ZDCB79, ZDCB80, ZDCB88. See Table 1 for information on the primer sequences, repeat units and annealing denaturation of the Chinese barb microsatellite;

Table 1 Information table of 15 microsatellite loci

The present invention has carried out specific verification on each primer, and the results show that each primer conforms to Mendel's law of separation, wherein: taking primers ZHDCB027, ZHDCB043 and ZHDCB080 as examples, the specific analysis is as follows: (genotype is 203/207), parent M1 (genotype is 199/203), child generation Z1-1 (genotype is 199/207)), the two alleles of child generation come from the father and mother respectively, In line with Mendel's law of segregation; Figure 2 is the sequencing map of primer ZHDCB043 (the parent F1 (genotype is 228/232), the parent M1 (genotype is 228/232), and the offspring Z1-1 (genotype is 228/228) )), the two alleles of the offspring come from the male parent and the female parent, respectively, in line with Mendel’s law of segregation; Figure 3 shows the sequencing map of the primer ZHDCB080 (the parental F1 (genotype is 274/274), the parental M1 (genotype is 274/274) 274/278), the offspring Z1-1 (genotype 274/278)), the two alleles of the offspring come from the male parent and the female parent, respectively, in line with Mendel's law of segregation.

(3) PCR amplification with fluorescently labeled microsatellite primers: The 5' end of the forward primer of each pair of primers in the 15 pairs of microsatellite primers in step (2) is labeled with FAM fluorescent substance, and the labeled fluorescent primer pair is used to label the 5' end of the forward primer. The DNA genome obtained in step (1) is amplified by gradient PCR, and the PCR reaction system is: 5.0uL 2×Power Taq PCR premix (the main components are 0.1U/μl Taq DNA polymerase, 2X PCR reaction buffer, 3mM MgCl ₂ , and 0.4mM dNTPs), 1.0uL template genomic DNA (concentration 30-50ng/uL), 0.4uL each of upstream and downstream amplification primers (concentration 10uM), add 3.1uL ddH2O to a total volume of 10uL. The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30s, 62°C→52°C gradient temperature (touchdown) annealing for 30s, extension at 72°C for 30s, for 10 cycles; denaturation at 95°C for 30s, annealing at 52°C for 30s, Extend at 72°C for 30 s for 22 cycles; finally extend at 72°C for 20 min. After quantitative dilution of the obtained PCR product, take 1 ul of PCR dilution product, add 7 ul of formamide (containing 4‰ fluorescent internal standard LIZ500) to denature, and perform capillary fluorescence electrophoresis detection on ABI 3730xl DNA sequencer. Individual allele size to obtain raw data for genotyping. According to the typing results obtained by the sequencer, the software GeneMarker v 2.2.0 (Holland and Parson, 2011) was used to read the size of individual alleles, and manual correction was performed according to the repeating unit composition of microsatellites.

(4) Paternity test analysis of the Chinese barb family: For the genotype data obtained in step (3) after manual proofreading, the software Cervus 3.0.7 (Kalinowski et al., 2010) was used to perform allelic analysis on the parental and offspring data Gene frequency calculation, simulation analysis and parent-child relationship analysis, the correlation between the genotype likelihood ratio (logLikelihood ratio, LOD) value between the offspring to be tested and the parent is analyzed, and the test offspring is determined at the 95% confidence level The relationship between generation and parent. The results showed that for a single parent with unknown parents, the non-parental cumulative exclusion probability (NE-1P) of 15 loci was 0.9682947; for the other parent with known uniparental genotype, the 15 loci The non-parental cumulative exclusion probability (NE-2P) was 0.99839823; when the parents were unknown, the non-parental cumulative exclusion probability (NE-PP) for the 15 loci was 0.99997443. The genetic diversity and exclusion probability of the 15 microsatellite loci in Chinese barb are shown in Table 2. In order to ensure the accuracy of the identification results, the parent-child relationship can be confirmed only when the LOD value is greater than 0 and is consistent with the family record data. The results showed that 92 of the 96 offspring individuals confirmed the parent-child relationship, and the identification accuracy rate was 95.83%. The above results show that the use of the microsatellite marker-based paternity test kit and the method for Chinese barbs of the present invention can efficiently and quickly fulfill the requirements of paternity analysis, germplasm management and proliferation and release effect evaluation of Chinese barb families.

Table 2. Genetic diversity and non-parental exclusion probability information of 15 microsatellite loci in Chinese barb.

Note: NS means no significant deviation (P>0.05), * means significant deviation (P<0.05)

The above-mentioned embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above-mentioned embodiments, and any other changes, modifications, substitutions, combinations, The simplification should be equivalent replacement manners, which are all included in the protection scope of the present invention.

Specification Nucleotide and Amino Acid Sequence Listing

<110> Institute of Water Engineering Ecology, Chinese Academy of Sciences, Ministry of Water Resources

<120> A microsatellite marker-based paternity test kit and method for Chinese barb carp

<160> 30

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB24 F

<400> 1

CTTGTCTCCTCGTTCCCTTG

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB24 R

<400> 2

TTGATGCTTATCAATGGCTCC

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB27F

<400> 3

CAGTGTTCTA TCTCATGGAC GG

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB27 R

<400> 4

TTCATGTTTGGGGGAGAGAG

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB28F

<400> 5

CCAGCTAAAG CCAAATGAGG

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB28 R

<400> 6

GCTGCATCCT GATCTGCAC

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB29F

<400> 7

ATTCTATGTC GACCCGAACG

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB29 R

<400> 8

ACATCATCAG ACTAGCCCCG

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB33F

<400> 9

TCGAAAAATC GTGTCGTCAA

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB33 R

<400> 10

TCGGCCTGGATTTTGAATTA

<210> 11

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB35F

<400> 11

GCAGGATTAG TTTCGCTGTT G

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB35 R

<400> 12

AACCGTAATC CAATAAGCTT GG

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB41 F

<400> 13

TGGGCTGATCTCAGTCTCTG

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB41 R

<400> 14

TGGACAAAAA CAAGGAGCTG

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB43 F

<400> 15

CCCGGAGCTA ATTGTGGTAA

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB43 R

<400> 16

AACACTCGAAGGTGATTGGG

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB50F

<400> 17

CTGCTTTGGC TCTTCATTCC

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB50 R

<400> 18

CGTGCACTTC CAACATCATC

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB57F

<400> 19

TGCATGCAAT CATTCAGTAT CTC

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB57 R

<400> 20

TCTAGCAATC CAAAATCACC A

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB58F

<400> 21

CTCATTCCTT GATGTCCCGT

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB58 R

<400> 22

GGTTAACCCA TTTAACCCAG C

<210> 23

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB66 F

<400> 23

TTCAGACAAG AATCAGACCA ACA

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB66 R

<400> 24

GCAAAACCTTTTGGGAAGGAT

<210> 25

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB79F

<400> 25

TAGTCACTGC AGCGTCCTG

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB79 R

<400> 26

TTGAGCAGAA ATGTTGAGCG

<210> 27

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB80F

<400> 27

CCATATGTGA ATTATGTGGA TGTG

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB80 R

<400> 28

GTGACCGAGT GCAGAAGTGA

<210> 29

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB88 F

<400> 29

TGTTCCTCAC TGTTTGGCAG

<210> 30

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ZHDCB88 R

<400> 30

TCACTAACCAGGCATGCAAA

Claims (9)

1. A primer set for paternity identification of Chinese barb based on microsatellite markers, characterized in that: the primer set includes ZHDCB24, ZHDCB27, ZHDCB28, ZHDCB29, ZHDCB33, ZHDCB35, ZHDCB41, ZDCB43, ZHDCB50, ZHDCB57, ZHDCB58, ZHDCB66, ZHDCB79, ZHDCB80, ZHDCB88, the sequence of each primer is as follows: Each primer Primer sequence (5'-3') ZHDCB24 F: CTTGTCTCCTCGTTCCCTTG R: TTGATGCTTATCAATGGCTCC ZHDCB27 F: CAGTGTTCTATCTCATGGACGG R: TTCATGTTTGGGGGAGAGAG ZHDCB28 F: CCAGCTAAAGCCAAATGAGG R: GCTGCATCCTGATCTGCAC ZHDCB29 F: ATTCTATGTCGACCCGAACG R: ACATCATCAGACTAGCCCCG ZHDCB33 F: TCGAAAAATCGTGTCGTCAA R: TCGGCCTGGATTTTGAATTA ZHDCB35 F: GCAGGATTAGTTTCGCTGTTG R: AACCGTAATCCAATAAGCTTGG ZHDCB41 F: TGGGCTGATCTCAGTCTCTG R: TGGACAAAAACAAGGAGCTG ZHDCB43 F: CCCGGAGCTAATTGTGGTAA R: AACACTCGAAGGTGATTGGG ZHDCB50 F: CTGCTTTGGCTCTTCATTCC R: CGTGCACTTCCAACATCATC ZHDCB57 F: TGCATGCAATCATTCAGTATCTC R: TCTAGCAATCCAAAATCACCA ZHDCB58 F: CTCATTCCTTGATGTCCCGT R: GGTTAACCCATTTAACCCAGC ZHDCB66 F: TTCAGACAAGAATCAGACCAACA R: GCAAACCTTTTGGGAAGGAT ZHDCB79 F: TAGTCACTGCAGCGTCCTG R: TTGAGCAGAAATGTTGAGCG ZHDCB80 F: CCATATGTGAATTATGTGGATGTG R: GTGACCGAGTGCAGAAGTGA ZHDCB88 F: TGTTCCTCACTGTTTGGCAG R: TCACTAACCAGGCATGCAAA . 2. The primer set for paternity testing of Chinese barb according to claim 1, wherein the 5' end of the forward primer of each pair of primers is marked with a fluorescent substance. 3. a Chinese barb carp paternity test kit based on microsatellite markers, is characterized in that: comprise Taq enzyme PCR premix, the Chinese barb carp paternity test primer set according to claim 1, wherein Taq enzyme PCR The main components in the premix solution are 0.1 U/μl Taq DNA polymerase, 2X PCR reaction buffer, 3 mM MgCl ₂ , and 0.4 mM dNTPs; ZHDCB29, ZHDCB33, ZHDCB35, ZHDCB41, ZHDCB43, ZHDCB50, ZHDCB57, ZHDCB58, ZHDCB66, ZHDCB79, ZHDCB80, ZHDCB88. 4. The Chinese barb carp parentage test kit according to claim 3 is characterized in that: it also comprises the genomic DNA and double distilled water of Chinese barb carp. 5. a microsatellite PCR identification method, is characterized in that: comprise the following steps: (1) Extracting genomic DNA from individual samples of Chinese barb; (2) PCR amplification: 15 pairs of microsatellite primers ZHDCB24, ZHDCB27, ZHDCB28, ZHDCB29, ZHDCB33, ZHDCB35, ZHDCB41, ZHDCB43, ZHDCB50, ZHDCB57 in the primer set for paternity test of Chinese barb described in claim 1 , ZHDCB58, ZHDCB66, ZHDCB79, ZHDCB80, ZHDCB88, the 5' end of the forward primer of each pair of primers is labeled with a fluorescent substance, and each labeled fluorescent primer in the above primer set is used to perform gradient PCR on the DNA genome obtained in step (1). Amplification, the amplified product is subjected to capillary electrophoresis on the sequencer, and the allele size of each individual is read to obtain genotyping data; (3) Paternity identification analysis of the Chinese barb family: Based on the genotype data obtained in step (2), the parent and offspring data were analyzed, and the correlation between the offspring genotype and the parental genotype was determined to determine the relationship between the offspring and the parental genotype. parent-child relationship. 6 . The method according to claim 5 , wherein the PCR amplification procedure is as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30s, 62°C→52°C gradient temperature annealing for 30s, 72°C extension for 30s, 10 cycles were performed; denaturation at 95°C for 30s, annealing at 52°C for 30s, and extension at 72°C for 30s were performed for 22 cycles; the final extension was at 72°C for 20 min. 7. method according to claim 5, is characterized in that: described PCR reaction system is: 5.0 uLTaq enzyme PCR premix, 1.0 uL template genomic DNA, each 0.4 uL of upstream and downstream amplification primers, concentration 10 uM, Add 3.2 uLddH ₂ O to a total volume of 10 uL; The main components in the Taq enzyme PCR master mix were 0.1 U/μl Taq DNA polymerase, 2X PCR reaction buffer, 3 mM MgCl ₂ , and 0.4 mM dNTPs. 8. The method according to claim 7, wherein the concentration of genomic DNA of Chinese barb is 30-50 ng/uL, and the concentration of upstream and downstream amplification primers is 10 uM. 9 . The method according to claim 5 , wherein the step (1) is as follows: obtaining the genomic DNA of each individual by using a high-salt extraction method for the individual fin rays and offspring fry of the Chinese barb parent. 10 . , save it for later use.

Images