CN101933920A - Application of 3,15-dicarbonyl gibberellic acid methyl ester in reversing tumor multidrug resistance - Google Patents

Abstract

The invention relates to application of 3,15-dicarbonyl gibberellic acid methyl ester (GA) in reversing tumor multidrug resistance. A compound GA provided in the invention has favorable activity on the reversing tumor multidrug resistance (MDR), the GA acting on K562/A02 has higher drug susceptibility and can obviously reverse the drug resistance of the K562/A02 for ADM (Archer Daniels Midland); the effect mechanism of the GA for reversing the multidrug resistance of K562/A02 cells is realized by increasing the contents of chemotherapeutic drugs in the drug-resistance cells to prevent the chemotherapeutic drugs from being discharged outwards and promote the apoptosis of the drug-resistance cells, and has no obvious relevance with the expression of down-regulated drug-resistance genes mdr-1, thereby prompting that the action mechanism of the GA is relevant to the outward discharging pump function of inhibiting the drug-resistance cells P-gp and inducing the apoptosis of the drug-resistance cells; and the compound GA has lower toxicity, and therefore the compound GA has favorable application prospect on clinical tumor chemotherapy and particularly on resisting clinical tumor drug resistance.

Description

3, the purposes of 15-dicarbonyl gibberellic acid methyl ester in reverse multiple drug resistance of tumor

Technical field

The present invention relates to the purposes of new synthetic Methyl gibberellate, specifically is 3, the purposes of 15-dicarbonyl gibberellic acid methyl ester in reverse multiple drug resistance of tumor.

Background technology

Malignant tumor serious harm human life and health have become the one of the main reasons of current disease death.Along with the intensification to malignant tumor essence understanding, malignant tumor is a whole body and the understanding of non-locality's disease is generally admitted.Therefore, operation is compared with X-ray therapy, and the Drug therapy of tumor is chemotherapy in the treatment tumor, have sure and irreplaceable effect aspect prolonging quality of life of life span and raising patient ^[1]But (Multi-drug resistance MDR) is the one of the main reasons of chemotherapy of tumors failure to the multidrug resistance that produces in the chemotherapy process of tumor ^[9]

MDR is meant tumor cell to a kind of chemical sproof while of antineoplastic agent deposits yields, the antineoplastic agent deposits yields cross resistance different with mechanism of action to structure.The MDR spininess is to natural drug, as generations such as amycin, daunorubicin, vincristine, vinblastine, paclitaxel, podophyllotoxins ^[11]MDR is the major obstacle of tumor chemical therapy, also is the difficult problem that chemotherapy of tumors needs to be resolved hurrily.The mechanism that MDR forms is complicated, and tumor cell can cause MDR to produce by different approaches.The generation of MDR is relevant with the overexpression of P-glycoprotein (P-gp), and is also relevant with the anti-apoptosis mechanism of multidrug-associated protein (MRP), lung drug-resistant protein (LRP), mdr cell, topoisomerase II (TOPO II), Protein kinase C (PKC), metallothionein, glutathion (GSH), glutathion-S transferring enzyme (GST) etc. ^[2]But the generation of most tumors cell MDR is mainly expressed with crossing of P-gp or is relevant with the anti-apoptosis mechanism of MDR mediation.P-gp is expressed on the cell membrane, is an energy dependence transport protein, is similar to Teat pipette, natural drug that can multiple structure is different with mechanism of action is discharged the extracellular, make drug level reduction in the cell, cause tumor cell insensitive, produce MDR multiple chemotherapeutics ^[10]And anti-apoptotic genes expression is crossed and is expressed and the low expression of short apoptogene all can suppress apoptosis of tumor cells, and influences chemotherapeutics to the killing and wounding of tumor cell, thereby also can produce MDR ^[3]Wherein with the imbalance of expression that suppresses apoptogene Bcl-2 and short apoptogene Bax for seeing more.

Human P-gp is divided into two classes, respectively by mdr-1 and mdr-3 gene code.The P-gp of mdr-1 coding is relevant with MDR, and molecular weight is 170kD, is that the medicine of an energy dependence effluxes transmembrane protein, has 12 to stride the film district, and two ATP-binding domain are arranged in the film.Most MDR reversal agents can suppress the P-gp activity, recover or partly recover the sensitivity of tumor cell to cancer therapy drug ^[4]The MDR reversal agents of Recent study is broadly divided into 1. calcium ion channel blocker: its representative is verapamil (verapamil, VER), it is the MDR reversing drug of finding the earliest, its reversion MDR effect and calcium antagonism are irrelevant, but by combining with P-gp competitively, become the competitive substrate of MDR cell efflux pump, thereby the accumulation amount that increases medicine in the cell realizes reverse effect.But this class medicine is because serious cardiovascular system toxicity has hindered its clinical practice.2. cyclosporins: be a kind of height lipophilic substance, can compete binding site on the P-gp with antitumor drug, thereby suppress to stride the membrane pump effect, make medicine cumulative rises in the cell, reversion MDR.It represents medicine is cyclosporin A (CsA) and derivant Valspodar (SDZ-PSC833) and bircodar (Vx710).Clinical observation finds that CsA has stronger reverse effect than traditional inversion agent verapamil.But because Valspodar and Bircodar are the substrates of cytochrome oxidase P4503A4, therefore the activity that also suppresses this enzyme, cause being suppressed through the internal metabolism and the elimination of this enzymes metabolism related drugs, the drug level of being correlated with in medication person's body raises and produces serious toxic reaction.Because the interaction between these medicines is extremely complicated, be difficult to clinically determine dosage safely and effectively, limited the application of this type of medicine ^[12]3. recently by structure activity relationship and combinatorial chemistry principle development P-gp is had more specificity and more pretends the P-gp inhibitor Tariquidar (XR9576) of usefulness, energy high-affinity ground is in conjunction with P-gp, its activity of potent inhibition.Be different from preceding two class competitive inhibition mechanism, Tariquidar is a specificity, noncompetitive with combining of P-gp, and its affinity is much larger than other substrate.Tariquidar observes its ability that suppresses P-gp in clinical research and the time obviously surpasses preceding two class MDR reversal agents, and all receives good effect in I phase and the clinical experiment of II phase.But toxicity strengthens when finding in the clinical experiment of III phase that it treats drug combination with a linearize, even serious toxicity occurs, so that finally clinical efficacy is still undesirable ^[5]

In the MDR reversal agents of research, the overwhelming majority is non-anticarcinogen, and for known anticarcinogen, tumor cell nearly all can produce drug resistance again, even the application time is long, the good again anticarcinogen paclitaxel of curative effect also is like this.Almost not to the effective anticarcinogen of drug-resistant tumor, more can't learn the drug-fast mechanism of its reversing tumor so far ^[6]Report is arranged, effective ingredient-the indirubin of treatment chronic myelocytic leukemia demonstrates the effect of reversing drug resistance, in the clinical trial, it but has the curative effect that is higher than them during less than other anticarcinogen at dosage, show reversing drug resistance and antineoplastic double effect, this type of medicine is worth expectation, is the important directions of seeking overriding resistance tumor new drug ^[7]

Cell death inducing is the co-channel of numerous chemotherapeutics killing tumor cells, and in this sense, apoptosis is subjected to or apoptosis is escaped may be that tumor cell produces one of drug-fast mechanism ^[8]At present, the relation of apoptosis regulation gene and tumor multi-medicine drug-resistant is confirmed by many scholars.The Bcl-2 gene family is to study more deep gene participating in apoptosis at present, and is closely related with drug resistance of tumor cell ^[3]And Bax promotes the representative of gene as apoptosis, and its overexpression can induce kinds of tumor cells to produce apoptosis, otherwise then produces drug resistance.

Chemical compound 3; 15-dicarbonyl gibberellic acid methyl ester (GA13315) is the new tetracyclic diterpene compounds that filters out from synthetic a series of gibberellins derivants; obtained the Chinese invention patent protection; patent name: 3; 15-dicarbonyl gibberellic acid compounds and ester thereof and salt, the patent No.: ZL 200410021939.2.

Summary of the invention

The purpose of this invention is to provide 3, the application of 15-dicarbonyl gibberellic acid methyl ester in preparation medicine for treating tumor thing.

Early stage, the inventor found in the exploration to GA reversing tumor MDR, people's chronic myelocytic leukemia cell strain-K562/A02 of anti-doxorubicin (ADM), the multiple structure classical chemotherapeutic different with mechanism of action produced under the drug-fast situation, still responsive to chemical compound GA, its half-inhibition concentration IC ₅₀Be starkly lower than other chemotherapeutic, and present dose dependent preferably.

The application on this basis, with drug-fast cell strain K562/A02 of chemotherapeutic ADM and corresponding sensitive strain K562 is model, with the positive contrast of verapamil (VER), on the basis of the MDR characteristic of verifying the K562/A02 model and degree, further detect GA and act on the drug susceptibility of K562/A02 cell and reverse drug-fast effect of its ADM and mechanism.Adopt flow cytometry (FCM), direct immunofluorescence, two method, real-time quantitative RT-polymerase chain reaction (RQ-PCR) the various kinds of cell molecular biology methods of dying of AnnexinV/PI, detect the influence that GA transcribes each side to the alleviation and the mdr-1 gene mRNA of K562/A02 cell P-gp expression, function, MDR apoptosis resistance.

The present invention researches and develops the new multidrug resistance reversing agent with independent intellectual property right for seeking the candidate compound that has antitumor simultaneously concurrently and overcome tumor multi-medicine drug-resistant, and the curative effect that improves oncotherapy lays the foundation, and has important scientific meaning.In addition, because the synthesis material of chemical compound GA is cheap and easy to get, reactions steps is few, efficiency of pcr product is high, so the present invention also has the application prospect that can expect.

The beneficial effect of the application of GA of the present invention in the preparation tumour medicine is as follows: chemotherapeutic ADM, epirubicin (EPI) and etoposide (VP-16) are to the half-inhibition concentration (IC of K562/A02 cell growth ₅₀) all＞100 μ g/ml, and to the IC of K562 cell ₅₀Be respectively 0.33,2.08 and 2.21 μ g/ml, K562/A02 is respectively 303.03,48.08,45.25 to the drug resistance index (RI) of each chemotherapeutic, shows that K562/A02 is the MDR cell model, and K562 is corresponding sensitive cells model.Chemical compound GA is to the IC of K562/A02 cell ₅₀Only be 4.43 μ g/ml, prompting is to the drug-fast while of multiple chemotherapeutic, and K562/A02 still has higher sensitivity to GA.ADM and 10 μ g/mlVER associating or cooperate with the IC of K562/A02 cell with the GA of 3.125,6.25,12.5 μ g/ml concentration ₅₀Be respectively 1.68,24.13,2.38,0.84, reverse multiple (FR) and be respectively 32.4,2.26,39.45,64.81 times, prompting chemical compound GA can significantly reverse the drug resistance (P＜0.01) of K562/A02 to ADM; In accumulating experiment, ADM and VER or GA coupling all can significantly improve ADM in the intracellular accumulation of K562/A02, and GA demonstrates comparatively significantly dose dependent (p＜0.01), and the GA of same concentrations and VER under equal conditions do not have this effect (P＞0.05) with the ADM coupling to the K562 sensitive strain; RH-123 effluxes experimental result and shows, the intracellular RH-123 content of K562 is significantly higher than K562/A02 cell (P＜0.01), and the GA of 6.25 μ g/ml can obviously improve P-gp high-affinity substrate RH-123 in the intracellular content of K562/A02 (P＜0.05), and presents good dose dependent; P-gp detection of expression result shows that K562/A02 is than K562 high expressed P-gp (P＜0.01), and the GA of 12.5 μ g/ml does not relatively have significant difference (P＞0.05) to influence and negative control group that K562/A02 cell P-gp expresses; The apoptosis testing result shows that ADM self can not be alleviated the K562/A02 cell because the apoptosis that drug resistance caused is obstructed (P＞0.05).But ADM is after cooperating with the K562/A02 cell with GA, get final product the anti-apoptotic effect of dose dependent ground alleviation by the K562/A02 cell that MDR caused, after 12.5 the GA of μ g/ml associating ADM acts on K562/A02 cell 48h, persister is increased to 74.41%, P＜0.05 by the apoptosis that 10 μ g/ml ADM cause from 20.15%; RQ-PCR result shows, after ADM cooperated with the K562/A02 cell separately or with GA, slight downward modulation appearred in the expression of its mdr-1mRNA, but compares this downward modulation effect not obvious (P＞0.05) with matched group.Therefore, new tetracyclic diterpene compounds GA has the effect that reverses K562/A02 cell multidrug resistance, this effect and the content that increases the interior chemotherapeutic of mdr cell, stop it to efflux and promote that the mdr cell apoptosis is relevant, but do not have obviously relevantly with the expression of downward modulation drug resistant gene mdr-1, point out its mechanism of action apoptosis-related with efflux pump function and the inducible resistance of inhibition mdr cell P-gp.

Description of drawings

Fig. 1 is the IC50 (μ g/ml) of chemical compound GA to K562 and K562/A02 cell proliferation;

Fig. 2 is the influence of chemical compound GA to ADM accumulation in the K562/A02 cell; Among the figure from left to right each peak be followed successively by: negative control group, GA-3.125,6.25, VER (positive control)-10, GA-12.5 (μ g/ml);

Fig. 3 is the influence of chemical compound GA to ADM accumulation in the K562 cell;

Fig. 4 is the influence (three empirical average value) of chemical compound GA to ADM accumulation in the K562/A02 cell;

Fig. 5～Fig. 8 is the influence that GA expresses K562/A02 cell P glycoprotein (P-gp);

Fig. 9 is the influence of GA to RH123 content in K562/A02 and the K562 cell;

Figure 10 is the influence of GA to the outer row function of P-gp albumen pump;

Figure 11～Figure 15 is that GA is to the apoptotic influence of the inductive K562/A02 of ADM;

Figure 16 is each experimental group solubility curve figure among the RQ-PCR;

Figure 17 is each experimental group amplification curve diagram among the RQ-PCR;

Figure 18 detects the inhibitory action that GA expresses K562/A02 cell mdr-1mRNA for RQ-PCR.

The specific embodiment

The invention will be further described below in conjunction with specific embodiment and accompanying drawing.

One, experiment material

(1) cell strain

K562 (The Drug Sensitive Human Myelogenous Leukemia Cell line): people's chronic myelogenous leukemia cell strain;

K562/A02 (The Drug Resistant Human Myelogenous Leukemia Cell line): people's chronic myelogenous leukemia cell strain of anti-doxorubicin.

Two strain cells all draw from Shanghai Pharmaceutical Inst., Chinese Academy of Sciences.The K562 cell places and contains volume fraction 10% hyclone RPMI1640 culture fluid, 37 ℃, 5%CO ₂, cultivate under the saturated humidity.The doxorubicin (ADM) that adds 1 μ g/ml in the K562/A02 cell culture medium is kept cultivation, and in preceding 2 weeks of experiment removing ADM, cultivating with conventional RPMI1640 complete culture solution.

(2) sample and reagent

1, sample

Chemical compound GA13315, chemical name 3,15-dicarbonyl gibberellic acid methyl ester is new tetracyclic diterpene compounds, molecular weight is 370.4, is provided by Yunnan University.

2, main medicine and reagent

(1) hydrochloride for injection doxorubicin (ADM): Haizheng Medicine Stock Co., Ltd., Zhejiang Prov, lot number: 080202B;

(2) etoposide inj (VP-16): Hengrui Medicine Co., Ltd., Jiangsu Prov., lot number: 08020691;

(3) injection vincristine sulfate (VCR): Haizheng Medicine Stock Co., Ltd., Zhejiang Prov, lot number: 070501;

(4) verapamil hydrochloride injection (VER): Harbin Pharmaceutical Group's three refining medicines, lot number: 080107A8;

(5) be connected with the P-gp monoclonal antibody (Anti-Pgp-PE) of fluorescein PE: BD company;

(6) rhodamine 123 reagent (RH-123): Sigma company, 127k5752;

(7) modified form RPMI 1640 culture medium: Sai Mo flies generation that biochemistry goods (Beijing) company limited, lot number: NTE0099;

(8) dimethyl sulfoxide (DMSO): Amresco product, lot number: 0718A01;

(9) propidium iodide (PI): Sigma company produces;

(10) ribonuclease A (RNase A): Sigma company produces;

(11) dehydrated alcohol: the north, a Tianjin day medical chemistry chemical reagent work produces lot number: 20090515;

(12) hyclone: Hangzhou Sijiqing Biological Engineering Material Co., Ltd. produces, lot number: 080619;

(13) dimethyl tetrazole indigo plant (MTT): Amresco company produces, lot number: 1708B015;

(14) sodium lauryl sulphate (SDS): the Shantou City reaches Hao fine chemicals company and produces lot number: 20080210;

(15) isobutanol: Shanghai chemical reagents corporation produces, lot number: 0804253;

(16) concentrated hydrochloric acid (HCl): glad Haixing County, Chengdu chemical reagent factory produces;

(17) 0.9% sodium chloride injections (NS): Kuming Nanjiang Pharmacy Co., Ltd produces, lot number: 0806270;

(18) NaCl: Chongqing Chuan Dong chemical industry (group) company limited production, lot number: 20080901;

(19) TRIzol reagent, invitrogen company produces, Lot.No:50300413;

(20) pyrocarbonic acid diethyl ester (DEPC), Promega company product;

(21) M-MLV Reverse Transcriptase (200U/ul) test kit, invitrogen company produces, Cat.No:28025-021;

(22) 5XFirst-Strand Buffer[250Mm Tris-HCl, 375Mm KCl, 15mm MgCl2], invitrogen company product, Cat.No:28025-021;

(23) DTT (0.1mM), invitrogen company product, Cat.No:28025-021;

(24) Random primer, Chinese Shanghai biotechnology company limited product, Lot.No:0701;

(25) dNTPs (10mM), Chinese Shanghai biotechnology company limited product, Lot.No:3080901;

(26) β-actine and mdr-1 upstream and downstream primer, Chinese Shanghai biotechnology company limited is synthetic;

(27) SYBR Green I (20 *), Generay company product, Lot.No:RS0975;

(28) MgCl2 (25mM), Fermentas company product, Lot.No:00031664.

(29) TaqDNA polymerase, PCR reaction buffer (10x), Beijing BioDev

(29) Platinum Taq DNA Polymerase (5U/ul), invitrogen company product, Lot.No:266632.

(3) key instrument and equipment

1.CO2 incubator: German Hereaus company produces;

2. electronic balance: the two outstanding test instrunment in Changshu City factory produces the JJ200 type;

3. medical clean work station: cleaning equipment company in Suzhou produces, the YJ-1450 type;

4. low-temperature and high-speed centrifuge: German Hereaus company produces Biofuge 15R type;

5. inverted phase contrast microscope: Japanese Olympus company produces the BH-2 type;

6. ELISA Plate automatic reading instrument: Bio Rad Laboratories produces, Bio-Rad 680 types;

7. hot-air dry disinfect box: German Hereaus company produces the D-6450 type;

8. disposable 6 holes, 96 well culture plates: U.S. Corning company produces;

9. ultra cold storage freezer: U.S. Thermo Electron company produces, the Forma-86C991 type;

10. optical microscope: German Lycra (Leica) company produces, the DM400B type;

11. flow cytometer: Beckman coulter company produces, Coulter Epics * L type;

12. the desk type high speed refrigerated centrifuge, German Heraeus company product, model Biofuge Stratos;

13. the room temperature high speed centrifuge, U.S. power ﹠ light company product, model IEC Multi;

14. the real-time fluorescence quantitative PCR instrument, American AB I company product, model 7300;

15. Haier's refrigerator (4 ℃), Chinese Qingdao Haier Group product;

16.UV2000 uv analyzer, sky, Shanghai energy Science and Technology Ltd. product;

17. electrophresis apparatus, electrophoresis tank, sky, Shanghai energy Science and Technology Ltd. product;

18. the uv-spectrophotometric instrument, BIO-RAD company limited product;

19. eddy mixer, its woods Bel instrument manufacturing company product, QL-901.

(4) reagent preparation

1.RPMI the preparation of 1640 complete culture solutions [11]:

Add 10% hyclone, penicillin (100 μ g/ml) and streptomycin (100 μ g/ml) in the RPMI RPMI-1640, pH is 7.4.

2.0.1mol PBS balanced salt solution preparation.

NaCl 8.00g, KCl 0.20g, Na2HPO4H2O 2.89g, KH2PO40.20g are with 1L tri-distilled water dissolving back adjust pH about 7.2.

3. three liquid preparation:

0.012mol/l hydrochloric acid, 10%SDS, 5% isobutanol promptly add 1.2ml 36%-37% concentrated hydrochloric acid, 100g SDS, 50ml isobutanol, with the dissolving of 1L tri-distilled water.

4.MTT preparation:

Get the 5mgMTT powder, add 1mlPBS and be made into 5mg/ml concentration solution.

5. prepare doxorubicin (ADM) solution:

Injection doxorubicin: specification 10mg, add 10ml sterile saline (N.S) in ampoule bottle, dissolving back concentration is 1mg/ml, divide and be filled in the 1.5ml ep pipe, preserve stand-by in 0 ℃ of refrigerator, the ADM that at every turn gets in the 1ep pipe uses, can not be frozen again after the thawing, and do keeping of K562/A02 cell strain and cultivate and test and use.

6.TAE storage liquid (50x):

24.2gTris alkali (trihydroxy methyl ammonium methane), the 57.1ml glacial acetic acid, 37.2gNa2EDTA.2H2O adds water to 1000ml, 4 ℃ of preservations.The time spent thin up is to the lx working solution.

7. bromophenol blue sample-loading buffer (6X):

0.25% bromophenol blue, 0.25% dimethylbenzene green grass or young crops, 30% glycerol is soluble in water, 4 ℃ of preservations.Time spent and sample mixed with 1: 5 goes up sample.

8. agarose gel preparation:

2% agarose gel: 0.9g agarose dry powder, 45ml deionized water, 900ulTAE are mixed in the flask, boil in microwave oven, treat that gelling temp is reduced to about 60 ℃ to add EB, make final concentration reach 10mg/ml.Pour into immediately after shaking up in the ready glued membrane, after cooling, extract the sample comb, take out gel and in 4 ℃ of refrigerators, preserve.

Two, embodiment

Multidrug resistance characteristic and the degree of embodiment one K562/A02

1. medicine and preparation

Chemotherapeutic ADM, EPI, VP-16 all establish 5 of 100,50,25,12.5,6.25 μ g/ml and are tried concentration, and this concentration is set according to the trial test result.Specifically be formulated as follows: take by weighing after a certain amount of medicine adds a certain amount of N.S dissolving, add a certain amount of RPMI1640 complete culture solution again and be mixed with highly concentrated solution, all the other concentration proportional diluted are formulated.

2. experimental technique

Reference literature [13] is measured the influence of each chemical compound on cell proliferation with the improvement mtt assay.Get the K562 and the K562/A02 cell strain that are in exponential phase and be adjusted into certain density cell suspension inoculation in 96 well culture plates, 90 μ l/ holes, add difference immediately behind the kind plate and be subjected to the reagent thing, respectively being tried thing all establishes 5 of 100,50,25,12.5,6.25 μ g/ml and is tried concentration, every kind of concentration is established 3 parallel multiple holes, 10 μ l/ holes.Negative control is the equal-volume culture medium.Continue to place 37 ℃ after the dosing, the 5%CO2 incubator is cultivated, and behind drug effect 48h, every hole adds MTT (5mg/ml) 20 μ l, continue to cultivate 4h, every hole adds three liquid [10%SDS-5% isobutanol-0.012mol/L HCl (W/V/V)], 100 μ l dissolving and reducing product Jia Za.Under the single wavelength of 570nm, measure the OD value in each hole with microplate reader.

3. result treatment

(1) calculate the average OD value and the standard deviation of each given the test agent variable concentrations, calculate cell proliferation inhibition rate by following formula:

Suppression ratio (%)=(OD value control wells-OD value well)/OD value control wells * 100%

Adopt Microsoft Excel 2003 to calculate suppression ratio, adopt Logit method calculation of half inhibitory concentration IC50;

(2) by following formula calculate above three kinds of chemotherapeutics the drug resistance index (Resistance Index, RI):

Result: chemotherapeutic ADM, EPI, VP-16 all show excellent drug sensitivity, its IC the K562 sensitive strain being done the time spent ₅₀Value is respectively 0.33,2.08,2.21 μ g/ml.And equal experiment condition acts on the half-inhibition concentration IC of K562/A02 mdr cell ₅₀Equal＞100 μ g/ml.The RI that by formula calculates each chemotherapeutics is all greater than 30 (IC ₅₀Value during greater than 100 μ g/ml by 100 RI) (table 1).Reference literature confirms the establishment of mdr cell model.

Table 1K562/A02 cell is to the drug resistance index (RI) of each chemotherapeutics

Embodiment two K562/A02 cells are to the sensitivity of chemical compound GA

1. medicine and preparation

ADM, VCR, VP-16, GA all establish 5 of 100,50,25,12.5,6.25 μ g/ml and are tried concentration (this concentration is set according to the trial test result), and concrete compound method is the same.

2. experimental technique

The mtt assay of improvement is the same.

The result: chemical compound GA acts on the K562/A02 cell and shows higher drug susceptibility, IC ₅₀Value only is 4.43 μ g/ml (table 2), and for other three kinds of chemotherapeutic that structure is different with mechanism of action, the K562/A02 cell is all insensitive to its drug effect.Prompting K562/A02 cell still has higher sensitivity to chemical compound GA, for subsequent experimental provides foundation to the drug-fast while of multiple chemotherapeutic.

Table 2K562/A02 cell is to respectively being tried the drug susceptibility of thing

Group IC ₅₀(μ g/ml)

ADM ＞100

VCR 72.74

VP-16 ＞100

GA 4.43

Embodiment three chemical compound GA reverse K562/A02 drug-fast effect of cell ADM and intensity

1. medicine and preparation

(1) chemical compound G

If 12.5,6.25,3.125 μ g/ml3 are tried concentration (this concentration is set according to the trial test result).Specifically be formulated as follows: take by weighing a certain amount of GA, add a certain amount of DMSO treat its dissolving after, add a certain amount of RPMI1640 complete culture solution again and be mixed with highly concentrated solution, each low concentration solution then dilutes formulated in proportion;

(2) positive control VER

VER is the injection liquid preparation of initial concentration 2.5mg/ml, and adding a certain amount of RPMI1640 complete culture solution is the working solution of 10 μ g/ml concentration with its dilution;

(3)ADM

Original liquid concentration 1mg/ml, adding a certain amount of RPMI1640 complete culture solution is the working solution of 10 μ g/ml concentration with its dilution.

2. experimental technique

With K562 and K562/A02 cell suspension with 2 * 10 ⁵/ ml is inoculated in 96 orifice plates, and it is divided into five experimental grouies ^[14]: A organizes (negative control group): cell+10 μ g/mlADM;

B organizes (positive controls): cell+10 μ g/mlADM+10 μ g/ml VER;

C organizes (low dose group): cell+10 μ g/mlADM+3.125 μ g/ml GA;

D organizes (middle dosage group): cell+10 μ g/mlADM+6.25 μ g/ml GA;

E organizes (high dose group): cell+10 μ g/mlADM+12.5 μ g/ml GA.

Dosing is placed on 37 ℃, 5%CO ₂Hatch 48h in the incubator, adopt the influence of the mtt assay detection of drugs of improvement to the inhibition of growth of tumour cell propagation, method is the same.

3. computing formula:

(1) calculates IC ₅₀, software and formula are the same;

(2) by following formula computerized compound GA reverse K562/A02 cell MDR the reverse multiple (Fold Resistance, FR):

The result shows: K562/A02 tolerates ADM than K562; By contrast positive drug VER, GA can significantly reverse the drug-resistant effect of K562/A02 to ADM; GA all can significantly reverse the tolerance of K562/A02 to ADM at 3.125,6.25,12.5 μ g/ml concentration, VER in 10 μ g/ml concentration, makes its IC ₅₀Reduce, and present good dose dependent.The reverse multiple is respectively: 2.26,39.45,64.81 and 32.4 times.Learn by statistics and handle, basic, normal, high dosage group of chemical compound GA and positive controls and negative control group are relatively, its difference has significance P＜0.01, see Table 3, Fig. 1, Fig. 1 each peak from left to right is followed successively by negative control group, GA-3.125,6.25, VER (positive control)-10, GA-12.5 (μ g/ml); Correspondingly, GA and VER all do not have this effect to K562 in this concentration.See Fig. 3.Wherein 1. the peak is the K562/A02 matched group, and the peak averaging fluorescence intensity is 10, and Hou Sanfeng is the K562 cell, is followed successively by VER 10 μ g/ml from top to bottom, K562 negative control, GA-12.5 μ g/ml.Each peak averaging fluorescence intensity is respectively 32,34,40.

Table 3 chemical compound GA reverses K562/A02 drug-fast effect of cell ADM and intensity

IC ₅₀Value is the mean ± standard deviation of three experiments.* is p＜0.01, and * is p＜0.05.

Embodiment four GA are to the influence of ADM accumulation in K562 and the K562/A02 cell

1. being tried thing prepares

Chemical compound GA establishes 3 of 12.5,6.25,3.125 μ g/ml and is tried concentration; ADM and VER working concentration are 10 μ g/ml, and this concentration is set according to the MTT result of the test, and compound method is the same.

2. experimental technique

Reference literature ^[15], adopt flow cytometry (FCM) that the content of ADM in K562 and the K562/A02 cell is detected, operating procedure is as follows:

(1) set up six groups:

A organizes (sensitive cells negative control group): K562+10 μ g/mlADM;

B organizes (mdr cell negative control group): K562/A02+10 μ g/mlADM;

C organizes (positive controls): K562/A02+10 μ g/mlADM+10 μ g/ml VER;

D organizes (low dosage is organized by examination): K562/A02+10 μ g/mlADM+3.125 μ g/ml GA;

E organizes (middle dosage is organized by examination): K562/A02+10 μ g/mlADM+6.25 μ g/ml GA;

F organizes (high dose is organized by examination): K562/A02+10 μ g/mlADM+12.5 μ g/ml GA;

(2) adjusting K562 and K562/A02 cell concentration is 1 * 10 ⁶/ ml plants in six orifice plates, every hole 900 μ l, and ADM is independent or unite in variable concentrations GA and the VER adding cell every hole 100 μ l;

(3) place 37 ℃, 5%CO ₂After incubator was hatched 90min, the centrifugal 5min of 1000rpm removed supernatant, collecting cell;

(4) ice PBS liquid is washed 2 times, removes the loose colour of extracellular ADM;

(5) be resuspended in the ice PBS of 200 μ l through the cell of above-mentioned processing, hatch 30min for 4 ℃;

(6) adopting flow cytometer that the content of ADM in K562 and the K562/A02 cell is detected, is 488nm in excitation wavelength, emission wavelength be the mensuration ADM of 615nm place the average fluorescent strength value (Mean Fluorescence Intensity, MFI).

The result: the Flow Cytometry measurement result shows: ADM associating GA or VER can significantly improve it in the intracellular accumulation of K562/A02.Average fluorescent strength (MFI) result shows that GA more can promote the accumulation of ADM in the K562/A02 cell than VER, and presents dose dependent preferably; Chemical compound GA low dose group (3.125 μ g/ml) compares with negative control group, its difference of statistical analysis has significance P＜0.05, and the middle and high dosage group of chemical compound GA and VER positive control and negative control group are relatively, and its difference of statistical analysis has highly significant P＜0.01; Yet GA and VER do not have this effect to the K562 sensitive strain.This experiment repeats 3 times, sees Fig. 4.Be followed successively by from left to right: matched group, GA-3.125,6.25,12.5, VER (positive control)-10 (μ g/ml).

The influence that embodiment five GA express K562/A02 cell P glycoprotein (P-gp)

1. being tried thing prepares

Chemical compound GA establishes 2 of 12.5,6.25 μ g/ml and is tried concentration, and compound method is the same.

2. experimental technique

Reference literature ^[15], adopt P-gp monoclonal antibody (Anti-Pgp-PE) labeled cell that is connected with fluorescein PE and the MFI value that has fluorescently-labeled antigen antibody complex in conjunction with the detection of streaming immunofluorescence technique.Concrete experimental procedure is as follows:

(1) establish following four groups:

A organizes (sensitive cells negative control group): K562+Pgp-PE;

B organizes (mdr cell negative control group): K562/A02+Pgp-PE;

C organizes (low dose group is organized by examination): K562/A02+6.25 μ g/ml GA+Pgp-PE;

D organizes (high dose group is organized by examination): K562/A02+12.5 μ g/ml GA+Pgp-PE.

(2) adjusting cell concentration is 1 * 10 ⁶/ ml, with K562 and K562/A02 cell kind in six orifice plates, every hole 900 μ l.Add variable concentrations GA immediately, making its final concentration is 12.5,6.25 μ g/ml, every hole 100 μ l;

(3) place 37 ℃, 5%CO ₂After incubator was hatched 48h, the centrifugal 5min of 1000rpm removed the supernatant collecting cell, and with the PBS re-suspended cell of 200 μ l;

(4) under the lucifuge condition, adopt Aiti-Pgp-PE labeling of monoclonal antibody cell, 5 μ l/ group;

(5) after lucifuge was hatched 15min, the centrifugal 5min of 1000rpm removed residual dyestuff and liquid;

(6) ice PBS liquid is washed 2 times, removes the extracellular loose colour, is resuspended in the PBS of 200 μ l afterwards;

(7) adopting flow cytometer to detect, is 488nm in excitation wavelength, and emission wavelength is the MFI value that the 525nm place measures fluorescein PE in the cell.

The result shows that K562/A02 is than K562 cell high expressed P-gp, and its MFI value is respectively 101.4 ± 5.04 and 7.28 ± 1.02 (P＜0.01), proves that the K562/A02 cell strain is the drug resistance model of high expressed P-gp really; Yet GA P-gp expression to the K562/A02 cell when 6.25,12.5 μ g/ml concentration does not make significant difference, statistical result showed, two the dosage groups of chemical compound GA and K562/A02 negative control group relatively, its difference does not have significance P＞0.05, sees Fig. 5～8.

Embodiment six GA are to the influence of the outer row function of P-gp albumen pump

1. medicine and preparation

(1) chemical compound G

If 12.5,3 of 6.25,3.125 μ g/ml are tried concentration.Compound method is the same.

(2) rhodamine-123 (RH-123) working solution:

Precision takes by weighing a certain amount of RH-123, and with the N.S dissolving, making its working solution concentration is 100 μ g/ml.Matching while using keeps in Dark Place.

2. experimental technique

Reference literature ^[16], the method that this experiment adopts FCM to combine with P-gp specificity fluorescent substrate RH-123, by measuring the MFI value of RH-123 in the K562/A02 cell, indirect detection chemical compound GA is to the influence of the outer row function of P-gp albumen pump, and concrete steps are as follows:

(1) establish following six groups:

A organizes (blank group): cell only;

B organizes (sensitive cells negative control group): K562+RH-123;

C organizes (mdr cell negative control group): K562/A02+RH-123;

D organizes (low dose group is organized by examination): K562/A02+RH-123+3.125 μ g/ml GA;

E organizes (middle dosage group is organized by examination): K562/A02+RH-123+6.25 μ g/ml GA;

F organizes (high dose group is organized by examination): K562/A02+RH-123+12.5 μ g/ml GA;

(2) adjusting cell concentration is 1 * 10 ⁶/ ml according to six different groups, plants two kinds of cells in six orifice plates respectively simultaneously, and every hole 900 μ l add variable concentrations GA, and making its final concentration is 12.5,6.25,3.125 μ g/ml, every hole 100 μ l;

(3) place 37 ℃, 5%CO ₂After incubator is hatched 60min, add P-gp specificity fluorescent substrate RH-123 working solution under the lucifuge condition, 10 μ l/ group;

(4) continue to hatch 60min after, the centrifugal 5min of 1000rpm removes supernatant, collecting cell;

(5) ice PBS liquid is washed 2 times, removes the loose colour of extracellular RH-123;

(6) be resuspended in the ice PBS of 200 μ l through the cell of above-mentioned processing, hatch 30min for 4 ℃;

(7) adopting flow cytometer to detect, is 488nm in excitation wavelength, and emission wavelength is the MFI value that the 530nm place measures the RH-123 that is detained in the cell.

The result shows that RH-123 content is significantly higher than corresponding K562/A02 mdr cell (P＜0.01) in the K562 cell; After being subjected to chemical compound GA effect, the concentration of the interior RH-123 of K562/A02 cell is dose dependent than the K562/A02 negative control group and increases, the content of RH-123 and the comparison of K562/A02 negative control group in K562/A02 cell when chemical compound GA is 6.25 μ g/ml and 12.5 μ g/ml dosage in concentration, significant difference has significance.6.25 during μ g/ml, P＜0.05; 12.5 during μ g/ml, P＜0.01.See Fig. 9～10.

Embodiment seven unites utilization GA and the inductive apoptosis of ADM

1. being tried thing prepares

(1) chemical compound GA

If 12.5,3 of 6.25,3.125 μ g/ml are tried concentration.Compound method is the same.

(2) binding buffer liquid

According to the requirement of AnnexinV/PI test kit, preparation binding buffer liquid.Stock solution is 4 times of concentrated solutions (4 * binding buffer), gets stock solution 120 μ l and adds 480 μ l ultra-pure waters, is the working solution concentration after diluting 4 times, and mixing is stand-by in 4 ℃ of preservations.

(3) AnnexinV-FITC and PI

Require operation according to test kit.

2. experimental technique

Reference literature ^[17], to the apoptotic influence of K562/A02, concrete steps are as follows when adopting FCM to detect ADM and GA coupling in conjunction with the two methods of dying of AnnexinV/PI:

(1) blank is set up in experiment, feminine gender, and five groups of the basic, normal, high dosage of chemical compound GA, and method is the same;

(2) adjusting cell concentration is 1 * 10 ⁶/ ml is provided with according to different groups and adds corresponding medicine, and adjusting the ADM final concentration is 10 μ g/ml, and chemical compound GA final concentration is 3.125,6.25,12.5 μ g/ml, make ADM separately or associating GA add in the K562/A02 cell;

(3) place 37 ℃, 5%CO ₂After incubator was hatched 24h, the centrifugal 8min of 900rpm removed supernatant, collecting cell;

(4) ice PBS liquid thorough washing cell is 2 times, removes the loose colour of extracellular ADM;

(5) with the fresh binding buffer liquid re-suspended cell for preparing, every group of cell adds 250 μ l binding buffer liquid, and to readjust cell concentration be 2-5 * 10 ⁵/ ml;

(6) every group of cell suspension that takes out 195ml adds the AnnexinV-FITC of 5 μ l, gently room temperature lucifuge 3min behind the mixing;

(7) lucifuge adding concentration is propidium iodide (PI) test solution of 20 μ g/ml, 10 μ l/ group;

(8) hatch 10min in the room temperature lucifuge behind the vibration mixing;

(9) add binding buffer liquid once more, 300 μ l/ group, mixing gently adopts the apoptosis rate of flow cytometer check and analysis cell immediately.

The result shows that ADM self can not alleviate the K562/A02 cell because the apoptosis that MDR caused is obstructed P＞0.05; And after cooperating with the K562/A02 cell with GA, the K562/A02 cell resistance that can significantly alleviate MDR and caused, and can the inductive apoptosis of dose dependent ground increase ADM.6.25 behind the ADM combined effect 48h of the GA of 12.5 μ g/ml and 10 μ g/ml, the apoptosis that the K562/A02 cell is caused by 10 μ g/ml ADM is increased to 69.94% and 74.41% from 20.15%, Figure 11～15 are seen in P＜0.05.

Embodiment eight RQ-PCR methods detect the influence of GA to mdr-1 genetic transcription in the K562/A02 cell

1. tried to prepare before thing preparation and the experiment

(1) chemical compound GA establishes 3 of 12.5,6.25,3.125 μ g/ml and is tried concentration;

(2) extract RNA institute water, Tip and ep pipe and all spend the night, in case the RNA enzyme pollutes with 0.1%DEPC water logging bubble.And, place baking box to dry residual moisture for 50 ℃ equipment with the residual DEPC of High Temperature High Pressure removal, standby;

(3) the used electrophoresis tank of RNA electrophoresis, the device such as offset plate that falls are used detergent, pure water is cleaned, and use the water of handling through DEPC to be mixed with electrophoresis liquid and can carry out electrophoresis.

2. experimental technique

(1) group is provided with apoptosis experiment, 5 groups totally;

(2) adjusting cell concentration is 1 * 10 ⁶/ ml is provided with the different corresponding medicines that add according to group, and adjusting the ADM final concentration is 10 μ g/ml, and chemical compound GA final concentration is 3.125,6.25,12.5 μ g/ml, make ADM separately or associating GA add in the K562/A02 cell;

(3) place 37 ℃, 5%CO ₂After incubator is hatched 48h, collecting cell, PBS washes twice, goes in the ep pipe that said method handled;

(4) adjusting each experimental group cell concentration is 1 * 10 ⁶/ ml adds the Trizol test solution, the 1ml/ group, and the mixing that fully vibrates is placed 5min on ice, makes its abundant cracking, impels nucleoprotein complex to separate fully;

(5) adopt the low-temperature and high-speed centrifuge, 4 ℃, 12000rpm, 5min moves into supernatant in the new centrifuge tube of 1.5ml, and is stand-by;

(6) add the chloroform test solution, 200 μ l/ group is covered tight ep pipe pipe lid, manually behind the jolting mixing, places 10min on ice bag, and this step operation can not be adopted the vortex oscillation device, in case it is disconnected that mRNA is shaken;

(7) adopt low-temperature and high-speed centrifuge, 4 ℃, 12000rpm, 15min.Mixture after centrifugal is tangible three layers of differentiation: red bottom is phenol-chloroform layer, intermediate layer, and the water white water sample layer in upper strata.Change upper strata water (about 500-600ul) in another clean 1.5ml ep pipe with liquid-transfering gun.Intermediate layer material should be noted avoiding sucking during this step operation, otherwise protein contamination will be occurred;

(8) add isopyknic isopropyl alcohol (about 500-600 μ l), put upside down mixing gently, on ice bag, leave standstill 10min.Observe if no obvious sediment occurs, then can place-20 ℃ to spend the night;

(9) adopt the low-temperature and high-speed centrifuge, 4 ℃, 12000rpm, 10min abandons supernatant, and pipe end white precipitate is total RNA;

(10) carefully abandon supernatant,, add 75% ethanol, the 1ml/ group lentamente along tube wall.Put upside down mixing, the precipitation that suspends, thus clean residual salt;

(11) adopt the low-temperature and high-speed centrifuge, 4 ℃, the centrifugal 5min of 7500rpm carefully discards ethanol liquid.Drying at room temperature 5-10min volatilizees ethanol naturally;

(12) use the ultra-pure water 30 μ l dissolving RNA sample of handling through DEPC, hatch 10min for 50 ℃, to promote the RNA dissolving.After treating that the RNA precipitation is dissolved fully, can be stand-by in-80 ℃ of preservations;

(13) concentration determination of RNA: adopt the uv-spectrophotometric instrument measure the RNA that carries at the absorbance at 260nm and 280nm place and calculate its ratio (A260/A280), judge the purity (A260/A280 value between 1.8-2.0 time extractive RNA can be considered as the high-purity sample) of RNA sample in view of the above.Press 1OD=40 μ g and calculate the RNA productive rate, calculate its concentration at the absorbance of 260nm according to extractive RNA.Carry out reverse transcription reaction immediately, remaining sample continues to place-80 ℃ of preservations;

(14) RNA electrophoresis: conventional agarose gel electrophoresis, gum concentration are 1%, and electric field intensity is 8V/cm, when bromophenol blue is run out of 5cm, approximately during 10min, stop electrophoresis, and gel is placed observation RNA electrophoresis result uv analyzer under, Taking Pictures recording result.Mass ratio RNA electrophoresis preferably can be seen near three bands: the 200bp near 5SRNA band, the 1000bp 28SRNA band behind 18SRNA band, the 1500bp, and the brightness of 28S is about 2 times of 18S brightness, illustrate that total RNA extracts complete nothing degraded, satisfies the subsequent experimental requirement;

(15) the synthetic cDNA of reverse transcription:

1. in aseptic ep pipe, add following reagent

2. 65 ℃ of heating 5min place 1min on ice immediately, and strand is curled naturally;

3. of short duration centrifugal after, add following reagent in order successively

Total reaction volume is 20 μ l, and mixing gently vibrates;

4. 1h is hatched in 42 ℃ of warm railway carriage or compartments;

5. 95 ℃, 5min, inactivator;

6. obtain cDNA and carry out pcr amplification reaction.

(16) RQ-PCR reaction:

1. primer sequence: design of primers reference literature ^[18], and confirm its accuracy and reliability through checking Genebank and blastn.Transfer to Shanghai biological engineering company limited to required primer synthesize, separation, purification, mdr-1 primer synthetic alkali basic sequence is as follows:

mdr1：309bp

Sense：AGGCCAACATACATGCCTTC

Anti-sense：GCTCCTTGACTCTGCCATTC

β-actin：204bp

Sense：AACTGGGACGACATGGAGAA

Anti-sense：AGAGGCGTACAGGGATAGCA

2. the pcr amplification reaction system is as follows:

3. reaction condition is as follows: pre-95 ℃ of 10min of degeneration, and 95 ℃ of 15s of degeneration, the 59 ℃ of 20s that anneal extend 68 ℃ of 1min, totally 40 circulations;

4. interpretation of result

(1) real-time quantitative PCR result's analysis:

Adopting the relative quantification method of standard curve method, is internal reference with β-actin, by software analysis amplification curve and product melting curve, calculates the copy number of genes of interest mRNA according to the relative quantification method.Promptly according to genes of interest (mdr-1) and house-keeping gene (β-actin) the Ct value, according to 2 ^{-Δ Δ Ct}Method is calculated the relative amount of genes of interest with reference to house-keeping gene, relatively the expression of genes of interest.

(2) computing formula is as follows:

ΔCt＝Ct(Target)-Ct(β-actin)；

Genes of interest relative amount=2 ^{-Δ Δ ct}

Δ Δ Ct=[CtGl (testing sample)-CtGAPDH (testing sample)-[CtGl (correcting sample)-CtGADPH (correcting sample)).

The result: by solubility curve figure (Figure 16) as can be seen, each experimental group only has unique main peak, and it is good that mRNA purity is respectively organized in prompting, and can get rid of non-specific amplification product and primer dimer influences RQ-PCR result; In addition, the amplification curve diagram of this experiment (Figure 17) shows that each sets of curves flex point is clear, and exponential phase is obvious.Baseline is put down does not have the phenomenon that raises up, and the amplification efficiency height then is described, reagent sensitivity is good; Baseline on the figure is represented the amplification curve of negative sample, and is straight and do not have the trend that raises up, and then the yin and yang attribute contrast is clear, is difficult for causing negative specimen erroneous judgement.

RQ-PCR detects GA the result that influences that K562/A02 cell mdr-1mRNA expresses is shown, matched group and ADM group mRNA express and be respectively: 2.28,2.05, and prompting ADM self can not suppress the expression of K562/A02 cell mdr-1 mRNA, P＞0.05; And with the GA coupling after can slightly reduce K562/A02 cell mdr-1mRNA expression: behind the ADM combined effect K562/A02 cell 48h of the GA of 3.125 μ g/ml, 6.25 μ g/ml, 12.5 μ g/ml and 10 μ g/ml, the expression of its mdr-1mRNA is respectively 2.15,1.82,1.77, compare with matched group, the effect of downward modulation mdr-1mRNA is not obvious, does not possess statistical significance P＞0.05, Figure 18, from left to right be followed successively by: matched group, ADM group, GA-3.125,6.25,12.5 (μ g/ml).

Above embodiment explanation: chemical compound GA is a new tetracyclic diterpene compounds with remarkable inside and outside anti-tumor activity.Early stage, the inventor found in the exploration to GA reversing tumor MDR, people's chronic myelogenous leukemia cell (K562/A02) of the doxorubicin of anti-chemotherapeutic the (ADM) still has higher sensitivity in that multiple structure and the diverse chemotherapeutic of mechanism of action are produced under the drug-fast situation to chemical compound GA.This research is on the basis of previous work, with drug-fast K562/A02 and corresponding sensitive cells K562 thereof is model, multidrug resistance (MDR) characteristic and drug-fast degree and the GA reverse K562/A02 drug-fast effect of cell ADM and the intensity of drug resistance K562/A02 cell have been detected, and on the basis of GA reversion MDR, the mechanism of reverse effect is explored: detected the influence of GA aspects such as K562/A02 cell P glycoprotein (P-gp) expression and function, apoptosis resistance and mdr-1 gene code P-gp expression.

The result shows that chemotherapeutic ADM, epirubicin (EPI) and etoposide (VP-16) do not show the obvious suppression effect to the growing multiplication of drug resistance K562/A02 cell, its half-inhibition concentration (IC ₅₀) all greater than 100 μ g/ml, and to the IC of K562 cell ₅₀Be respectively 0.33,2.08 and 2.21 μ g/ml, K562/A02 is respectively 303.03 to the drug resistance index (RI) of above each chemotherapeutic, 48.08 and 45.25, show that the K562/A02 among the application possesses the MDR characteristic, and the K562 cell that adopts simultaneously in the experiment is the corresponding sensitive cells that contrasts Journal of Sex Research.

The susceptibility testing result shows, compares with other chemotherapeutic, and chemical compound GA acts on the K562/A02 cell and shown that then significant inhibition is active, its IC ₅₀Be 4.43 μ g/ml, show excellent drug sensitivity.Prompting K562/A02 cell still has higher sensitivity to the drug-fast while of multiple chemotherapeutic to chemical compound GA, and the subsequent experimental research that reverses K562/A02 for GA provides the feasibility foundation.

In order to confirm whether chemical compound GA is a potential MDR reversal agents, the application adopts mtt assay to detect the influence that GA and ADM coupling are grown to K562/A02 and K562 cell proliferation.Experimental result shows: K562/A02 tolerates ADM than K562, IC ₅₀Value is respectively 54.44 and 0.29 μ g/ml (P＜0.01); By the independent feminine gender group of effect of contrast ADM, GA 3.125,6.25,12.5 μ g/ml concentration and positive control VER 10 μ g/ml concentration respectively with the ADM coupling, all can significantly reverse the tolerance of K562/A02, and present dose dependent preferably, its IC ADM ₅₀Value is reduced to 24.13,1.38,0.84 and 1.68 μ g/ml respectively.From experimental result as can be seen, compare with the matched group of only handling through ADM, K562/A02 adds the IC that respectively organizes behind chemical compound GA or the VER ₅₀Value all reduces significantly, GA 3.125,6.25,12.5 μ g/ml concentration, VER during in 10 μ g/ml concentration the reverse multiple to K562/A02MDR be respectively 2.26,39.45,64.81 and 32.4 times, its difference credit is by statistics analysed and is all had significance P＜0.01.

Above embodiment is based on all that stable MDR cell model carries out, tentative confirmation GA reverse the effect of K562/A02 cell MDR, prompting GA may be a potential tumor MDR reversal agents.Among the embodiment subsequently, the inventor starts with from the mechanism that GA reverses K562/A02 cell MDR effect, by adopt FCM, direct immunofluorescence, AnnexinV/PI is two dyes various cellular elements biological methods such as method, RQ-PCR, further explore GA and reverse the K562/A02 molecular mechanism of drug-resistance.

The reason that produces MDR is many-sided, and it comprises: medicine effluxes to increase and causes that drug level reduces in the cell; The proteic mistake of P-gp expressed; Apoptosis is subjected to press down etc. ^[8]Leukemic traditional treatment means are combined chemotherapies, but 20%～30% patient can not obtain to alleviate or recurrence easily, it is former because the leukaemia produces MDR to chemotherapeutics, the P-gp high expressed is the important mechanisms of leukaemia MDR, discover recently, the transcripton of P-gp raises and cause P-gp to cross to express is the main cause that produces MDR, therefore and multidrug-associated protein (MRP) and lung resistance-related protein (LRP) only play secondary role, reduce P-gp and express reversible transfer part and divide leukemic MDR.People recognize that also apoptotic inhibition also is that the leukaemia produces drug-fast important mechanisms in recent years, take suitable mode to promote drug-fast apoptosis of leukemia or the expression that suppresses its anti-apoptotic genes expression can reach the effect of part palliating leukemia MDR ^[6]In view of the above, the application explores the mechanism of action that GA reverses K562/A02 cell MDR from above three majors avenues of approach.

ADM itself possesses the characteristic of sending fluorescence, and available FCM technology is directly measured at intracellular content it ^[19]Find that by detecting the variation that adds ADM content in VER or the GA front and back K562/A02 cell GA can significantly increase the accumulation of ADM in the K562/A02 cell, and presents dose dependent preferably.And effect is better than than positive control drug VER.Chemical compound GA when 3.125 μ g/ml concentration and negative control group relatively, significant difference has significance P＜0.05, and chemical compound GA compares at 10 μ g/ml and negative control group at 6.25 μ g/ml, 12.5 μ g/ml and VER, and its difference has highly significant P＜0.01; But the GA of same concentrations and VER to the K562 sensitive cells strain but do not have this effect.

Apoptosis is that body is that regulation and control self are grown, and keeps homeostasis, is regulated by its inherent gene programming, by biochemical process initiatively, makes the phenomenon of cell suicide death.Cell death inducing is the co-channel of numerous chemotherapeutics killing tumor cells, and in this sense, apoptosis is subjected to or apoptosis is escaped may be that tumor cell produces one of drug-fast mechanism [6].Phosphatidylserine in normal cell (PS) only is distributed in the inboard of cell membrane lipid bilayer, and early stage at apoptosis, and the PS in the cell membrane by rollover in the adipose membrane laterally.AnnexinV is that a kind of molecular weight is the Ca of 35-36KD ²⁺Dependency phospholipids incorporate albumen has high affinity with PS, so can combine with the after birth of the early stage cell of apoptosis by the PS that the outside exposes.Therefore AnnexinV is used as one of sensitivity index of checking early apoptosis of cells.AnnexinV is carried out the FITC labelling, with labelling AnnexinV as fluorescent probe, utilize flow cytometer can detect apoptotic generation.And propidium iodide (PI) is a kind of nucleic acid dye, and it can not see through complete cell membrane, but to the apoptosis cell and the dead cell in late period, and PI can permeate through cell membranes and nucleus is incarnadined.Therefore with AnnexinV and the use of PI coupling, just the cell differentiation that is in different apoptosis period can be come.Therefore this application promptly is to the apoptotic influence of K562/A02 when adopting FCM to detect ADM and GA coupling in conjunction with the two methods of dying of AnnexinV/PI.Experimental result shows, the inductive K562/A02 mdr cell of chemotherapeutic ADM can obtain existence by escape apoptosis or antagonism apoptosis, it can not obviously induce K562/A02 cell generation apoptosis, compare with matched group, difference not statistically significant P＞0.05 proves that ADM self can not be alleviated the K562/A02 cell because the apoptosis that MDR caused is obstructed.But after ADM and GA cooperate with the K562/A02 cell, the anti-apoptotic effect that can obviously alleviate MDR and caused, and present dose dependent preferably; GA can significantly improve ADM and induce the K562/A02 apoptosis, and behind the ADM synergy 48h of the GA of 12.5 μ g/ml and 10 μ g/ml, persister is increased to 74.41%, P＜0.05 by the apoptosis that ADM causes from 20.15%.In addition, the Bcl-2 gene family is to study more deep gene participating in apoptosis at present, and is closely related with drug resistance of tumor cell.And Bax promotes the representative of gene as apoptosis, and its overexpression can induce kinds of tumor cells to produce apoptosis, otherwise then produces drug resistance.At present, this application has is through beginning to seek the molecular mechanism that chemical compound GA reverses the anti-apoptotic effect of K562/A02 cell, and the result remains further to be verified.

P-gp has the function of energy dependence medicine efflux pump, belongs to ATP in conjunction with box (ATP binding cassette, ABC) transport protein superfamily member.It is driven by the ATP molecular energy, with the chemotherapeutics " pump " that enters cell to born of the same parents, thereby reduce drug level in the born of the same parents, make it not reach the concentration threshold of killing tumor cell and produce drug resistance.The tumor multi-medicine drug-resistant of P-gp mediation is considered to classical resistance mechanism.P-gp has universality with combining of medicine, can transport the different substrate of multiple structure, so tumor cell can produce MDR at the structure medicine different with mechanism of action ^[20]

The application has explored the influence of chemical compound GA to K562/A02 cell P-gp expression and function, searches out GA reverses K562/A02 cell MDR effect by the P-gp approach molecular mechanism.Its principle is the antigen (or cell-membrane receptor) and relevant fluorescent antibody combination by cell surface, formation has the antigen antibody complex of fluorescence, adopt its fluorescence volume of cells were tested by flow cytometry subsequently, can obtain the different antigen site expressions of cell mass.After employing is connected with P-gp monoclonal antibody (Anti-Pgp-PE) labeled cell of fluorescein PE, in conjunction with average fluorescent strength (MFI) value of the relevant antigen antibody complex that has fluorescence of streaming immunofluorescence technique detection, can react GA and use the proteic expression of front and back K562/A02 cell P-gp.The result shows that K562/A02 is than K562 cell high expressed P-gp, and its MFI value is respectively 101.4 ± 5.04 and 7.28 ± 1.02 (P＜0.01), proves that the K562/A02 cell strain is the drug resistance model of high expressed P-gp really; Yet chemical compound GA all expresses the P-gp of K562/A02 cell strain when 12.5 μ g/ml and two dosage of 6.25 μ g/ml and does not make significant difference, with the K562/A02 negative control group relatively, its difference does not have significance P＞0.05.Prompting chemical compound GA can not suppress the proteic expression of P-gp in the K562/A02 cell.

RH-123 is the specific substrate of P-gp, in the K562/A02 mdr cell, because the existence of P-gp certainly will be discharged the extracellular with its specific effect substrate RH-123.The inventor adopts FCM in view of the above, and by measuring the MFI value of RH-123 in the K562/A02 cell, indirect detection chemical compound GA is to the influence of the outer row function of P-gp albumen pump.The result shows that RH-123 concentration is significantly higher than corresponding K562/A02 mdr cell (P＜0.01) in the K562 cell; After being subjected to chemical compound GA effect, the concentration of RH-123 obviously increases than the K562/A02 negative control group in the K562/A02 cell, chemical compound GA when 6.25 μ g/ml and 12.5 μ g/ml dosage in the K562/A02 cell content of RH-123 compare with the K562/A02 negative control group, significant difference has highly significant, P＜0.01.And present dose-effect relationship preferably.Prompting chemical compound GA can dose dependent ground suppresses the efflux pump function of K562/A02 cell P-gp, reduces P-gp and effluxes the extremely extracellular effect of its substrate.More than the prompting of two experimental results, GA may express realization but not suppress it by suppressing P-gp efflux pump function by the molecular mechanism that the P-gp approach reverses K562/A02 cell MDR effect.

Mdr-1 is the proteic gene of coding P-gp, and its overexpression in tumor cell is considered to mediate the classical mechanism of MDR.Mdr1 and expression product thereof from the drug-resistant tumor cell strain, have been isolated in recent decades.Studies show that the p-gp level increases with mdr1 gene amplification and mRNA, the MDR effect also with its positive correlation.The RQ-PCR technology is meant to add fluorescent dyes such as fluorophor such as SYBR Green I that in the PCR reaction system SYBR Green is a kind of dna binding dye.In annealing and primer extension stage, dyestuff combines with double-stranded DNA, and fluorescence intensity increases, and when the DNA degeneration, signal can lower again.Therefore, in an individual system, its signal intensity can have been represented the quantity of double chain DNA molecule substantially.In RQ-PCR, by fluorescence detection device whole pcr amplification reaction process is carried out real-time monitoring and analysing amplified relevant fluorescence signal continuously, along with the carrying out of reaction, the variation of the fluorescence signal that monitors can be depicted as a curve.Can certain detect the amount of PCR product on a bit in that PCR reaction is in exponential phase, and infer the relative amount of testing gene thus with reference to house-keeping gene, i.e. the initial content of template.For the ease of the detection sample is compared, need to set a fluorescence signal intensity threshold value, fluorescence signal can be identified from the background noise of background when reaching this threshold value.Passing threshold defines the threshold cycle number (Ct) of sample, the implication of Ct value is that the fluorescence signal in each reaction tube reaches preset threshold and in after this being the reaction cycle number that is experienced when continuing Exponential growth, therefore, PQ-PCR and conventional P CR relatively, expression that more can accurately response gene.RQ-PCR detects GA the result that K562/A02 cell mdr-1mRNA expresses is shown, the mRNA expression values that matched group and ADM group record is respectively: 2.28,2.05, the two is compared, difference not statistically significant P＞0.05, prompting ADM self can not suppress the expression of K562/A02 cell mdr-1mRNA; ADM associating GA acts on the expression that the K562/A02 cell can slightly suppress K562/A02 cell mdr-1mRNA.3.1251, behind the ADM synergy K562/A02 cell 48h of the GA of 6.25,12.5 μ g/ml and 10 μ g/ml, the expression of its mdr-1mRNA is respectively 2.15,1.82,1.77, but compare with matched group, the effect of downward modulation mdr-1mRNA is not obvious, not statistically significant P＞0.05.This experimental result conforms to the experimental result that P-gp in detected GA before there is no downward modulation K562/A02 cell expresses, and has verified that once more GA is not to be to realize by the approach that suppresses P-gp protein expression or its upstream encoding gene mdr-1 by the molecular mechanism that the P-gp approach reverses K562/A02 cell MDR effect.

To sum up, the application has confirmed that GA can effectively reverse the MDR effect of K562/A02, and simultaneously, GA use in conjunction ADM can promote K562/A02 through the inductive apoptosis of ADM, and can increase in the born of the same parents of ADM and accumulate concentration, suppresses the efflux pump function of MDR cell P-gp.These presentation of results GA has significant MDR unkehr effect, for the preparation and the clinical practice of multidrug resistance reversing agent provides wide prospect.

Need not further to elaborate, believe and adopt the disclosed content in front, those skilled in the art can use the present invention to greatest extent.Therefore, the various measuring methods of technical process, quality index and other similar change all belong to the scope of the invention.

The list of references that the present invention quotes in the above is as follows:

1. Li Duan, Yin Ming, pharmacology, People's Health Publisher: 438;

2. Han Rui, Sun Yan, the chemoprophylaxis of new century cancer and Drug therapy: 275-277;

3. Xu Hong is refined, He Ling, etc.GP and cancer therapy drug share the reverse effect to tumor multi-medicine drug-resistant.Chinese Pharmacological circular Chinese Pharmacological Bulletin 2007Sep; 23 (9): 1207～12;

4.Krishna?R，Mayer?L?D.Modulation?of?p-glycoprotein(P-gP)mediated?multi-drug?resistance(MDR)using?chemosensitizers：recent?advances?in?the?design?of?selective?MDR?modulators[J].CurtMed?Anti?Cancer?Agents，2001，1(2)：163-74；

5.Norimasa?S，Tetsuro?M，Tatsuto?K，et?al.Two?dyridine?analogues?with?more?effective?ability?toreverse?multi-drug?resistance?and?with?lower?calcium?channel?blocking?activity?than?theirdihydropyridine?counterparts?[J].Cancer?Res，1990，50：3055-3059；

6. old Bao'an, Zhou Yun, Cheng Jian etc. the research [J] of Protein kinase C and K562/AO2 cell multidrug resistance dependency. leukemia-lymphoma, 2005,14 (1): 7-9;

7. Ceng Yixin, oncology, People's Health Publisher: 299-301;

8.Beck?WT.The?cell?biology?of?multiple?drug?resistance[J].Biochem?Pharmacol，1987，36(18)：2879-2887；

9.Fischer?V，Rodriguez?GA，Heitz?F，et?al.The?multi-drug?resistance?modulator?valspodar?(PSC833)is?metabolized?by?human?P4503A：Implications?for?drug-drug?interactions；

10.Mistry?P，Stewar?AJ，Dangerfield?W，et?al.In?vitro?and?invivo?reversal?of?P-glycoprotein?mediated?multi-drug?resistance?by?a?novel?potent?modulator，XR9576[J].Cancer?Res，2001，61：749-758；

11.Pusztai?L，Wagner?P，Ibrahim?N，et?al.Phase?II?study?of?Tariquidar，a?selective?P-gp?inhibitor，in?patients?with?chemotherapy-resistant，advanced?breast?carcinoma[J].Cancer?2005?Aug?104(4)：682-691；

12.Takara?K，Sakaeda?T，Okumura?K.An?update?on?overcoming?MDR1-mediated?multidrug?resistance?in?cancer?chemotherapy[J].Curt?Pharm?Des.2006，12(3)：273-286；

13.Rhoads?CD.Nitrogen?mustards?in?treatment?of?neoplastic?disease[J].JAMA，1946，21：656-677；

14. Zhou Jianjun, happy elegant virtue etc. estimate the active improvement of cancer-resisting substance MTT method. Chinese Journal of Pharmaceuticals, 1993; 24 (10): 455;

15.Thomas?Efferth，Mary?Davey，et?al.Activity?of?drugs?from?traditional?chinese?medicine?toward?sensitive?and?mdr1-or?mrp1-Overexpressing?multidrug-resistant?human?CCRF-CEM?leukemia?cells[J].Blood?cells，molecules，and?Diseases(2002)28(2)Mar/Apr：160-168；

16.Hao-Jie?ZHU，Jun-Sheng?WANG，et?al.Reversal?of?P-glycoprotein?mediated?multidrug?resistance?in?K562cell?line?by?a?novel?synthetic?calmodulin?inhibitor，E6[J].Biol.Pharm.Bull.28(10)1974-1978(2005)Vol.28，No.10；

17.Geraldo?Barroso?Cavalcanti，Jr，et?al.Co-expression?of?p53?protein?and?MDR?functional?phenotype?in?leukemias：the?predominant?association?in?chronic?myeloid?leukemia?[J].Cytometry?Part?B(Clinical?Cytometry)61B：1-8(2004)；

18. Wang Tao, horse Liang Ming etc.Arsenic trioxide associating buthionine sulfoximine is to the effect and the Mechanism Study thereof of K562/ADM cell, and Chinese Journal of Hematology rolled up for the 7th phase July the 28th in 2007;

19.Neil?S.Horowitz，et?al.The?role?of?topoteacan?for?extending?the?platinum-free?interval?in?recurrent?ovarian?cancer：an?in?vitro?model[J].Gynecologic?oncology?94(2004)67-63；

20.Ambudkar?SV，Kimchi-Sarfaty?C，Sauna?ZE，et?al.P-gp：from?genomles?to?mechanism[J].Oncogene，2003，22(47)：7468-7485。

Claims (3)

1. chemical compound 3, the purposes of 15-dicarbonyl gibberellic acid methyl ester GA in reverse multiple drug resistance of tumor.

2. the purposes of chemical compound GA according to claim 1 in reverse multiple drug resistance of tumor is characterized in that being used in preparation the application of antitumor cell multidrug resistance medicine.

3. the purposes of chemical compound GA according to claim 1 and 2 in reverse multiple drug resistance of tumor, it is characterized in that: the pharmaceutical preparation that chemical compound GA and at least a pharmaceutically acceptable carrier are made, dosage form is liquid preparation, granule, tablet, electuary, soft gelatin capsule, capsule, slow releasing agent, drop pill or injection.

Images