CN101928722B - New preparation of apolipoprotein A-IV - Google Patents
New preparation of apolipoprotein A-IV Download PDFInfo
- Publication number
- CN101928722B CN101928722B CN 200910067152 CN200910067152A CN101928722B CN 101928722 B CN101928722 B CN 101928722B CN 200910067152 CN200910067152 CN 200910067152 CN 200910067152 A CN200910067152 A CN 200910067152A CN 101928722 B CN101928722 B CN 101928722B
- Authority
- CN
- China
- Prior art keywords
- apoa
- pichia pastoris
- expression
- pastoris phaff
- apolipoprotein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to a recombinant protein and preparation and identification method thereof, in particular to the expression of a recombinant human apolipoprotein A-IV (rhApoA-IV) in saccharomyces pastorianus, and an optimized method for producing the recombinant human apolipoprotein A-IV through high-density fermentation. The probable purpose of the method in future is to produce the apolipoprotein A-IV in a large scale, and can be clinically used for adjusting blood fat metabolism.
Description
Invention field
The present invention relates to recombinant protein and preparation thereof, particularly relate to and in saccharomyces pastorianus, express recombination human apolipoprotein A-IV (rhApoA-IV), and the method for the high density fermentation Restruction human apolipoprotein A-Ⅰ V that optimizes.
Background of invention
ApoA-IV is a kind of acidic protein, is comprised of 376 amino acid, and relative molecular mass 46kD is the moiety of chylomicron (CM), vldl (VLDL) and high-density lipoprotein (HDL) (HDL).Healthy People fasting plasma ApoA-IV concentration is 0.13～0.16g/L.ApoA-IV is synthetic by small intestine and liver, and its Small Intestine occupies very important status, is subjected to the adjusting of triacylglycerol and cholesterol concentration in the blood plasma, and is secreted in the intestines when fat absorbing, and the ApoA-IV of hepatic secretion ten minutes is limited.The ApoA-IV of intestinal secretion mainly enters blood circulation through two approach.The ApoA-IV that enters blood by lymphsystem is distributed in CM, VLDL, HDL and the density component greater than 1.21g/ml in the lymph liquid; Another approach is the synthetic ApoA-IV of sub-fraction small intestine, directly enters blood circulation, is distributed among component, HDL and the VLDL of density greater than 1.21g/ml.ApoA-IV has the characteristic with lipid (mainly being phosphatide) combination, and the affinity of characteristic decision ApoA-IV between lipid of protein molecule surface microenvironment is combined.
ApoA-IV is the fastest a kind of lipophorin of turnover rate, and the plasma A poA-IV transformation period is 18～27.5 hours.People ApoA-IV gene and ApoA-I and ApoC-III gene linkage are positioned on the o.11 karyomit(e).ApoA-IV comprises 2 introns and 3 exons by 2603 based compositions.The length of 2 introns of ApoA-IV gene is respectively 357 and 777 Nucleotide.And the length of 3 exons is respectively 162,127 and 1180 Nucleotide.In the whole 5 ' non-translational region of first exons coding ApoA-IV mRNA of ApoA-IV gene and 20 codons of signal peptide front 16; Front 39 amino-acid residues of rear 4 amino-acid residues of Second Exon coded signal peptide and ripe blood plasma ApoA-IV; Mature amino acid residue and the mRNA3 ' non-coding region of the 3rd the ripe blood plasma ApoA-IV of exons coding.
ApoA-IV has different physiological roles:
1) effect in blood lipid metabolism
1. activate Lecithin-cholesterol acyltransferase (LCAT)
Although ApoA-IV and ApoA-I can both activate LCAT, substrate is different, and its activation efficiency is different.When doing substrate with cholesterol and a kind of saturated fatty acid, the specific activity ApoA-IV that ApoA-I activates LCAT is high; And when doing substrate with cholesterol and two kinds of saturated fatty acids, ApoA-IV activates the LCAT activity apparently higher than ApoA-I.
2. participate in reverse cholesterol transport
ApoA-IV has almost participated in each step of reverse cholesterol transport, and the lipid of its facilitate tissue interstitial fluid is transported in the blood vessel, activates LCAT, promotes the cholesterol esterification, is conducive to carrying and being combined with liver cell of HDL.ApoA-IV is the fabulous receptor of transhipment cholesterol.
3. with Cell binding
ApoA-IV can be combined with cell-specific.This is because the binding site of ApoA-IV is arranged on the liver plasma membrane.ApoA-IV can mediate HDL and Cell binding.
4. assisted activation lipoprotein lipase (LPL)
ApoA-IV can assist ApoC-II to disintegrate down from HDL or VLDL, is combined with CM or VLDL, impels ApoC-II to activate LPL.But under the condition that lacks ApoC-II, ApoA-IV can't activate separately LPL.The research of Goldberg is found, with ApoA-I, ApoE and cholesteryl ester transfer protein (CETP) are compared, when lacking VLDL, no matter be at physiological concentration or be lower than in the situation of physiological concentration, ApoA-IV can improve the LPL activity, if VLDL and ApoA-IV exist simultaneously, the LPL activity can increase by 100% (Goldberg IJ, Scheraldi CA, Yacoub IK, et al.Lipoprotein apoC-II activation of lipoprotein lipase:modulation by apolipoprotein A-IV[J] .J Biol Chem, 1990,265 (8): 4266-4272.).In the TG hydrolytic process of LPL mediation, the release of ApoC-II from HDL and VLDL all needs the ApoA-IV mediation.
5. modulation of appetite
2) antioxygenation
The oxidation index of the people ApoA-IV transgenic mice of ApoE defective (h-ApoA-IV/ApoE (0)) (comprises the LDL state of aggregation, anti-oxidant type LDL antibody, the tissue oxygen protein expression, heart medium sized artery plaque forms the expression of required special determinant) obvious (the Ostos MA that reduces, Concoin M, Vergnes L, etal.Antioxidative and antiatherosclerotic effects of human apolipoprotein A-IV inapolipoprotein E-deficient mice[J] .Arterioscler Thromb Vasc Biol, 2001,21 (6): 1023-1028), illustrate that ApoA-IV has antioxygenation.In this test, also find to have at the atherosclerotic plaque place gathering of ApoA-IV.The oxidative damage that these all point out ApoA-IV can suppress local organization, atherosclerotic progress therefore can slow down.Recalde studies discovery, the mouse of expressing people h-ApoA-IV/ApoE (0) can reduce atherosclerotic susceptibility (Recalde D, Ostos MA, Badell E, et al.Humanapolipoprotein A-IV reduces secretion of proinflammatory cytokines and atheroscleroticeffects of a chronic infection mimicked by lipopolysaccharide[J] .Arterioscler Thromb VascBiol, 2004,24 (4): 756-761).There is research to find, Patients Plasma with Coronary Heart Disease ApoA-IV level is starkly lower than control group (Warner MM, Guo J, Zhao Y.The relationship between plasma apolipoproteinA-IV levels and coronary heart disease[J] .Chin Med J, 2001,114:275-279).These confirm that all ApoA-IV has antioxygenation, and then prevent and treat atherosclerosis.
The different physiological roles acting in conjunction of ApoA-IV makes ApoA-IV have the adjusting blood lipid metabolism, prevents and treats atherosclerotic effect.At present, mostly ApoA-IV is from blood plasma to separate and purifying obtains, and cost is high and yield poorly.Therefore, be necessary to set up and develop recombinant expressed and method purifying ApoA-IV, in order to satisfy the demand of laboratory study.
Methylotrophic yeast, particularly pichia pastoris phaff are the eukaryotic expression systems of being furtherd investigate, and have been used to express many useful protein.For example, United States Patent (USP) 5,324,639 disclose the method for particularly producing type-1 insulin like growth factor at methylotrophic yeast in the pichia pastoris phaff cell; United States Patent (USP) 5,330,901 disclose the method for using pichia pastoris phaff system expression human serum albumin; United States Patent (USP) 5,965,389 provide in methylotrophic yeast the DNA construct of expressing Pidolidone decarboxylase (GAD65) and by the method for the pure GAD65 of preparation; United States Patent (USP) discloses the method for the platelet-derived cytokine (PDGF) of in pichia pastoris phaff expression; United States Patent (USP) 6,780,615 have described the method for using Recombinant Pichia pastoris production monellin.Yet, there is not yet so far about using pichia pastoris phaff to produce the report of human apolipoprotein A-Ⅰ V.
Goal of the invention
An object of the present invention is to provide the method for a kind of use methylotrophic yeast Restruction human apolipoprotein A-Ⅰ V (rhApoA-IV) polypeptide, the method is included in take methyl alcohol as carbon source with in the substratum of the energy and cultivates methylotrophic yeast, and wherein said methylotrophic yeast is to transform with the DNA construct that comprises the following element that is operatively connected: the derivable transcripting promoter of (1) methyl; (2) dna fragmentation of coding apolipoprotein A-1 V; (3) transcription terminator and (4) but selection marker, thereby produce apolipoprotein A-1 V polypeptide with the concentration of 120mg/L substratum at least.
According to a preferred embodiment of the invention, wherein said methylotrophic yeast is pichia pastoris phaff, and said methyl inducible promoter and transcription terminator are all from pichia pastoris phaff AOX1 gene.
Another object of the present invention provides for the methylotrophic yeast of expressing recombination human apolipoprotein A-IV, this yeast can rely on the methyl alcohol growth as carbon source and the energy, but and is that the DNA construct that is included dna fragmentation, transcription terminator and the selection marker of the derivable transcripting promoter of methyl, coding apolipoprotein A-1 V transforms.
According to a preferred embodiment of the invention, wherein said methylotrophic yeast is pichia pastoris phaff, and methyl inducible promoter and transcription terminator are all from pichia pastoris phaff AOX1 gene.
A further object of the present invention provides for expressing the DNA construct of recombination human apolipoprotein A-IV polypeptide at pichia pastoris phaff, and this construct comprises the element that is operatively connected: but dna fragmentation, transcription terminator and the selection marker of the derivable transcripting promoter of methyl, coding apolipoprotein A-1 V.
According to a preferred embodiment of the invention, wherein said methylotrophic yeast is pichia pastoris phaff, and said methyl inducible promoter and transcription terminator are all from pichia pastoris phaff AOX1 gene.
A further object of the present invention provides the fermentation culture conditions of the optimization of using pichia pastoris phaff scale operation recombination human apolipoprotein A-IV polypeptide, be characterised in that wherein leavening temperature maintains 28 ℃～30 ℃, employed pH value and is 6.0～6.5, and is added with the peptone of 0.5% (W/V) in the substratum.
Summary of the invention
The present invention relates to protein production and authentication method, particularly relate to the method for expression of apolipoprotein A-IV in saccharomyces pastorianus.
Pichia pastoris phaff (P.Pastoris) is the yeast expression system that has potentiality that grows up in the 80-90 age in 20th century, owing to it obtains using more and more widely having the incomparable advantage of other system aspect the protein expression.
As eukaryotic expression system, pichia pastoris phaff has the not available advantage of many other protein expression systems:
1. belong to unicellular organism, so kept the characteristics of easy handling and fast growth; 2. nutritional requirement is low, and medium component is simple, and production cost is low, is specially adapted to large-scale industrialization production; 3. by homologous recombination, expression vector stably can be incorporated in the host chromosome, be difficult in the continuous passage losing; 4. have strong alcohol oxidase gene (AOX) promotor, can strictly regulate and control the expression of foreign gene; 5. expression amount is high, and the productive rate of many albumen can reach every liter of above level of gram; The protein of 6. expressing not only can be present in the born of the same parents but also can secrete to born of the same parents, and the secretory volume of pichia pastoris phaff oneself protein matter is very low, extremely is conducive to the purpose product purification; 7. as eukaryotic expression system, correct processing and modification after can translating the albumen of expressing; 8. degree of glycosylation is low.
Pichia yeast expression system is comprised of an exogenous gene expression frame and AOX1 promotor, multiple clone site (MCS) and a terminator sequence that copies from the AOX1 gene (TT).Simultaneously, most of carriers all comprise as the HIS4 gene of selection markers and the sequence (such as ColEI replication origin and anti-penbritin gene) that exists for copying propagation.In addition, also contain the AOX13 ' non-coding area sequence that makes foreign gene can be incorporated into alternative or inserted mode chromosomal AOX1 position.Carrier used in the present invention is to be made of elements such as promotor, terminator, selective marker, reporter gene, replication orgin.Excretion vector also needs to have signal sequence in addition.
The most frequently used promotor is the AOX1 promotor, and its methanol induction is very strong, thereby the foreign gene under its control can obtain higher expression.Most oxidation of ethanol enzyme activities are provided by AOX1 in the cell.When growing take glucose or glycerine as the substratum of carbon source, AOX1 transcribes and is suppressed; And take methyl alcohol as unique growth carbon source the time, then can induce transcribing and protein expression of AOX1 gene.Selective marker (HIS4) generally is the wild type gene corresponding to the auxotrophy receptor.
The protein of pichia pastoris phaff self secretion seldom, so secreting, expressing is a kind of desirable phraseology.Simultaneously, extracellular expression more is conducive to extraction and the purifying of protein.The preferred signal peptide of the present invention is a factor (aMF).A factor signal sequence is comprised of 87 amino acid, comes from a sexual maturity factor leader sequence of cereuisiae fermentum (S.cerevsia), and the signal peptide of this section sequence encoding is inserted the people in the expression vector of pichia pastoris phaff.
Pichia pastoris phaff expression vector of the present invention can be intracellular expression, also can be secreting, expressing.These carriers all comprise an expression cassette that is comprised of 3 ' sequence of the Transcription Termination gene of 5 ' AOX1 sequence fragment of 0.9kb and about 0.3kb.Secreted expression carrier can be pPIC9, pPIC9k, pHIL-Sl, pPICZa, pYAM75P6E6 etc.; The carrier of intracellular expression can be pHIL-D2, pA0815, pPIC3K, pPICZ, pHWOl0E121, pGAPZ, pGAPZa etc.The present invention is pPICZa preferably.
The general Pichia Pastoris strain that is used for exogenous gene expression comprises Y-11430, M-6100-3, GS115, KM71, SMD1168 etc., and the present invention is pichia pastoris phaff X-33 bacterial strain preferably.
After obtaining carrying the recombinant expression vector of apolipoprotein A-1 V gene, can use the methods such as lithium salts method, PEG method, spheroplast method and electroporation to transform the pichia pastoris phaff host cell.Wherein, the preferred method for transformation of the present invention is electroporation (Sambrook, ed.Molecular Cloning:A Laboratory Manul (2nd.ed.ed, Vols.1-3, ColdSpring Harbor Laboratory, 1998).
Import recombinant expression vector in the yeast body only have with yeast chromosomal on homologous region recombinate, be incorporated on the karyomit(e), foreign gene can stable existence and is expressed.Among the present invention, in order stably to express goal gene, can be in the single endonuclease digestion site of His or 5 ' AOX1 with plasmid vector linearizing (Sac I), make it to change by single cross and be incorporated in the yeast cell karyomit(e), be Mut thereby obtain phenotype
+And has a transformant that high methanol utilizes ability.
Be used for many posttranslational modification functions that pichia pastoris phaff of the present invention contains typical higher eucaryote.These functions comprise processing, the protein folding of signal peptide, formation, O-and the glycosylation of N-type and the acidylate etc. of disulfide linkage.Wherein, most important and most study is glycosylation.The glycosylation chain of protein participates in cell recognition, hormone receptor combination, protein positioning and host-microorganism interphase interaction.Glycosylation process is the reaction that also produces the few ribose that is comprised of Mans-6-GluNAC2 (high mannose type) through a series of montages.Pichia pastoris phaff can be connected to carbohydrate on the exogenous protein of secreting, expressing.The mean length that pichia pastoris phaff is modified sugar chain is 8～14 seminoses, and outer chain do not contain a-1, and 3 seminoses are so the glycoprotein of its expression is particularly suitable for the treatment application.
Since fully optimized fermentation pH value among the present invention, the culture condition such as stir speed (S.S.), nutrient, thus can make the yeast high-density growth, thus efficiently expressing of product caused.For example, under the horizontal culture condition of test tube, recombinant apolipoprotein A-IV polypeptide output of the present invention can reach 120mg/L.
In most cases, integrate the multiple copied foreign gene in the pichia pastoris phaff (P.Pastoris) and can improve expression of recombinant proteins output, so the present invention preferentially selects secretor type, high copy mark and easy-operating shuttle vectors, particularly pPICZa as the expression vector of Apo A-IV polypeptide.
In addition because when integrating in the His site, the His site of chromosome mutation can and the HIS4 gene locus of expression cassette between the producer exchange can cause losing of expression cassette, so ordinary priority selection AOX1 site.
Among the present invention, the employed substratum of fermentation culture can be the substratum such as BMGY/BMMY, BMG/BMM, MGY/MM, but preferably contains BMGY/BMMY or the BMG/BMM substratum of damping fluid in the composition.
As unique carbon source and the energy, the add-on of methyl alcohol is generally the 0.5-1.0% of volume of culture (V/V).
In the fermentation culture process, can use known method to detect the ApoA-IV content of peptides that produces by being converted the cellular segregation thing, and therefrom select to have the cellular segregation thing of high yield, be used for amplifying and produce.
The present invention first in yeast (pichia pastoris X-33) efficient secretory expression rhApoA-IV, set up stable rhApoA-IV pichia spp and efficiently expressed system.Compare with Expression in Escherichia coli, method of the present invention has following features: 1. expression system is stable, and the expression cassette that contains goal gene is integrated into by homologous recombination in the karyomit(e) of yeast, and bacterial classification is stable, does not have the problem of plasmid loss; 2. effective secreting, expressing, the expression of target protein matter is subjected to the strict control of alcohol oxidase promotor, can under methanol induction, start and express and expression product is secreted in the substratum, and the albumen of pichia spp itself seldom is secreted in the substratum, make target protein be easier to purifying; 3. express the output height, the test tube horizontal expression amount of rhApoA-IV in pichia spp can be up to 120mg/L; 4. there is not the contaminated with endotoxins problem; 5. the large scale fermentation production cost is low.
The present invention has set up the method for efficient secretory expression rhApoA-IV in yeast, use SDS-PAGE and protein N-terminal sequencing analysis, the rhApoA-IV that confirmation is produced according to the inventive method has sequence and the physico-chemical property identical with natural A poA-IV, thereby provides prerequisite for further detecting its inside and outside biologic activity.
The result shows that the expression rate of the Pichia yeast engineering high density fermentation Restruction human apolipoprotein A-Ⅰ V that the present invention sets up is about the 120mg/L fermented liquid, has sequence and the physico-chemical property identical with natural A poA-IV.These results of study of the present invention will provide necessary basis for suitability for industrialized production and the clinical application of restructuring human apolipoprotein A-Ⅰ V undoubtedly.
Description of drawings
Fig. 1 shows that the PCR of recombinant plasmid pPICZ a/hApoA-IV transformed yeast bacterium identifies electrophoretogram.Wherein swimming lane 1 is dna molecular amount mark (DL2000); Swimming lane 2～5th, the pcr amplification product of different conversion of saccharomycetes subgenom DNA.
Fig. 2 shows the impact (SDS-PAGE analysis) that pH expresses rhApoA-IV.Wherein swimming lane 4 is: Takara protein molecular weight mark; Swimming lane 1～3 and 5～8 is respectively abduction delivering 96h supernatant under pH4.0,4.5,5.0,5.5,6.0,6.5,7.0 conditions.
Embodiment
Below by embodiment preferred forms of the present invention is described.These embodiment are intended to further illustrate for example the present invention, rather than limit by any way the await the reply scope of claim of the present invention.
Embodiment 1: clone and the amplification of human apolipoprotein A-Ⅰ V gene (hApoA-IV)
(1) the Trizol method is extracted total RNA from people small intestine
The size of 100mg is cut in the people small intestine of fresh separated, puts into immediately the liquid nitrogen quick-frozen.From tissue, extract total RNA by following method.Take out the freezing mortar of organizing 300mg to put into to fill liquid nitrogen, tissue is pulverized.The tissue that will pulverize moves in the 50ml centrifuge tube, adds about 5ml Trizol, in room temperature homogenizer high-speed homogenization 15～30s.Add 1.0ml chloroform (200 μ l/ml Trizol), fully vibration shakes up, and places 5min under the room temperature.Behind 4 ℃ of centrifugal (12000r/min) 15min upper water is moved in another centrifuge tube mutually.Add the equal-volume Virahol, vibration shakes up, precipitation at room temperature 10min, and 4 ℃ of centrifugal (12000r/min) 15min abandon supernatant.Add 75% ethanol 1ml washing precipitation 2 times, 4 ℃ of centrifugal (12000r/min) 5min, the remaining ethanol of air evaporation under the room temperature.Total RNA precipitation is dissolved in the 50 μ l DEPC treated waters, and-80 ℃ save backup.
Get 100 times of 1 μ l diluted samples and measure A260 and A280 by ultraviolet spectrophotometer, calculate its concentration and purity, agarose gel electrophoresis is observed the integrity of RNA.
Rna content calculates by following formula:
RNA concentration (μ g/ μ l)=A260 * 40 * extension rate/1000
A260/A280=1.8～2.0 expression purity are qualified
(2) hApoA-IV gene cloning (RT-PCR method)
The RT reaction:
The total RNA 1 μ g that in 0.2ml EP pipe, adds said extracted, 1 μ l OligodT, 70 ℃ of sex change 10min, then ice bath 1min adds following reaction solution:
MgCl
2 4μl
10 * RNA PCR damping fluid, 2 μ l
RNA enzyme inhibitors 0.5 μ l
dNTP(10mmol/L) 2μl
AMV reversed transcriptive enzyme 1 μ l
Add to final volume 20 μ l without RNA enzyme sterilization ultrapure water
42 ℃ of reaction 60min on the PCR instrument, then 99 ℃ of 5min deactivation reversed transcriptive enzymes synthesize cDNA and are used for next step PCR reaction.
The PCR reaction:
Add following reaction system in the above-mentioned 0.2ml EP pipe:
10 * LA PCR damping fluid, 8 μ l
LATaq 1μl
The sterilization ultrapure water adds to final volume 100 μ l
Carry out cyclic amplification at the PCR instrument.Amplification program is:
①94℃2min
2. 94 ℃ of 30s, 59 ℃ of 30s, 72 ℃ of 1min, 30 circulations
③72℃10min
This PCR reaction primer sequence is as follows:
Upstream primer: 5 '-GATCCAGTGTGGCAAGAAACTCCT-3 ' (SEQ ID NO:1)
Downstream primer: 5 '-TTGGGACAGACAGACAGACAGGT-3 ' (SEQ ID NO:2)
Whether amplified production carries out 1% agarose gel electrophoresis, observe clip size and coincide with expected results, determines whether to obtain correct goal gene.
(3) structure of cloning vector, conversion and amplification
Reclaim the hApoA-IV gene fragment of pcr amplification and carry out 1% agarose gel electrophoresis analysis.After the recovery, 16 ℃ in hApoA-IV gene fragment and T carrier is connected 30 minutes.The ligation system comprises: hApoA-IV gene fragment 0.1～0.3pmol; T carrier 0.03pmol; Solution I (contain dna ligase and be connected damping fluid, see Takara company's T support agent box) 5 μ l; The sterilization ultrapure water is to final volume 10 μ l.
According to ordinary method, from 37 ℃ of XL that cultivate 16 hours
1(not containing antibiotic LB agar plate) single bacterium colony of picking on the negative culture plate of-Blue (diameter 2～3mm) is inoculated in the 1L culturing bottle that contains 100ml LB substratum, with preparation competence Bacillus coli cells, and frozen for subsequent use in-80 ℃.
After getting a frozen competent cell thawing, add above-mentioned connection product, carry out routine and transform.Then get competent cell that 200 μ l have transformed and coat on the LB agar plate that contains X-Gal, IPTG (the two can be before being coated with bacterium half an hour be applied to LB agar plate surface) and penbritin (100 μ g/ml), cultivated 12～16 hours in 37 ℃ of incubators.
(4) evaluation of recombinant vectors
White single bacterium colony (" indigo plant is screened in vain ") after picking transforms at random is inoculated in the LB substratum that contains penbritin (1 μ g/ml), 37 ℃ of strong concussion overnight incubation, the then conventional plasmid DNA of extracting.The DNA throw out of getting 1 μ l dissolving carries out the agarose gel electrophoresis quantitative analysis and enzyme is cut evaluation.The two enzymic digestions of 37 ℃ of Hind III, Stu I 2 hours are identified correct clone according to the inscribe zymogram behind 1% agarose gel electrophoresis.Select enzyme and cut the correct clone of evaluation, extract plasmid, be used for dna sequencing.
The structure of embodiment 2:hApoA-IV pichia spp secreted expression carrier pPICZa/hApoA-IV and host cell transform
Get above-mentioned order-checking and identify the correct plasmid 50ng that carries the hApoA-IV gene, in 0.2ml EP pipe, set up the PCR reaction system according to the above ratio.Utilize above-mentioned PCR reaction system and condition, introduce partial sequence and the XhoI site of yeast a factor signal peptide by upstream primer 5 '-TAACTCGAGAAGAGAGAGGTCAGTGCTGA-3 ' (SEQ ID NO:3), and utilize downstream primer: 5 '-TATTCTAGATCAGCTCTCCAAAGGGGCCA-3 ' (SEQ ID NO:4) introduces Xba I site.After PCR introduces above-mentioned sequence and restriction enzyme site, reclaim the purpose fragment.After cutting with corresponding enzyme, be connected into the plasmid pPICZa after cutting with same enzyme, make up yeast expression vector pPICZa/hApoA-IV, then transform intestinal bacteria, extract plasmid and also carry out enzyme and cut and identify and the determined dna sequence analysis.
Get the correct cultivation bacterium liquid of order-checking, extract plasmid DNA and carry out quantitative analysis with agarose gel electrophoresis method by the plasmid extraction kit specification sheets.Get 10～15 μ g pPICZa/hApoA-IV recombinant plasmids after SacI enzymic digestion (linearizing), precipitate with phenol/chloroform extracting and with ethanol.Linearizing plasmid is for subsequent use on ice with 10 μ l ultrapure waters dissolving postposition.
(it is dull and stereotyped not contain antibiotic YPD Agar) single bacterium colony of picking from the negative culture plate of the YPD of pichia pastoris X-33 is inoculated in the 5ml YPD substratum, 250rpm, and 30 ℃ of concussions were cultivated 8 hours, prepared the yeast competent cell with routine.
Then get the above-mentioned competence bacteria of 80 μ l, mix with the linearizing recombinant expression plasmid of 10～15 μ g, move in the 0.2cm electricity conversion cup and carry out the electricity conversion.The bacterium liquid of getting after 50～100 μ l transform is coated on the YPD flat board that contains Zeocin (100 μ g/ml), and 30 ℃ of incubators were cultivated 2～3 days, observed the upgrowth situation of transformant.PCR method screening transformed yeast bacterium.Behind the centrifugal recovery thalline, extract the pastoris genomic dna performing PCR of going forward side by side and identify that qualification result as shown in Figure 1.
The expression of embodiment 3:ApoA-IV polypeptide
The clone who gets the above-mentioned qualification result positive is inoculated in 10ml BMGY (pH6.0) substratum, and 30 ℃ of concussions were cultivated 24 hours, to OD
600Reach 2.0～6.0 o'clock collecting cells.With equal-volume (10ml) BMMY (pH6.0) re-suspended cell precipitation, abduction delivering is cultivated in 30 ℃ of concussions.In the Induction Process, replenished a methyl alcohol to final concentration 0.5% in per 24 hours, replenish simultaneously the sterilization ultrapure water, the fermented liquid cumulative volume is remained unchanged.Respectively get the 0.5ml fermented liquid at the 0th, 24,48,72,96,120,144, the 168 hour equi-time point of cultivating, the centrifuging and taking supernatant is used for protein analysis (SDS-PAGE, n terminal amino acid sequential analysis etc.).
The physico-chemical property of embodiment 4:ApoA-IV polypeptide is identified
(1) SDS-PAGE analyzes
Carry out mensuration and the rough quantitative analysis of protein molecular weight with SDS-PAGE.Method is as follows:
1) glue: record separation gel and concentrated glue in following ratio.
1. 5% concentrate glue:
30% acrylamide 1.0ml
1.0mol/L Tris-HCl(pH6.8) 0.75ml
Ammonium persulphate 0.06ml
10％SDS 0.06ml
TEMED 0.006ml
Sterile purified water 4.1ml
2. 12% separation gel:
30% acrylamide 3.3ml
1.5mol/LTris-HCl(pH8.8) 2.5ml
10％SDS 0.1ml
Ammonium persulphate 0.1ml
TEMED 0.004ml
Sterile purified water 4.0ml
2) get respectively 24h, 48h, 72h, 96h, 120h culture supernatant in 4: 1 ratio adding 5 * SDS sample buffers, behind the mixing, boil 5min.
3) take out above-mentioned sample, be cooled to room temperature after, centrifugal (10000r/min) 30s gets the every hole of supernatant application of sample 50 μ l.
4) the 50V electrophoresis is adjusted voltage to 100V, the constant voltage electrophoretic separation to concentrated glue and separation gel intersection.
5) after coomassie brilliant blue staining, the decolouring, the observation analysis result.
(2) amino acid sequence analysis of expression product
The primary structure of protein is the basis of its higher structure, during with the gene recombination technology expression secreted protein, signal peptide mistake cutting phenomenon appears in the heterologous protein of expressing easily in the processing ripening process, then affect higher structure and the bioactive performance of expressing protein.Therefore, determine to tackle the determined amino acid sequence that expressed recombinant protein carries out protein N-end in the correct situation of molecular weight at SDS-PAGE, to determine the exactness of its primary structure.Sequencing result shows that the recombination human apolipoprotein A-IV for preparing according to the inventive method has the identical aminoacid sequence with wild-type apolipoprotein A-1 V.
Embodiment 5:rhApoA-IV the determining of best pH that ferment
Pichia spp is very wide to the pH subject range of substratum, can both grow well at pH 3.0～6.0, but in the process of fermentation expression foreign protein, fermented liquid pH has a great impact the expression of foreign protein, and is particularly evident when large scale fermentation cell high-density culture.Therefore, before carrying out large scale fermentation, the pH that has carried out fermentation expression rhApoA-IV in the shaking table level optimizes, and expressing for the large scale fermentation of rhApoA-IV provides call parameter.
Choose the high rhApoA-IV Pichia yeast engineering of expression amount and be inoculated in the 10ml YPD substratum, 30 ℃, 250r/min concussion cultivation 24～36h.The bacterium liquid 1ml that gets above-mentioned cultivation is inoculated in 30 ℃, 250r/min concussion cultivation 24～36h in the 100ml BMGY substratum.Get respectively above-mentioned bacterium liquid 10ml and place the 50ml centrifuge tube, room temperature centrifugal (3000r/min) 10min abandons supernatant.Each pipe adds respectively the BMMY 9ml with damping fluid, adds 1molL
-1Na
2HPO
4And 0.5molL
-1Citric acid is mixed with the BMMY abduction delivering of different pH, and (the hApoA-IV engineering bacteria is abduction delivering under 4.0,4.5,5.0,5.5,6.0,6.5,7.0 the condition at pH respectively, determine the optimal pH of rhApoA-IV fermentation), 30 ℃, 250r/min shake cultivation, additional methyl alcohol to the final concentration of every 24h is 0.5% in the Induction Process, replenish simultaneously the sterilization deionized water, the fermented liquid cumulative volume is remained unchanged.Respectively get the 0.5ml fermented liquid at 72,96,120,144,168 hours equi-time points of cultivation, the centrifuging and taking supernatant carries out Protein quantitative analysis (SDS-PAGE method).
The result is presented at pH and is lower than in 5.0 the fermented liquid supernatant, almost can't detect rhApo A-IV; Under pH value 6.0～7.0 conditions, the rhApoA-IV expression amount is the highest, determines that pH 6.5 is the best pH condition (referring to accompanying drawing 2) of rhApoA-IV fermentation.
Sequence table
＜110〉Jinlin Shengyuan Science ﹠. Technology Co., Ltd.
＜120〉preparation of a kind of new apolipoprotein A-1 V
<140>
<141>
<160>4
<210>1
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the pcr amplification primer as the structure cloning vector that designs according to specific nucleotide sequence.
<400>1
GATCCAGTGT GGCAAGAAAC TCCT
<210>2
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the pcr amplification primer as the structure cloning vector that designs according to specific nucleotide sequence.
<400>2
TTGGGACAGA CAGACAGACA GGT
<210>3
<211>29
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the pcr amplification primer as construction of expression vector that designs according to specific nucleotide sequence.
<400>3
TAACTCGAGAAGAGAGAGGT CAGTGCTGA
<210>4
<211>29
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the pcr amplification primer as construction of expression vector that designs according to specific nucleotide sequence.
<400>4
TATTCTAGAT CAGCTCTCCAAAGGGGCCA
Claims (3)
1. method of using pichia pastoris phaff Restruction human apolipoprotein A-Ⅰ V polypeptide, the method comprises: cultivating pichia pastoris phaff take methyl alcohol as carbon source with in the substratum of the energy, wherein said pichia pastoris phaff is to transform with the DNA construct that comprises the following element that is operatively connected: the derivable transcripting promoter of (1) methyl; (2) dna fragmentation of encoding human apolipoprotein A-1 V; (3) transcription terminator and (4) but selection marker, thereby obtain recombination human apolipoprotein A-IV polypeptide with the concentration of 120mg/L substratum at least, wherein said methyl inducible promoter and transcription terminator are all from pichia pastoris phaff AOX1 gene.
2. be used for expressing at pichia pastoris phaff the DNA construct of recombination human apolipoprotein A-IV, this construct comprises the element that is operatively connected: but dna fragmentation, transcription terminator and the selection marker of the derivable transcripting promoter of methyl, encoding human apolipoprotein A-1 V.
3. according to claim 2 construct, wherein said methyl inducible promoter and transcription terminator are all from pichia pastoris phaff AOX1 gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910067152 CN101928722B (en) | 2009-06-22 | 2009-06-22 | New preparation of apolipoprotein A-IV |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910067152 CN101928722B (en) | 2009-06-22 | 2009-06-22 | New preparation of apolipoprotein A-IV |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101928722A CN101928722A (en) | 2010-12-29 |
| CN101928722B true CN101928722B (en) | 2013-03-13 |
Family
ID=43368151
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910067152 Expired - Fee Related CN101928722B (en) | 2009-06-22 | 2009-06-22 | New preparation of apolipoprotein A-IV |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101928722B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007130403A2 (en) * | 2006-05-02 | 2007-11-15 | University Of Pittsburgh-Of The Commonwealth System Of Higher Education | REGULATION OF ApoB BY Hspl 10 PROTEINS AND RELATED COMPOSITIONS AND METHODS |
-
2009
- 2009-06-22 CN CN 200910067152 patent/CN101928722B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007130403A2 (en) * | 2006-05-02 | 2007-11-15 | University Of Pittsburgh-Of The Commonwealth System Of Higher Education | REGULATION OF ApoB BY Hspl 10 PROTEINS AND RELATED COMPOSITIONS AND METHODS |
Non-Patent Citations (2)
| Title |
|---|
| 冯美卿.重组人载脂蛋白A-Ⅰ在毕赤酵母( Pichia pastoris)中的高表达.《生物工程学报》.2004,第20卷(第6期),906-911. * |
| 张彦.重组人载脂蛋白AⅠ米兰突变体在酵母中的分泌表达.《复旦学报》.2008,第47卷(第3期),重组人载脂蛋白AⅠ米兰突变体在酵母中的分泌表达. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101928722A (en) | 2010-12-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102146135A (en) | Recombinant human-like collagen and production method thereof | |
| CN100494385C (en) | Constructing method for transgenic Chlamydomonas reinhardtii bioreactor | |
| CN103525784B (en) | Partial glyceride lipase mutant, plasmids, recombination strains, preparation methods and applications | |
| US20230295594A1 (en) | Method for the efficient expression and purification and application of a recombinant fusion protein of mannase and homologues thereof and glp-1 | |
| CN101974587A (en) | Efficient expression method of human serum albumin | |
| CN103756985B (en) | Myrmecia incisa Reisigl diacylglycerol acyltransferase gene sequence and use thereof | |
| CN105733973A (en) | Recombinant pichia pastoris expressing proline aminopeptidase and construction method of recombinant pichia pastoris | |
| CN103421794B (en) | Expression element composed of aspergillus niger and expression vector composed of expression element, and recombined aspergillus niger and construction method and application thereof | |
| CN103468595A (en) | Saccharomycetes for expressing recombinant human serum albumin, construction method and application thereof, and method for expressing recombinant human serum albumin | |
| RU2676321C1 (en) | METHOD FOR OBTAINING THE ENZYME PREPARATION OF A2 PHOSPHOLIPASE WITH THE APPLICATION OF A RECOMBINANT PRODUCTSTRAIN PICHIA PASTORIS X-33/pPiCZαA-PhoA2-StV | |
| CN100348720C (en) | Mannase and its coding gene and uses | |
| CN101928723B (en) | Preparation of new apolipoprotein A-II | |
| CN101928722B (en) | New preparation of apolipoprotein A-IV | |
| CN104278017A (en) | Recombinant expression method of human lysozyme | |
| CN103114089B (en) | Strong promoter from trichoderma reesei as well as expression vector and application thereof | |
| CN100354424C (en) | Expression method for high temperature resistant xylanase and specific expression carrier for same | |
| CN101864372A (en) | Preparation method of antibacterial peptide gene engineering strain | |
| CN103031289A (en) | Lactase and recombinant expression engineering bacterium thereof | |
| CN102399803B (en) | Improved beta-glucosidase gene and preparation of recombinase thereof | |
| CN104212779B (en) | A kind of novel ribonuclease A and purifying production process thereof | |
| KR20200132835A (en) | High productivity method for growing algae | |
| CN101928721B (en) | Preparation of new apolipoprotein C-I | |
| CN104593362B (en) | DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof | |
| CN102978234B (en) | Eukaryotic expression method of molt-inhibiting hormone-1 gene of mitten crab | |
| CN102321665B (en) | Method for expressing human humanin protein in peanut seed |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130313 Termination date: 20210622 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |