CN105733973A - Recombinant pichia pastoris expressing proline aminopeptidase and construction method of recombinant pichia pastoris - Google Patents
Recombinant pichia pastoris expressing proline aminopeptidase and construction method of recombinant pichia pastoris Download PDFInfo
- Publication number
- CN105733973A CN105733973A CN201610202929.1A CN201610202929A CN105733973A CN 105733973 A CN105733973 A CN 105733973A CN 201610202929 A CN201610202929 A CN 201610202929A CN 105733973 A CN105733973 A CN 105733973A
- Authority
- CN
- China
- Prior art keywords
- aminopeptidase
- pichia pastoris
- recombinant
- proline aminopeptidase
- proline
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/485—Exopeptidases (3.4.11-3.4.19)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/14—Dipeptidyl-peptidases and tripeptidyl-peptidases (3.4.14)
- C12Y304/14012—Xaa-Xaa-Pro tripeptidyl-peptidase (3.4.14.12), i.e. prolyltripeptidyl aminopeptidase
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses recombinant pichia pastoris expressing proline aminopeptidase and a construction method of the recombinant pichia pastoris, and belongs to the field of bioengineering technologies and genetic engineering.According to the construction method, proline aminopeptidase genes derived from aspergillus oryzae are optimized and then integrated into pichia pastoris chromosomes to obtain the recombinant pichia pastoris GS115/pPIC9K-pap, and the recombinant strain can efficiently express the proline aminopeptidase; after preliminary optimization through flask shaking is performed, the enzyme activity of supernatant of fermentation liquor is 5.6 U/mL, the intracellular enzyme activity is 61.26 U/mL, and a foundation is laid for industrialized production of the recombinant proline aminopeptidase.
Description
Technical field
The present invention relates to a kind of recombinant yeast pichia pastoris expressing proline aminopeptidase and construction method thereof, belong to biotechnology and
Genetic engineering field.
Background technology
Proline aminopeptidase, as a kind of circumscribed-type protease, has critically important answering at multiple fields such as food, medicine and chemical industry
With.The bitterness, the depth hydrolysis of protein, the preparation of biologically active peptide and the recombiant protein that can be used for removing in protein hydrolyzate are solid
Determine the toolenzyme etc. needed for agent or protein sequence mensuration, have a extensive future with chemical industry in food, medicines and health protection.
Aspergillus oryzae is a kind of fermentation industry bacterium being widely used in production, and its proline aminopeptidase expressed has good physicochemical property.
But owing to its expression is low, protein stability is poor, and purification steps troublesome, is difficult to meet the market demand.At present to proline ammonia
The heterogenous expression research of peptidase focuses primarily upon the prokaryotic hosts such as escherichia coli, although improve the expression of recombiant protein, but
Have the disadvantage in that 1) it is difficult to secreting, expressing, is easily formed inclusion body；2) produce endotoxin and there is potential safety hazard, be not suitable for food
The production of product enzyme；3) plasmid including genes of interest is easily lost, and needs to add a large amount of antibiotic in production, destroys ecological ring
Border.Therefore, the aminopeptidase recombinant bacterium building a strain energy high efficiency stable expression, genetic background clearly and beneficially purification has important meaning
Justice.
Summary of the invention
First technical problem that the invention solves the problems that is to provide the Pichia yeast engineering of a recombinant expressed proline aminopeptidase of strain.
Described Pichia yeast engineering is with Pichia pastoris GS115 as expressive host, with pPIC9K as expression vector, have expressed nucleoside
Acid sequence proline aminopeptidase gene as shown in SEQ ID NO.2.
Proline aminopeptidase gene shown in described SEQ ID NO.2, is to the proline aminopeptidase gene (SEQ from aspergillus oryzae
ID NO.1) be optimized after obtain.
Second technical problem that the invention solves the problems that is to provide a kind of method building described Pichia yeast engineering, mainly includes
Following steps:
(1) design genes of interest shown in primer amplification SEQ ID NO.2；The aminopeptidase of the aminopeptidase gene code that amplification obtains
N-end contain histidine-tagged；
(2) PCR primer is connected on Expression vector pPIC9K, it is thus achieved that recombiant plasmid；
(3) the recombinant vector Pme I checking order correct carries out single endonuclease digestion, after linearization for enzyme restriction, with Pichia sp. competence
Cell mixes, and carries out electroporated, and screening obtains recombinant yeast pichia pastoris.
The present invention also provides for a kind of method applying described Pichia yeast engineering fermenting and producing proline aminopeptidase, mainly include with
Lower step:
1. on picking YPD flat board activation bacterium colony in 25mL BMGY culture medium, 30 DEG C, 230rpm cultivate 20h；
2. culture fluid is placed in centrifugal collecting precipitation in sterile centrifugation tube, precipitation is heavily dissolved in 25mL BMMY culture medium 30 DEG C
Cultivating 168h, the methanol adding final concentration 0.5% every 24h in culture fluid carries out methanol induction；
3. the fermentation liquid that will obtain, centrifugal collection supernatant, it is the outer crude enzyme liquid of aminopeptidase born of the same parents, after bacterial sediment dilution certain multiple
Ultrasonication, i.e. obtains intracellular crude enzyme liquid after broken liquid is centrifugal.
Aminopeptidase gene is optimized by the present invention, and successful expression restructuring proline aminopeptidase in Pichia sp. first.
Comparing the recombinant yeast pichia pastoris expressing the most optimized aminopeptidase gene, enzymatic activities brings up to 1.66 times, and endocellular enzyme is lived and brought up to
2.1 again.Different from this gene intracellular expression in prokaryotic hosts escherichia coli, proline aminopeptidase obtains in recombinant yeast pichia pastoris
Having arrived merocrine secretion expression, and the enzyme work in shaking flask initial optimization after fermentation liquid supernatant is 5.6U/mL, endocellular enzyme work is
61.26U/mL.The inventive method is simply effective, the recombinant yeast pichia pastoris high efficient expression proline aminopeptidase of energy of structure, and restructuring
Albumen comprises histidine-tagged, beneficially the purification of later stage recombiant protein and be the research characteristic of proline aminopeptidase, knot further
Structures etc. provide desirable proteins.
Accompanying drawing explanation
PCR checking (M:Marker, 1-5: genes of interest) of Fig. 1 proline aminopeptidase (pap) recon
The double digestion checking of Fig. 2 recombiant plasmid pPIC9K-pap.(M:Marker, 1-3:pPIC9K-pap recombiant plasmid
Double digestion, P:pPIC9K plasmid)
Fig. 3 recombiant plasmid pPIC9K-pap structural representation
Fig. 4 recombinate proline aminopeptidase SDS-PAGE analyze (M: standard protein Marker, 1:P.pastoris
The broken supernatant of GS115/pPIC9K-pap cell precipitation, 2: destination protein)
The growth curve of Fig. 5 recombinant yeast pichia pastoris
Fig. 6 induces initial time that proline aminopeptidase is produced the impact of enzyme
Yeast is produced the impact of proline aminopeptidase by Fig. 7 methanol concentration
Detailed description of the invention
Used medium:
LB (g/L): tryptone 10, yeast extract 5, NaCl 10, pH 7.0；
YPD (g/L): peptone 20, glucose 20, agar 20；
MD (g/L): glucose 20, agar 20, YNB 13.4, biotin 0.4；
MM (g/L): methanol 5mL/L, agar 20, YNB 13.4, biotin 0.4；
BMGY (g/L): peptone 20, glycerol 10, yeast extract 10, YNB 13.4, biotin 0.4,100mM phosphoric acid
Salt buffer pH 6.0:
BMMY (g/L): peptone 20, methanol 10, yeast extract 10, YNB 13.4, biotin 0.4,100mM phosphoric acid
Salt buffer pH 6.0；
T4DNA ligase, restricted enzyme Bgl Ι I, EcoR I, Not Ι and Sal I and shared Buffer are purchased from precious biological
Engineering (Dalian) company limited.
Proline aminopeptidase enzyme activity determination method:
With L-PROLINE-paranitroanilinum as substrate, adding the Tris-HCl buffer of 2mL pH 7.5,1mL dilution is the most again
The enzyme liquid of number and 1mL substrate (2mM), 50 DEG C of reaction 10min, at 405nm, measure light absorption value, calculate enzyme activity.
Proline aminopeptidase enzyme is lived and is defined:
Under certain condition, decomposition L-PROLINE per minute-paranitroanilinum produces the enzyme amount required for the paranitroanilinum of 1 μM,
It is enzyme unit alive.
(wherein Abs is light absorption value at 405nm)
Embodiment 1 expresses the construction method of the recombinant yeast pichia pastoris of proline aminopeptidase.
For realizing the expression in Pichia sp. of the proline aminopeptidase gene, according to proline aminopeptidase gene design primer.
Forward primer P1:5 ＇-CCGGAATTC(underscore represents EcoR to ATGGCTGCCAAACTAGTAGAC-3 ＇
Ι restriction enzyme site)；
Downstream primer P2:5 ＇-ATAGTTTAGCGGCCGC(underscore represents CTAATCAATAGAGTCG-3 ＇
Not Ι restriction enzyme site)；
With comprise proline aminopeptidase gene pET-28a-pap plasmid as template, the construction method of this plasmid is recorded in the patent No.
For ZL 201310656778.3, invention entitled " strain produces the genetic engineering bacterium of proline aminopeptidase and construction method thereof "
In patent.P1 and P2 is primer amplification genes of interest.PCR system is (50 μ L): PrimerSTAR enzyme 25 μ L；
PET-28a-pap plasmid 1 μ L；P11μL；P21μL；ddH2O 22μL.PCR condition is: 94 DEG C of denaturations 5min；
94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C extend 90s；5min is extended after 72 DEG C；33 circulations.
The genes of interest that amplification is obtained and plasmid pPIC9K EcoR I and Not I double digestion, double digestion system is as follows:
Double digestion system (50 μ L) system: genes of interest/plasmid 16 μ L, the restriction each 2 μ L of enzyme, distilled water 10 μ L, 10 × H,
The each 5 μ L of BSA Buffer.37 DEG C of double digestion reaction 5h, after agarose gel electrophoresis 35min, glue reclaims purpose band.
Genes of interest after double digestion and carrier mixs by the ratio of mole mass ratio 8:1,16 DEG C of overnight also Transformed E .coli
JM109.Coat cultivation 12-16h in the LB culture medium containing ammonia benzyl resistance (100 μ g/mL).Picking 3 strain bacterium carries out PCR
Amplification and double digestion checking, verify and correct carry out sequencing, and checking order correct is recombinant vector pPIC9K-pap.
The making of Pichia sp. competent cell:
(1) picking Pichia pastoris GS115 list colony inoculation is to 5mL YPD Tube propagation overnight (10h)；
(2) receiving in 50mL YPD triangle shaking flask with 1% inoculum concentration, 30 DEG C of overnight incubation, to OD600Reach about 2.0
(12h)；
(3) take the centrifuge tube of 50mL sterilizing, each centrifuge tube loads 25mL bacterium solution, is placed in half an hour on ice；
(4) 4 DEG C, 4000rpm is centrifuged 6min, suspends with the sterilized water of 50mL pre-cooling；
(5) 4 DEG C, 4000rpm is centrifuged 6min, suspends with the sterilized water of 25mL pre-cooling；
(6) by step (5), centrifugal 6min, with the sorbitol washes of 10mL pre-cooling；
(7) precipitation is resuspended in 80 μ L sorbitol to obtain competent cell.
Take above-mentioned competent cell to mix with the pPIC9K-pap of Pme I linearization process, in 1500V, 400 Ω, 25/50 μ F,
Carry out electricity under the conditions of 4-6ms to turn, electricity is turned liquid and coats on MD flat board, cultivate 2-4d for 30 DEG C, after son to be transformed grows,
Picking list bacterium colony respectively point sample on MM and MD flat board, cultivates 2d for 30 DEG C, and wherein on MD flat board, normal growth is still
MM flat board grows and slower is the recombinant yeast pichia pastoris containing genes of interest.
The method of embodiment 2 restructured Pichia pastoris in expression proline aminopeptidase
Recombinant yeast pichia pastoris bacterium colony after picking activation in the BMGY culture medium of 25mL/250mL, 230rpm, 30 DEG C,
Cultivate 20h, then culture fluid 5000rpm is centrifuged 5min and collects thalline, be placed in 25/50mL with the resuspended thalline of BMMY
Triangular flask in, 230rpm, 25 DEG C cultivate 120h, middle add the methanol induction of final concentration 0.5% every 24h and also take 200
μ L fermentation liquid detection enzyme is lived.The fermentation liquid that will obtain, 10000rpm is centrifuged 5min, and supernatant is the outer crude enzyme liquid of aminopeptidase born of the same parents,
After bacterial sediment dilution certain multiple, ultrasonication 30min, 10000rpm i.e. obtain intracellular crude enzyme liquid after being centrifuged 5min.Broken
Condition is 6mm probe power 400W, and work 10s, intermittently 10s.Recording enzymatic activities is 0.93U/mL, and endocellular enzyme is lived
For 4.21U/mL.
Embodiment 3 is recombinated the gene optimization of proline aminopeptidase and histidine-tagged interpolation
(after the gene order order-checking after 1 optimization, insert pPIC9K carrier.Electricity after this vector linearization is transformed into GS115
Middle induction detection enzyme is lived, and construction method is with reference to embodiment 1, and expression is with reference to embodiment 2.Recording enzymatic activities is 1.55U/mL,
Bringing up to 1.66 times, endocellular enzyme is lived and is brought up to 2.1 times.
(2) for the extraction purification of beneficially later stage recombiant protein, with the proline aminopeptidase gene design two after optimizing to primer,
N end and C end at gene add histidine-tagged respectively.
N end adds histidine-tagged primer:
Forward primer P3:
5 ＇-CCGGAATTCATGCATCATCATCATCATCAT(underscore represents GCTGCCAAGCTTGT-3 ＇
EcoR Ι restriction enzyme site, dotted line represents 6 × His sequence)；
Downstream primer P4:
(underscore represents Not Ι enzyme to 5 ＇-ATAGTTTAGCGGCCGCTTAATCAATACTGTCATCTCTC-3 ＇
Cut site)；
C end adds histidine-tagged primer:
Forward primer P5:5 ＇-CCGGAATTC(underscore represents EcoR Ι enzyme to ATGGCTGCCAAGCTTGTT-3 ＇
Cut site)；
Downstream primer P6:5 ＇-
ATAGTTTAGCGGCCGCTTAATGATGATGATGATGATGATCAATACTGTCATCTCTC-3 ＇
(underscore represents Not Ι restriction enzyme site, and dotted line represents 6 × His reverse complementary sequence).
Respectively with P3, P4 and P5, P6 as primer, carry out PCR with the recombiant plasmid of aminopeptidase sequence after including optimization for template,
Check order after connecting pPIC9K.Extract the successful plasmid that checks order, carry out linearisation with BglII and Sal I respectively, build Muts
And Mut+Recon.Picking recon screens on the YPD flat board of the final concentration of 2mg/mL of Geneticin, and picking grows
Preferably carrying out methanol induction cultivation, detection enzyme is lived.Construction method is with reference to embodiment 1, and expression is with reference to embodiment 2.Result
Show C end add 6 × the bacterial strain intracellular of His label outside all live without enzyme, N end add the bacterial strain intracellular exoenzyme of 6 × His label live all with
The most close, the histidine-tagged aminopeptidase that produces recombinant bacterium of N end, without impact, can suppress, at 6 × His of C end, aminopeptidase of recombinating
Expression.Additionally, methanol utilizes fast type Mut+Recon induction 96 hours after, its intracellular exoenzyme live compares MutsType is high by 35%,
Enzymatic activities compares MutsType is high by 25%, therefore selects Mut+The fermentation strain studied as the later stage of recombinant bacterial strain.
The conditions of flask fermentation optimization of embodiment 4 recombinant yeast pichia pastoris:
(1) induction methanol concentration: recombinant yeast pichia pastoris is transferred after BMMY culture fluid, adds certain density every 24h
Methanol is induced, and concentration selects 1.0%, 1.2%, 1.4%, 1.6%, 1.8%, 2.0%, and periodically sampling carries out aminopeptidase enzyme
The mensuration lived.
(2) transit time: recombinant yeast pichia pastoris is inoculated in BMGY, cultivates 12h, 14h, 16h, 18h, 20h respectively
Then it is forwarded in BMMY culture medium, 230r min-1, 30 DEG C of constant-temperature tables carry out fermentation culture, periodically add methanol induction also
Sampling is surveyed fermentation broth enzyme and is lived.
(3) the initial pH of induction: recombinant yeast pichia pastoris is transferred respectively in using 10mol L-1KOH and pure H3PO4(all filter
Degerming) the BMMY culture medium that pH value is 5.0,6.0,7.0,8.0 allocated, 230r min-1, 30 DEG C of constant-temperature tables carry out
Fermentation culture, periodically adds methanol induction and samples survey fermentation broth enzyme work.
(4) inducing temperature: yeast can grow within the temperature range of 20-30 DEG C, wherein 30 DEG C is optimum growth temperature,
And the relatively low temperature of induction period potentially contributes to the raising of exogenous protein expression amount.Therefore trophophase selection temperature 30 DEG C, and induction period
The several different temperatures gradient of 20 DEG C, 23 DEG C, 26 DEG C, 28 DEG C and 30 DEG C is selected to carry out abduction delivering.Periodically add methanol induction also
Sampling is surveyed fermentation broth enzyme and is lived.
(5) sorbitol addition: sorbitol, as a kind of non-inhibited carbon source, will not suppress the thalline utilization to methanol, on the contrary can
Metabolism burden when effectively alleviating cell mass expressing external albumen caused self, the murder by poisoning that simultaneously can also reduce methanol is made
With, improve transformation efficiency.Therefore induction period adds sorbitol (the 3g L of different initial concentration in Shake flask medium-1、5g·L-1、
7g·L-1、9g·L-1、11g·L-1), investigate the impact of its expression that aminopeptidase enzyme is lived.
Through the shaking flask optimization to product aminopeptidase recombinant bacterium, result shows to induce initial time and methanol concentration to have enzymatic production
Significant impact.As it is shown in figure 5, recombinant bacterium is in fast growing period at 10-24h, after cultivating 18h in BMGY culture medium
I.e. can ensure that the enough thalline of accumulation can make again recombinant bacterium have good activity.After optimizing, recombinant yeast pichia pastoris
Final expression condition is: on picking YPD flat board single bacterium colony of activation in 25mL BMGY culture medium (pH 6.0) in, 30 DEG C,
After 230rpm cultivates 18h, it is transferred in the equal-volume BMMY culture medium that pH is 6.0, cultivates 144h for 30 DEG C, every
24h adds the methanol of final concentration 1.8% in culture fluid and carries out methanol induction.Proline aminopeptidase table after shaking flask initial optimization
The amount of reaching increases substantially, and it is 5.6U/mL that the enzyme in fermented liquid supernatant is lived, and endocellular enzyme is lived as 61.26U/mL.
Although the present invention is open the most as above with preferred embodiment, but it is not limited to the present invention, any person skilled in the art,
Without departing from the spirit and scope of the present invention, all can do various changes and modification, therefore protection scope of the present invention should be with
What claims were defined is as the criterion.
Claims (5)
1. the Pichia yeast engineering of a recombinant expressed proline aminopeptidase of strain, it is characterised in that described Pichia yeast engineering is
With Pichia pastoris GS115 as expressive host, with pPIC9K as expression vector, have expressed nucleotide sequence such as SEQ ID NO.2
Shown proline aminopeptidase gene.
2. the method building Pichia yeast engineering described in claim 1, it is characterised in that mainly comprise the steps that
(1) design genes of interest shown in primer amplification SEQ ID NO.2；The aminopeptidase of the aminopeptidase gene code that amplification obtains
N-end contain histidine-tagged；
(2) PCR primer is connected on Expression vector pPIC9K, it is thus achieved that recombiant plasmid；
(3) the recombinant vector Pme I checking order correct carries out single endonuclease digestion, after linearization for enzyme restriction, with Pichia sp. competence
Cell mixes, and carries out electroporated, and screening obtains recombinant yeast pichia pastoris.
3. apply the method for Pichia yeast engineering fermenting and producing proline aminopeptidase described in claim 1 for one kind, it is characterised in that
Mainly comprise the steps that
(on 1 picking YPD flat board activation bacterium colony in 25mL BMGY culture medium, 30 DEG C, 230rpm cultivate 20h；
(2) culture fluid is placed in centrifugal collecting precipitation in sterile centrifugation tube, precipitation is heavily dissolved in 25mL BMMY culture medium
Cultivating 168h for 30 DEG C, the methanol adding final concentration 0.5% every 24h in culture fluid carries out methanol induction；
(3) fermentation liquid that will obtain, centrifugal collection supernatant, it is the outer crude enzyme liquid of aminopeptidase born of the same parents, certain times of bacterial sediment dilution
Ultrasonication after number, i.e. obtains intracellular crude enzyme liquid after broken liquid is centrifugal.
4. a proline aminopeptidase gene, it is characterised in that nucleotide sequence is as shown in SEQ ID NO.2.
5. the application in proline aminopeptidase produces of the Pichia yeast engineering described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610202929.1A CN105733973A (en) | 2016-04-01 | 2016-04-01 | Recombinant pichia pastoris expressing proline aminopeptidase and construction method of recombinant pichia pastoris |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610202929.1A CN105733973A (en) | 2016-04-01 | 2016-04-01 | Recombinant pichia pastoris expressing proline aminopeptidase and construction method of recombinant pichia pastoris |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105733973A true CN105733973A (en) | 2016-07-06 |
Family
ID=56253550
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610202929.1A Pending CN105733973A (en) | 2016-04-01 | 2016-04-01 | Recombinant pichia pastoris expressing proline aminopeptidase and construction method of recombinant pichia pastoris |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105733973A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106676087A (en) * | 2017-02-08 | 2017-05-17 | 宁波希诺亚海洋生物科技有限公司 | Preparation method of proline endonuclease |
| CN106967703A (en) * | 2017-04-20 | 2017-07-21 | 江南大学 | A kind of method for preparing N glycosylation proline aminopeptidases and application |
| CN109468240A (en) * | 2018-11-15 | 2019-03-15 | 江南大学 | A kind of recombinant yeast pichia pastoris and its construction method for expressing asparagine aminopeptidase |
| CN113584005A (en) * | 2021-08-27 | 2021-11-02 | 江南大学 | Preparation of aminopeptidase and application of aminopeptidase in protein debittering |
| CN115896072A (en) * | 2022-10-27 | 2023-04-04 | 深圳润康生态环境股份有限公司 | Aminopeptidase BmAP, mutant BmAPM and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103695361A (en) * | 2013-12-06 | 2014-04-02 | 江南大学 | Genetically engineered bacteria for producing proline aminopeptidase and construction method thereof |
| CN104928315A (en) * | 2015-07-02 | 2015-09-23 | 江南大学 | Construction and expression method of recombinant pichia pastoris strain expressing lysine aminopeptidase |
-
2016
- 2016-04-01 CN CN201610202929.1A patent/CN105733973A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103695361A (en) * | 2013-12-06 | 2014-04-02 | 江南大学 | Genetically engineered bacteria for producing proline aminopeptidase and construction method thereof |
| CN104928315A (en) * | 2015-07-02 | 2015-09-23 | 江南大学 | Construction and expression method of recombinant pichia pastoris strain expressing lysine aminopeptidase |
Non-Patent Citations (1)
| Title |
|---|
| GUO-WEI DING ET AL.: "Over-Expression of a Proline Specific Aminopeptidase from Aspergillus oryzae JN-412 and Its Application in Collagen Degradation", 《APPL BIOCHEM BIOTECHNOL》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106676087A (en) * | 2017-02-08 | 2017-05-17 | 宁波希诺亚海洋生物科技有限公司 | Preparation method of proline endonuclease |
| CN106967703A (en) * | 2017-04-20 | 2017-07-21 | 江南大学 | A kind of method for preparing N glycosylation proline aminopeptidases and application |
| CN109468240A (en) * | 2018-11-15 | 2019-03-15 | 江南大学 | A kind of recombinant yeast pichia pastoris and its construction method for expressing asparagine aminopeptidase |
| CN113584005A (en) * | 2021-08-27 | 2021-11-02 | 江南大学 | Preparation of aminopeptidase and application of aminopeptidase in protein debittering |
| CN113584005B (en) * | 2021-08-27 | 2024-03-01 | 江南大学 | Preparation of aminopeptidase and application of aminopeptidase in protein debittering |
| CN115896072A (en) * | 2022-10-27 | 2023-04-04 | 深圳润康生态环境股份有限公司 | Aminopeptidase BmAP, mutant BmAPM and application thereof |
| CN115896072B (en) * | 2022-10-27 | 2023-09-05 | 深圳润康生态环境股份有限公司 | Aminopeptidase BmAp, mutant BmApM and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105733973A (en) | Recombinant pichia pastoris expressing proline aminopeptidase and construction method of recombinant pichia pastoris | |
| CN101492661B (en) | Clone, expression of beta-glucosidase gene, and preparation for gentian oligose | |
| CN104004672B (en) | A kind of Pichia sp. integrates the method for the outer N-glycosylation bacillus subtilis leucine amino peptidase of high efficient expression born of the same parents | |
| CN102146135A (en) | Recombinant human-like collagen and production method thereof | |
| CN104611317B (en) | A kind of method for improving L-ASP secreting, expressing | |
| CN104402975B (en) | Anti-aging small peptide and preparation method thereof | |
| CN104928315A (en) | Construction and expression method of recombinant pichia pastoris strain expressing lysine aminopeptidase | |
| CN106834336A (en) | A kind of heterogenous expression and purification process of Trichoderma harzianum acid protease P6281 | |
| CN103898153A (en) | Multi-copy metallothionein recombinant expression vector and method thereof for high-efficiency expression of metallothionein | |
| CN102676561B (en) | Recombinant bacterium for expressing keratinase and fermentation method thereof | |
| CN110616227A (en) | Gene, recombinant expression vector, engineering strain and application of anti-freeze protein from tenebrio molitor | |
| CN109957520A (en) | Exogenous gene expression Pichi strain | |
| CN102020712B (en) | Human-like collagen for vaccine stabilizing agent and production method thereof | |
| CN112522125B (en) | Hyaluronidase engineering bacterium and construction method and application thereof | |
| CN104278017A (en) | Recombinant expression method of human lysozyme | |
| CN108424894B (en) | Thermophilic fungus cutinase and coding gene and application thereof | |
| CN103194434A (en) | Novel sulfolobus solfataricus trehalose hydrolase, gene of hydrolase, recombinant expression vector containing gene, and recombinant bacterium, and preparation of hydrolase | |
| CN103146818B (en) | Recombinase Cre modification method, and application of modified recombinase Cre in plants | |
| CN101892168A (en) | Pichiapastoris expression strain for recombinant duck interleukin 2 and construction method and application thereof | |
| CN113717915B (en) | Xanthomonas oryzae with ACC deaminase expressed on surface as well as construction method and application thereof | |
| CN109182309A (en) | A kind of heat resistant type aminopeptidase and its high yield Pichia yeast engineering | |
| CN105734066B (en) | A kind of building of the eukaryon Hansenula yeast engineering bacteria containing recombinant hepatitis B virus gene and the production method of hepatitis B surface antigen | |
| CN103966110A (en) | Penicillium oxalicum host strain for enhancing expression of filamentous fungi protein | |
| CN104711274B (en) | A kind of preparation method and applications recombinating penicillium amagasakiense glucose oxidase | |
| CN102747067B (en) | Application of TrPK protein in cellulase yield adjustment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160706 |
|
| RJ01 | Rejection of invention patent application after publication |